Illumina Next Generation Sequencing Data analysis

Size: px
Start display at page:

Download "Illumina Next Generation Sequencing Data analysis"

Transcription

1 Illumina Next Generation Sequencing Data analysis Chiara Dal Fiume Sr Field Application Scientist Italy 2010 Illumina, Inc. All rights reserved. Illumina, illuminadx, Solexa, Making Sense Out of Life, Oligator, Sentrix, GoldenGate, GoldenGate Indexing, DASL, BeadArray, Array of Arrays, Infinium, BeadXpress, VeraCode, IntelliHyb, iselect, CSPro, GenomeStudio, Genetic Energy, HiSeq, and HiScan are registered trademarks or trademarks of Illumina, Inc. All other brands and names contained herein are the property of their respective owners.

2 Illumina Sequencing Workflow Sample Prep Analysis Instrumentation Primary Analysis Secondary Analysis 2

3 Illumina Sequencing Workflow Outcomes Clusters Images/TIFF files Sample Prep Analysis Instrumentation Primary (DNA Library) Intensities Basecalling Secondary Alignments 3

4 4 Primary Analysis Processes

5 Primary Data Analysis Components Instrument Control Software Provides a graphical interface while running the instrument Real Time Analysis (RTA) Component within the Instrument Control Software that monitors the run s progress, optimizes run conditions and provides run-time quality statistics Off-Line Base Caller (OLB) Provides the option to perform data analysis off-line Firecrest (image analysis) Instrument Control Software RTA CIF/files Primary Analysis Bustard (base calling) Off-Line Basecaller CASAVA Secondary Analysis bcl Samplesheet.csv CASAVA Build GenomeStudio or third party apps. 5

6 6

7 Cluster Detection Algorithm Maximum Threshold Cluster 7

8 Multi-Cycle Detection of Cluster Positions Better resolution of some overlapping clusters e.g. when two overlapping clusters are the same base in cycle 1 Cluster detection is performed over 4 cycles CYCLE 1 G channel Difficult to resolve overlapping clusters in one cycle only, when there are overlapping clusters of the same base G channel CYCLE 2 C channel By detecting cluster positions in multiple cycles there is a better chance of resolving overlapping clusters since they are less likely to be of the same base in multiple cycles 8

9 9 Base Calling Algorithm

10 Base calling Algorithms: Base calling and quality filtering Corrected Intensity C A C G T I A I B A C G T Filter clusters by signal purity Second-lowest CHASTITY at least 0.6 in first 25 cycles Looks at more cycles Allows one bad cycle Better error rate for given yield C I A I A I B CHASTITY Formula 10

11 SAV software monitoring run quality 11

12 12 12 Secondary Analysis

13 What is CASAVA? Consensus Assessment of Sequence And VAriation (CASAVA) is a Linux application designed to: Demultiplex samples Align reads Call SNPs Find indels Count expression level for exons, genes and splice junctions in case of RNA-seq runs Primary Analysis CASAVA s output is a folder structure (called a CASAVA Build ) ready for import into GenomeStudio for visualization and further analysis Gerald (Eland v2) Secondary SNP and Analysis Multiple *_export.txt + other files script for multiplexed run Indel Calls Counting For mrna CASAVA Build Data Visualization 13

14 CASAVA 1.8 BCL converter Converter part of CASAVA Generate fastq using ASCII offset of 33 Perform demultiplexing Data analysis on a per Sample basis Data manipulation and sharing greatly facilitated Common data formats (BAM and FastQ) Easier to handle and share Lots of other software available that work with BAM/FastQ 14

15 Secondary and Tertiary Analysis The biological visualization RNA-Seq: Tuxedo suite, Bioconductor, Third party tools MetaGenomics NextGEne, CLCbio, Megan SNP & Indel Detection ELAND/CASAVA, BWA/SAMTools, DeNovo Assembly Abyss, Velvet, SoapDenovo 15

16 Burrows-Wheeler Aligner BWA aligns relatively short nucleotide sequences against a long reference sequence such as the human genome. BWA has two major components, one for read shorter than 150bp and the other for longer reads. Bwa-short: algorithm that works for query sequences shorter than 150bp BWA-SW: algorithm that works for longer sequences up to around 100kbp. BWA Main features: Gapped alignment and paired-end mapping Accurate, fast and lightweight BWA-SW component is able to find chimera. 16

17 Sequence Alignment/Map SAM is a generic format for storing large nucleotide sequence alignments. SAM main features: Flexibility: store all the alignment information generated by various alignment tools Simplicity: easily generated by alignment programs or converted from existing alignment formats Compact in file size Allows the file to be indexed by genomic position to efficiently retrieve all reads aligning to a locus. SAM Tools provide various utilities for manipulating alignments in the SAM format, including sorting, merging, indexing and generating alignments in a per-position format. 17

18 The "Tuxedo Suite : Secondary analysis applications for RNA-seq Aligning Short Reads to References with Bowtie, Tophat, and Cufflinks Provide directions on how to convert Illumina sequence output to: Measures of differential expression Discover splice forms Bowtie Tuxedo suite Cufflinks TopHat 18

19 19 Thank you

GenomeStudio Software Release Notes

GenomeStudio Software Release Notes GenomeStudio Software 2009.2 Release Notes 1. GenomeStudio Software 2009.2 Framework... 1 2. Illumina Genome Viewer v1.5...2 3. Genotyping Module v1.5... 4 4. Gene Expression Module v1.5... 6 5. Methylation

More information

HiSeq Instrument Software Release Notes

HiSeq Instrument Software Release Notes HiSeq Instrument Software Release Notes HCS v2.0.12 RTA v1.17.21.3 Recipe Fragments v1.3.61 Illumina BaseSpace Broker v2.0.13022.1628 SAV v1.8.20 For HiSeq 2000 and HiSeq 1000 Systems FOR RESEARCH USE

More information

Image Analysis and Base Calling Sarah Reid FAS

Image Analysis and Base Calling Sarah Reid FAS Image Analysis and Base Calling Sarah Reid FAS For Research Use Only. Not for use in diagnostic procedures. 2016 Illumina, Inc. All rights reserved. Illumina, 24sure, BaseSpace, BeadArray, BlueFish, BlueFuse,

More information

High-throughput sequencing: Alignment and related topic. Simon Anders EMBL Heidelberg

High-throughput sequencing: Alignment and related topic. Simon Anders EMBL Heidelberg High-throughput sequencing: Alignment and related topic Simon Anders EMBL Heidelberg Established platforms HTS Platforms Illumina HiSeq, ABI SOLiD, Roche 454 Newcomers: Benchtop machines 454 GS Junior,

More information

High-throughput sequencing: Alignment and related topic. Simon Anders EMBL Heidelberg

High-throughput sequencing: Alignment and related topic. Simon Anders EMBL Heidelberg High-throughput sequencing: Alignment and related topic Simon Anders EMBL Heidelberg Established platforms HTS Platforms Illumina HiSeq, ABI SOLiD, Roche 454 Newcomers: Benchtop machines: Illumina MiSeq,

More information

Galaxy Platform For NGS Data Analyses

Galaxy Platform For NGS Data Analyses Galaxy Platform For NGS Data Analyses Weihong Yan wyan@chem.ucla.edu Collaboratory Web Site http://qcb.ucla.edu/collaboratory Collaboratory Workshops Workshop Outline ü Day 1 UCLA galaxy and user account

More information

Sequencing. Short Read Alignment. Sequencing. Paired-End Sequencing 6/10/2010. Tobias Rausch 7 th June 2010 WGS. ChIP-Seq. Applied Biosystems.

Sequencing. Short Read Alignment. Sequencing. Paired-End Sequencing 6/10/2010. Tobias Rausch 7 th June 2010 WGS. ChIP-Seq. Applied Biosystems. Sequencing Short Alignment Tobias Rausch 7 th June 2010 WGS RNA-Seq Exon Capture ChIP-Seq Sequencing Paired-End Sequencing Target genome Fragments Roche GS FLX Titanium Illumina Applied Biosystems SOLiD

More information

EcoStudy Software User Guide

EcoStudy Software User Guide EcoStudy Software User Guide FOR RESEARCH USE ONLY What is EcoStudy? 3 Setting Up a Study 4 Specifying Analysis Settings for your Study 6 Reviewing the Data in your Study 8 Exporting Study Data to a Report

More information

RNA Sequencing with TopHat and Cufflinks

RNA Sequencing with TopHat and Cufflinks RNA Sequencing with TopHat and Cufflinks Introduction 3 Run TopHat App 4 TopHat App Output 5 Run Cufflinks 18 Cufflinks App Output 20 RNAseq Methods 27 Technical Assistance ILLUMINA PROPRIETARY 15050962

More information

Using Pipeline Output Data for Whole Genome Alignment

Using Pipeline Output Data for Whole Genome Alignment Using Pipeline Output Data for Whole Genome Alignment FOR RESEARCH ONLY Topics 4 Introduction 4 Pipeline 4 Maq 4 GBrowse 4 Hardware Requirements 5 Workflow 6 Preparing to Run Maq 6 UNIX/Linux Environment

More information

Sequence Analysis Pipeline

Sequence Analysis Pipeline Sequence Analysis Pipeline Transcript fragments 1. PREPROCESSING 2. ASSEMBLY (today) Removal of contaminants, vector, adaptors, etc Put overlapping sequence together and calculate bigger sequences 3. Analysis/Annotation

More information

mtdna Variant Processor v1.0 BaseSpace App Guide

mtdna Variant Processor v1.0 BaseSpace App Guide mtdna Variant Processor v1.0 BaseSpace App Guide For Research Use Only. Not for use in diagnostic procedures. Introduction 3 Workflow Diagram 4 Workflow 5 Log In to BaseSpace 6 Set Analysis Parameters

More information

Galaxy workshop at the Winter School Igor Makunin

Galaxy workshop at the Winter School Igor Makunin Galaxy workshop at the Winter School 2016 Igor Makunin i.makunin@uq.edu.au Winter school, UQ, July 6, 2016 Plan Overview of the Genomics Virtual Lab Introduce Galaxy, a web based platform for analysis

More information

BaseSpace User Guide FOR RESEARCH USE ONLY

BaseSpace User Guide FOR RESEARCH USE ONLY BaseSpace User Guide FOR RESEARCH USE ONLY Introduction 3 How Do I Start 7 BaseSpace User Interface 11 How To Use BaseSpace 21 Workflow Reference 44 Data Reference 50 Technical Assistance ILLUMINA PROPRIETARY

More information

RNA-seq. Manpreet S. Katari

RNA-seq. Manpreet S. Katari RNA-seq Manpreet S. Katari Evolution of Sequence Technology Normalizing the Data RPKM (Reads per Kilobase of exons per million reads) Score = R NT R = # of unique reads for the gene N = Size of the gene

More information

Illumina Experiment Manager User Guide

Illumina Experiment Manager User Guide Illumina Experiment Manager User Guide For Research Use Only. Not for use in diagnostic procedures. What is Illumina Experiment Manager? 3 Getting Started 4 Creating a Sample Plate 7 Creating a Sample

More information

NGS Analysis Using Galaxy

NGS Analysis Using Galaxy NGS Analysis Using Galaxy Sequences and Alignment Format Galaxy overview and Interface Get;ng Data in Galaxy Analyzing Data in Galaxy Quality Control Mapping Data History and workflow Galaxy Exercises

More information

Local Run Manager Resequencing Analysis Module Workflow Guide

Local Run Manager Resequencing Analysis Module Workflow Guide Local Run Manager Resequencing Analysis Module Workflow Guide For Research Use Only. Not for use in diagnostic procedures. Overview 3 Set Parameters 4 Analysis Methods 6 View Analysis Results 8 Analysis

More information

RNA-Seq in Galaxy: Tuxedo protocol. Igor Makunin, UQ RCC, QCIF

RNA-Seq in Galaxy: Tuxedo protocol. Igor Makunin, UQ RCC, QCIF RNA-Seq in Galaxy: Tuxedo protocol Igor Makunin, UQ RCC, QCIF Acknowledgments Genomics Virtual Lab: gvl.org.au Galaxy for tutorials: galaxy-tut.genome.edu.au Galaxy Australia: galaxy-aust.genome.edu.au

More information

Mapping NGS reads for genomics studies

Mapping NGS reads for genomics studies Mapping NGS reads for genomics studies Valencia, 28-30 Sep 2015 BIER Alejandro Alemán aaleman@cipf.es Genomics Data Analysis CIBERER Where are we? Fastq Sequence preprocessing Fastq Alignment BAM Visualization

More information

Dr. Gabriela Salinas Dr. Orr Shomroni Kaamini Rhaithata

Dr. Gabriela Salinas Dr. Orr Shomroni Kaamini Rhaithata Analysis of RNA sequencing data sets using the Galaxy environment Dr. Gabriela Salinas Dr. Orr Shomroni Kaamini Rhaithata Microarray and Deep-sequencing core facility 30.10.2017 RNA-seq workflow I Hypothesis

More information

MiSeq System User Guide

MiSeq System User Guide MiSeq System User Guide FOR RESEARCH USE ONLY ILLUMINA PROPRIETARY Part # 15027617 Rev. A August 2011 This document and its contents are proprietary to Illumina, Inc. and its affiliates ("Illumina"), and

More information

BaseSpace User Guide. Supporting the NextSeq, MiSeq, and HiSeq Sequencing Systems FOR RESEARCH USE ONLY

BaseSpace User Guide. Supporting the NextSeq, MiSeq, and HiSeq Sequencing Systems FOR RESEARCH USE ONLY BaseSpace User Guide Supporting the NextSeq, MiSeq, and HiSeq Sequencing Systems FOR RESEARCH USE ONLY Introduction 3 How Do I Start 8 BaseSpace User Interface 13 How To Use BaseSpace 25 Workflow Reference

More information

AutoLoader 2.x User Guide

AutoLoader 2.x User Guide AutoLoader 2.x User Guide FOR RESEARCH USE ONLY Topics 3 Introduction 4 Supported Configurations 7 AutoLoader 2.x Components 9 Process Overview 10 Powering Up the AutoLoader 2.x 11 Starting the AutoLoader

More information

Under the Hood of Alignment Algorithms for NGS Researchers

Under the Hood of Alignment Algorithms for NGS Researchers Under the Hood of Alignment Algorithms for NGS Researchers April 16, 2014 Gabe Rudy VP of Product Development Golden Helix Questions during the presentation Use the Questions pane in your GoToWebinar window

More information

RNA-seq Data Analysis

RNA-seq Data Analysis Seyed Abolfazl Motahari RNA-seq Data Analysis Basics Next Generation Sequencing Biological Samples Data Cost Data Volume Big Data Analysis in Biology تحلیل داده ها کنترل سیستمهای بیولوژیکی تشخیص بیماریها

More information

NGS Data Visualization and Exploration Using IGV

NGS Data Visualization and Exploration Using IGV 1 What is Galaxy Galaxy for Bioinformaticians Galaxy for Experimental Biologists Using Galaxy for NGS Analysis NGS Data Visualization and Exploration Using IGV 2 What is Galaxy Galaxy for Bioinformaticians

More information

Bioinformatics in next generation sequencing projects

Bioinformatics in next generation sequencing projects Bioinformatics in next generation sequencing projects Rickard Sandberg Assistant Professor Department of Cell and Molecular Biology Karolinska Institutet March 2011 Once sequenced the problem becomes computational

More information

Local Run Manager Amplicon Analysis Module Workflow Guide

Local Run Manager Amplicon Analysis Module Workflow Guide Local Run Manager Amplicon Analysis Module Workflow Guide For Research Use Only. Not for use in diagnostic procedures. Overview 3 Set Parameters 4 Analysis Methods 6 View Analysis Results 9 Analysis Report

More information

Accelrys Pipeline Pilot and HP ProLiant servers

Accelrys Pipeline Pilot and HP ProLiant servers Accelrys Pipeline Pilot and HP ProLiant servers A performance overview Technical white paper Table of contents Introduction... 2 Accelrys Pipeline Pilot benchmarks on HP ProLiant servers... 2 NGS Collection

More information

KaryoStudio v1.4 User Guide

KaryoStudio v1.4 User Guide KaryoStudio v1.4 User Guide FOR RESEARCH USE ONLY ILLUMINA PROPRIETARY Part # 11328837 Rev. C June 2011 Notice This document and its contents are proprietary to Illumina, Inc. and its affiliates ("Illumina"),

More information

Demultiplexing Illumina sequencing data containing unique molecular indexes (UMIs)

Demultiplexing Illumina sequencing data containing unique molecular indexes (UMIs) next generation sequencing analysis guidelines Demultiplexing Illumina sequencing data containing unique molecular indexes (UMIs) See what more we can do for you at www.idtdna.com. For Research Use Only

More information

Introduction to Read Alignment. UCD Genome Center Bioinformatics Core Tuesday 15 September 2015

Introduction to Read Alignment. UCD Genome Center Bioinformatics Core Tuesday 15 September 2015 Introduction to Read Alignment UCD Genome Center Bioinformatics Core Tuesday 15 September 2015 From reads to molecules Why align? Individual A Individual B ATGATAGCATCGTCGGGTGTCTGCTCAATAATAGTGCCGTATCATGCTGGTGTTATAATCGCCGCATGACATGATCAATGG

More information

Bioinformatics for High-throughput Sequencing

Bioinformatics for High-throughput Sequencing Bioinformatics for High-throughput Sequencing An Overview Simon Anders EBI is an Outstation of the European Molecular Biology Laboratory. Overview In recent years, new sequencing schemes, also called high-throughput

More information

MiSeq Reporter Amplicon DS Workflow Guide

MiSeq Reporter Amplicon DS Workflow Guide MiSeq Reporter Amplicon DS Workflow Guide For Research Use Only. Not for use in diagnostic procedures. Introduction 3 Amplicon DS Workflow Overview 4 Optional Settings for the Amplicon DS Workflow 7 Analysis

More information

Colorado State University Bioinformatics Algorithms Assignment 6: Analysis of High- Throughput Biological Data Hamidreza Chitsaz, Ali Sharifi- Zarchi

Colorado State University Bioinformatics Algorithms Assignment 6: Analysis of High- Throughput Biological Data Hamidreza Chitsaz, Ali Sharifi- Zarchi Colorado State University Bioinformatics Algorithms Assignment 6: Analysis of High- Throughput Biological Data Hamidreza Chitsaz, Ali Sharifi- Zarchi Although a little- bit long, this is an easy exercise

More information

Long Read RNA-seq Mapper

Long Read RNA-seq Mapper UNIVERSITY OF ZAGREB FACULTY OF ELECTRICAL ENGENEERING AND COMPUTING MASTER THESIS no. 1005 Long Read RNA-seq Mapper Josip Marić Zagreb, February 2015. Table of Contents 1. Introduction... 1 2. RNA Sequencing...

More information

High-throughout sequencing and using short-read aligners. Simon Anders

High-throughout sequencing and using short-read aligners. Simon Anders High-throughout sequencing and using short-read aligners Simon Anders High-throughput sequencing (HTS) Sequencing millions of short DNA fragments in parallel. a.k.a.: next-generation sequencing (NGS) massively-parallel

More information

BaseSpace Onsite v2.1 HT System Guide

BaseSpace Onsite v2.1 HT System Guide BaseSpace Onsite v2.1 HT System Guide For Research Use Only. Not for use in diagnostic procedures. Revision History 6 Introduction 7 Getting Started 12 BaseSpace Onsite User Interface 17 How To Use BaseSpace

More information

Illumina LIMS User Guide

Illumina LIMS User Guide This document and its contents are proprietary to Illumina, Inc. and its affiliates ("Illumina"), and are intended solely for the contractual use of its customer in connection with the use of the product(s)

More information

Designing Custom GoldenGate Genotyping Assays

Designing Custom GoldenGate Genotyping Assays Designing Custom GoldenGate Genotyping Assays Guidelines for efficiently creating and ordering high-quality custom GoldenGate Genotyping Assays using the Illumina Assay Design Tool. Introduction The Illumina

More information

Using Genome Analyzer Sequencing Control Software Version 2.5

Using Genome Analyzer Sequencing Control Software Version 2.5 Using Genome Analyzer Sequencing Control Software Version 2.5 FOR RESEARCH USE ONLY Topics 3 Introduction 4 Run Parameters Window 8 Data Collection Software Interface 12 Recipe Viewer 13 Reagent Tracking

More information

Designing Custom GoldenGate Genotyping Assays

Designing Custom GoldenGate Genotyping Assays Designing Custom GoldenGate Genotyping Assays Guidelines for efficiently creating and ordering high-quality custom GoldenGate Genotyping Assays using the Illumina Assay Design Tool. Introduction The Illumina

More information

Sequence mapping and assembly. Alistair Ward - Boston College

Sequence mapping and assembly. Alistair Ward - Boston College Sequence mapping and assembly Alistair Ward - Boston College Sequenced a genome? Fragmented a genome -> DNA library PCR amplification Sequence reads (ends of DNA fragment for mate pairs) We no longer have

More information

RNA Sequencing with TopHat Alignment v1.0 and Cufflinks Assembly & DE v1.1 App Guide

RNA Sequencing with TopHat Alignment v1.0 and Cufflinks Assembly & DE v1.1 App Guide RNA Sequencing with TopHat Alignment v1.0 and Cufflinks Assembly & DE v1.1 App Guide For Research Use Only. Not for use in diagnostic procedures. Introduction 3 Set Analysis Parameters TopHat 4 Analysis

More information

Omega: an Overlap-graph de novo Assembler for Metagenomics

Omega: an Overlap-graph de novo Assembler for Metagenomics Omega: an Overlap-graph de novo Assembler for Metagenomics B a h l e l H a i d e r, Ta e - H y u k A h n, B r i a n B u s h n e l l, J u a n j u a n C h a i, A l e x C o p e l a n d, C h o n g l e Pa n

More information

Genomic Files. University of Massachusetts Medical School. October, 2014

Genomic Files. University of Massachusetts Medical School. October, 2014 .. Genomic Files University of Massachusetts Medical School October, 2014 2 / 39. A Typical Deep-Sequencing Workflow Samples Fastq Files Fastq Files Sam / Bam Files Various files Deep Sequencing Further

More information

NGS Data and Sequence Alignment

NGS Data and Sequence Alignment Applications and Servers SERVER/REMOTE Compute DB WEB Data files NGS Data and Sequence Alignment SSH WEB SCP Manpreet S. Katari App Aug 11, 2016 Service Terminal IGV Data files Window Personal Computer/Local

More information

Maize genome sequence in FASTA format. Gene annotation file in gff format

Maize genome sequence in FASTA format. Gene annotation file in gff format Exercise 1. Using Tophat/Cufflinks to analyze RNAseq data. Step 1. One of CBSU BioHPC Lab workstations has been allocated for your workshop exercise. The allocations are listed on the workshop exercise

More information

Read mapping with BWA and BOWTIE

Read mapping with BWA and BOWTIE Read mapping with BWA and BOWTIE Before We Start In order to save a lot of typing, and to allow us some flexibility in designing these courses, we will establish a UNIX shell variable BASE to point to

More information

Data: ftp://ftp.broad.mit.edu/pub/users/bhaas/rnaseq_workshop/rnaseq_workshop_dat a.tgz. Software:

Data: ftp://ftp.broad.mit.edu/pub/users/bhaas/rnaseq_workshop/rnaseq_workshop_dat a.tgz. Software: A Tutorial: De novo RNA- Seq Assembly and Analysis Using Trinity and edger The following data and software resources are required for following the tutorial: Data: ftp://ftp.broad.mit.edu/pub/users/bhaas/rnaseq_workshop/rnaseq_workshop_dat

More information

Review of Recent NGS Short Reads Alignment Tools BMI-231 final project, Chenxi Chen Spring 2014

Review of Recent NGS Short Reads Alignment Tools BMI-231 final project, Chenxi Chen Spring 2014 Review of Recent NGS Short Reads Alignment Tools BMI-231 final project, Chenxi Chen Spring 2014 Deciphering the information contained in DNA sequences began decades ago since the time of Sanger sequencing.

More information

Using the Galaxy Local Bioinformatics Cloud at CARC

Using the Galaxy Local Bioinformatics Cloud at CARC Using the Galaxy Local Bioinformatics Cloud at CARC Lijing Bu Sr. Research Scientist Bioinformatics Specialist Center for Evolutionary and Theoretical Immunology (CETI) Department of Biology, University

More information

Welcome to MAPHiTS (Mapping Analysis Pipeline for High-Throughput Sequences) tutorial page.

Welcome to MAPHiTS (Mapping Analysis Pipeline for High-Throughput Sequences) tutorial page. Welcome to MAPHiTS (Mapping Analysis Pipeline for High-Throughput Sequences) tutorial page. In this page you will learn to use the tools of the MAPHiTS suite. A little advice before starting : rename your

More information

Read Mapping. Slides by Carl Kingsford

Read Mapping. Slides by Carl Kingsford Read Mapping Slides by Carl Kingsford Bowtie Ultrafast and memory-efficient alignment of short DNA sequences to the human genome Ben Langmead, Cole Trapnell, Mihai Pop and Steven L Salzberg, Genome Biology

More information

Taller práctico sobre uso, manejo y gestión de recursos genómicos de abril de 2013 Assembling long-read Transcriptomics

Taller práctico sobre uso, manejo y gestión de recursos genómicos de abril de 2013 Assembling long-read Transcriptomics Taller práctico sobre uso, manejo y gestión de recursos genómicos 22-24 de abril de 2013 Assembling long-read Transcriptomics Rocío Bautista Outline Introduction How assembly Tools assembling long-read

More information

How to store and visualize RNA-seq data

How to store and visualize RNA-seq data How to store and visualize RNA-seq data Gabriella Rustici Functional Genomics Group gabry@ebi.ac.uk EBI is an Outstation of the European Molecular Biology Laboratory. Talk summary How do we archive RNA-seq

More information

MiSeq Reporter v2.2. Theory of Operation

MiSeq Reporter v2.2. Theory of Operation MiSeq Reporter v2.2 Theory of Operation Secondary Analysis of MiSeq Sequencing Data MiSeq Reporter v2.2 Theory of Operation - Part # 15038604 Rev. C 1 Table of Contents Introduction... 3 MiSeq Reporter

More information

Genomic Files. University of Massachusetts Medical School. October, 2015

Genomic Files. University of Massachusetts Medical School. October, 2015 .. Genomic Files University of Massachusetts Medical School October, 2015 2 / 55. A Typical Deep-Sequencing Workflow Samples Fastq Files Fastq Files Sam / Bam Files Various files Deep Sequencing Further

More information

Using Galaxy for NGS Analyses Luce Skrabanek

Using Galaxy for NGS Analyses Luce Skrabanek Using Galaxy for NGS Analyses Luce Skrabanek Registering for a Galaxy account Before we begin, first create an account on the main public Galaxy portal. Go to: https://main.g2.bx.psu.edu/ Under the User

More information

Short Read Alignment. Mapping Reads to a Reference

Short Read Alignment. Mapping Reads to a Reference Short Read Alignment Mapping Reads to a Reference Brandi Cantarel, Ph.D. & Daehwan Kim, Ph.D. BICF 05/2018 Introduction to Mapping Short Read Aligners DNA vs RNA Alignment Quality Pitfalls and Improvements

More information

Single/paired-end RNAseq analysis with Galaxy

Single/paired-end RNAseq analysis with Galaxy October 016 Single/paired-end RNAseq analysis with Galaxy Contents: 1. Introduction. Quality control 3. Alignment 4. Normalization and read counts 5. Workflow overview 6. Sample data set to test the paired-end

More information

Ensembl RNASeq Practical. Overview

Ensembl RNASeq Practical. Overview Ensembl RNASeq Practical The aim of this practical session is to use BWA to align 2 lanes of Zebrafish paired end Illumina RNASeq reads to chromosome 12 of the zebrafish ZV9 assembly. We have restricted

More information

MiSeq Reporter TruSight Tumor 15 Workflow Guide

MiSeq Reporter TruSight Tumor 15 Workflow Guide MiSeq Reporter TruSight Tumor 15 Workflow Guide For Research Use Only. Not for use in diagnostic procedures. Introduction 3 TruSight Tumor 15 Workflow Overview 4 Reports 8 Analysis Output Files 9 Manifest

More information

BaseSpace - MiSeq Reporter Software v2.4 Release Notes

BaseSpace - MiSeq Reporter Software v2.4 Release Notes Page 1 of 5 BaseSpace - MiSeq Reporter Software v2.4 Release Notes For MiSeq Systems Connected to BaseSpace June 2, 2014 Revision Date Description of Change A May 22, 2014 Initial Version Revision History

More information

Scalable RNA Sequencing on Clusters of Multicore Processors

Scalable RNA Sequencing on Clusters of Multicore Processors JOAQUÍN DOPAZO JOAQUÍN TARRAGA SERGIO BARRACHINA MARÍA ISABEL CASTILLO HÉCTOR MARTÍNEZ ENRIQUE S. QUINTANA ORTÍ IGNACIO MEDINA INTRODUCTION DNA Exon 0 Exon 1 Exon 2 Intron 0 Intron 1 Reads Sequencing RNA

More information

Cyverse tutorial 1 Logging in to Cyverse and data management. Open an Internet browser window and navigate to the Cyverse discovery environment:

Cyverse tutorial 1 Logging in to Cyverse and data management. Open an Internet browser window and navigate to the Cyverse discovery environment: Cyverse tutorial 1 Logging in to Cyverse and data management Open an Internet browser window and navigate to the Cyverse discovery environment: https://de.cyverse.org/de/ Click Log in with your CyVerse

More information

BGGN-213: FOUNDATIONS OF BIOINFORMATICS (Lecture 14)

BGGN-213: FOUNDATIONS OF BIOINFORMATICS (Lecture 14) BGGN-213: FOUNDATIONS OF BIOINFORMATICS (Lecture 14) Genome Informatics (Part 1) https://bioboot.github.io/bggn213_f17/lectures/#14 Dr. Barry Grant Nov 2017 Overview: The purpose of this lab session is

More information

MiSeq System User Guide

MiSeq System User Guide MiSeq System User Guide FOR RESEARCH USE ONLY ILLUMINA PROPRIETARY Part # 15027617 Rev. H March 2013 This document and its contents are proprietary to Illumina, Inc. and its affiliates ("Illumina"), and

More information

Peter Schweitzer, Director, DNA Sequencing and Genotyping Lab

Peter Schweitzer, Director, DNA Sequencing and Genotyping Lab The instruments, the runs, the QC metrics, and the output Peter Schweitzer, Director, DNA Sequencing and Genotyping Lab Overview Roche/454 GS-FLX 454 (GSRunbrowser information) Evaluating run results Errors

More information

!"#$%&$'()#$*)+,-./).01"0#,23+3,303456"6,&((46,7$+-./&((468,

!#$%&$'()#$*)+,-./).010#,23+3,3034566,&((46,7$+-./&((468, !"#$%&$'()#$*)+,-./).01"0#,23+3,303456"6,&((46,7$+-./&((468, 9"(1(02)1+(',:.;.4(*.',?9@A,!."2.4B.'#A,C(;.

More information

Isaac Enrichment v2.0 App

Isaac Enrichment v2.0 App Isaac Enrichment v2.0 App Introduction 3 Running Isaac Enrichment v2.0 5 Isaac Enrichment v2.0 Output 7 Isaac Enrichment v2.0 Methods 31 Technical Assistance ILLUMINA PROPRIETARY 15050960 Rev. C December

More information

Aligners. J Fass 21 June 2017

Aligners. J Fass 21 June 2017 Aligners J Fass 21 June 2017 Definitions Assembly: I ve found the shredded remains of an important document; put it back together! UC Davis Genome Center Bioinformatics Core J Fass Aligners 2017-06-21

More information

GPUBwa -Parallelization of Burrows Wheeler Aligner using Graphical Processing Units

GPUBwa -Parallelization of Burrows Wheeler Aligner using Graphical Processing Units GPUBwa -Parallelization of Burrows Wheeler Aligner using Graphical Processing Units Abstract A very popular discipline in bioinformatics is Next-Generation Sequencing (NGS) or DNA sequencing. It specifies

More information

SolexaLIMS: A Laboratory Information Management System for the Solexa Sequencing Platform

SolexaLIMS: A Laboratory Information Management System for the Solexa Sequencing Platform SolexaLIMS: A Laboratory Information Management System for the Solexa Sequencing Platform Brian D. O Connor, 1, Jordan Mendler, 1, Ben Berman, 2, Stanley F. Nelson 1 1 Department of Human Genetics, David

More information

INTRODUCTION AUX FORMATS DE FICHIERS

INTRODUCTION AUX FORMATS DE FICHIERS INTRODUCTION AUX FORMATS DE FICHIERS Plan. Formats de séquences brutes.. Format fasta.2. Format fastq 2. Formats d alignements 2.. Format SAM 2.2. Format BAM 4. Format «Variant Calling» 4.. Format Varscan

More information

HiScanSQ System Site Preparation Guide

HiScanSQ System Site Preparation Guide HiScanSQ System Site Preparation Guide FOR RESEARCH USE ONLY Introduction 3 Supported Configurations 4 User-Supplied Equipment and Materials 5 Delivery and Installation 6 Operation, Maintenance, and Service

More information

Aligners. J Fass 23 August 2017

Aligners. J Fass 23 August 2017 Aligners J Fass 23 August 2017 Definitions Assembly: I ve found the shredded remains of an important document; put it back together! UC Davis Genome Center Bioinformatics Core J Fass Aligners 2017-08-23

More information

Run Setup and Bioinformatic Analysis. Accel-NGS 2S MID Indexing Kits

Run Setup and Bioinformatic Analysis. Accel-NGS 2S MID Indexing Kits Run Setup and Bioinformatic Analysis Accel-NGS 2S MID Indexing Kits Sequencing MID Libraries For MiSeq, HiSeq, and NextSeq instruments: Modify the config file to create a fastq for index reads Using the

More information

GSNAP: Fast and SNP-tolerant detection of complex variants and splicing in short reads by Thomas D. Wu and Serban Nacu

GSNAP: Fast and SNP-tolerant detection of complex variants and splicing in short reads by Thomas D. Wu and Serban Nacu GSNAP: Fast and SNP-tolerant detection of complex variants and splicing in short reads by Thomas D. Wu and Serban Nacu Matt Huska Freie Universität Berlin Computational Methods for High-Throughput Omics

More information

Analysis of ChIP-seq data

Analysis of ChIP-seq data Before we start: 1. Log into tak (step 0 on the exercises) 2. Go to your lab space and create a folder for the class (see separate hand out) 3. Connect to your lab space through the wihtdata network and

More information

The software and data for the RNA-Seq exercise are already available on the USB system

The software and data for the RNA-Seq exercise are already available on the USB system BIT815 Notes on R analysis of RNA-seq data The software and data for the RNA-Seq exercise are already available on the USB system The notes below regarding installation of R packages and other software

More information

Tiling Assembly for Annotation-independent Novel Gene Discovery

Tiling Assembly for Annotation-independent Novel Gene Discovery Tiling Assembly for Annotation-independent Novel Gene Discovery By Jennifer Lopez and Kenneth Watanabe Last edited on September 7, 2015 by Kenneth Watanabe The following procedure explains how to run the

More information

Exome sequencing. Jong Kyoung Kim

Exome sequencing. Jong Kyoung Kim Exome sequencing Jong Kyoung Kim Genome Analysis Toolkit The GATK is the industry standard for identifying SNPs and indels in germline DNA and RNAseq data. Its scope is now expanding to include somatic

More information

NGS Data Analysis. Roberto Preste

NGS Data Analysis. Roberto Preste NGS Data Analysis Roberto Preste 1 Useful info http://bit.ly/2r1y2dr Contacts: roberto.preste@gmail.com Slides: http://bit.ly/ngs-data 2 NGS data analysis Overview 3 NGS Data Analysis: the basic idea http://bit.ly/2r1y2dr

More information

Differential gene expression analysis using RNA-seq

Differential gene expression analysis using RNA-seq https://abc.med.cornell.edu/ Differential gene expression analysis using RNA-seq Applied Bioinformatics Core, September/October 2018 Friederike Dündar with Luce Skrabanek & Paul Zumbo Day 3: Counting reads

More information

Performing whole genome SNP analysis with mapping performed locally

Performing whole genome SNP analysis with mapping performed locally BioNumerics Tutorial: Performing whole genome SNP analysis with mapping performed locally 1 Introduction 1.1 An introduction to whole genome SNP analysis A Single Nucleotide Polymorphism (SNP) is a variation

More information

Data Preprocessing. Next Generation Sequencing analysis DTU Bioinformatics Next Generation Sequencing Analysis

Data Preprocessing. Next Generation Sequencing analysis DTU Bioinformatics Next Generation Sequencing Analysis Data Preprocessing Next Generation Sequencing analysis DTU Bioinformatics Generalized NGS analysis Data size Application Assembly: Compare Raw Pre- specific: Question Alignment / samples / Answer? reads

More information

Supplementary Information. Detecting and annotating genetic variations using the HugeSeq pipeline

Supplementary Information. Detecting and annotating genetic variations using the HugeSeq pipeline Supplementary Information Detecting and annotating genetic variations using the HugeSeq pipeline Hugo Y. K. Lam 1,#, Cuiping Pan 1, Michael J. Clark 1, Phil Lacroute 1, Rui Chen 1, Rajini Haraksingh 1,

More information

Data Preprocessing : Next Generation Sequencing analysis CBS - DTU Next Generation Sequencing Analysis

Data Preprocessing : Next Generation Sequencing analysis CBS - DTU Next Generation Sequencing Analysis Data Preprocessing 27626: Next Generation Sequencing analysis CBS - DTU Generalized NGS analysis Data size Application Assembly: Compare Raw Pre- specific: Question Alignment / samples / Answer? reads

More information

version /1/2011 Source code Linux x86_64 binary Mac OS X x86_64 binary

version /1/2011 Source code Linux x86_64 binary Mac OS X x86_64 binary Cufflinks RNA-Seq analysis tools - Getting Started 1 of 6 14.07.2011 09:42 Cufflinks Transcript assembly, differential expression, and differential regulation for RNA-Seq Site Map Home Getting started

More information

Analyzing Variant Call results using EuPathDB Galaxy, Part II

Analyzing Variant Call results using EuPathDB Galaxy, Part II Analyzing Variant Call results using EuPathDB Galaxy, Part II In this exercise, we will work in groups to examine the results from the SNP analysis workflow that we started yesterday. The first step is

More information

RNA-Seq Analysis With the Tuxedo Suite

RNA-Seq Analysis With the Tuxedo Suite June 2016 RNA-Seq Analysis With the Tuxedo Suite Dena Leshkowitz Introduction In this exercise we will learn how to analyse RNA-Seq data using the Tuxedo Suite tools: Tophat, Cuffmerge, Cufflinks and Cuffdiff.

More information

Molecular Identifier (MID) Analysis for TAM-ChIP Paired-End Sequencing

Molecular Identifier (MID) Analysis for TAM-ChIP Paired-End Sequencing Molecular Identifier (MID) Analysis for TAM-ChIP Paired-End Sequencing Catalog Nos.: 53126 & 53127 Name: TAM-ChIP antibody conjugate Description Active Motif s TAM-ChIP technology combines antibody directed

More information

Analysis of high-throughput sequencing data. Simon Anders EBI

Analysis of high-throughput sequencing data. Simon Anders EBI Analysis of high-throughput sequencing data Simon Anders EBI Outline Overview on high-throughput sequencing (HTS) technologies, focusing on Solexa's GenomAnalyzer as example Software requirements to works

More information

CLC Server. End User USER MANUAL

CLC Server. End User USER MANUAL CLC Server End User USER MANUAL Manual for CLC Server 10.0.1 Windows, macos and Linux March 8, 2018 This software is for research purposes only. QIAGEN Aarhus Silkeborgvej 2 Prismet DK-8000 Aarhus C Denmark

More information

Next generation sequencing: assembly by mapping reads. Laurent Falquet, Vital-IT Helsinki, June 3, 2010

Next generation sequencing: assembly by mapping reads. Laurent Falquet, Vital-IT Helsinki, June 3, 2010 Next generation sequencing: assembly by mapping reads Laurent Falquet, Vital-IT Helsinki, June 3, 2010 Overview What is assembly by mapping? Methods BWT File formats Tools Issues Visualization Discussion

More information

Genetics 211 Genomics Winter 2014 Problem Set 4

Genetics 211 Genomics Winter 2014 Problem Set 4 Genomics - Part 1 due Friday, 2/21/2014 by 9:00am Part 2 due Friday, 3/7/2014 by 9:00am For this problem set, we re going to use real data from a high-throughput sequencing project to look for differential

More information

MiSeq Reporter TruSeq Amplicon Workflow Guide

MiSeq Reporter TruSeq Amplicon Workflow Guide MiSeq Reporter TruSeq Amplicon Workflow Guide For Research Use Only. Not for use in diagnostic procedures. Revision History 3 Introduction 4 TruSeq Amplicon Workflow Overview 5 TruSeq Amplicon Summary

More information

Next Generation Sequencing

Next Generation Sequencing Next Generation Sequencing Cavan Reilly November 21, 2014 Table of contents Next generation sequencing NGS and microarrays Study design Quality assessment Burrows Wheeler transform BWT example Introduction

More information