Illumina Next Generation Sequencing Data analysis
|
|
- Ezra Ferguson
- 5 years ago
- Views:
Transcription
1 Illumina Next Generation Sequencing Data analysis Chiara Dal Fiume Sr Field Application Scientist Italy 2010 Illumina, Inc. All rights reserved. Illumina, illuminadx, Solexa, Making Sense Out of Life, Oligator, Sentrix, GoldenGate, GoldenGate Indexing, DASL, BeadArray, Array of Arrays, Infinium, BeadXpress, VeraCode, IntelliHyb, iselect, CSPro, GenomeStudio, Genetic Energy, HiSeq, and HiScan are registered trademarks or trademarks of Illumina, Inc. All other brands and names contained herein are the property of their respective owners.
2 Illumina Sequencing Workflow Sample Prep Analysis Instrumentation Primary Analysis Secondary Analysis 2
3 Illumina Sequencing Workflow Outcomes Clusters Images/TIFF files Sample Prep Analysis Instrumentation Primary (DNA Library) Intensities Basecalling Secondary Alignments 3
4 4 Primary Analysis Processes
5 Primary Data Analysis Components Instrument Control Software Provides a graphical interface while running the instrument Real Time Analysis (RTA) Component within the Instrument Control Software that monitors the run s progress, optimizes run conditions and provides run-time quality statistics Off-Line Base Caller (OLB) Provides the option to perform data analysis off-line Firecrest (image analysis) Instrument Control Software RTA CIF/files Primary Analysis Bustard (base calling) Off-Line Basecaller CASAVA Secondary Analysis bcl Samplesheet.csv CASAVA Build GenomeStudio or third party apps. 5
6 6
7 Cluster Detection Algorithm Maximum Threshold Cluster 7
8 Multi-Cycle Detection of Cluster Positions Better resolution of some overlapping clusters e.g. when two overlapping clusters are the same base in cycle 1 Cluster detection is performed over 4 cycles CYCLE 1 G channel Difficult to resolve overlapping clusters in one cycle only, when there are overlapping clusters of the same base G channel CYCLE 2 C channel By detecting cluster positions in multiple cycles there is a better chance of resolving overlapping clusters since they are less likely to be of the same base in multiple cycles 8
9 9 Base Calling Algorithm
10 Base calling Algorithms: Base calling and quality filtering Corrected Intensity C A C G T I A I B A C G T Filter clusters by signal purity Second-lowest CHASTITY at least 0.6 in first 25 cycles Looks at more cycles Allows one bad cycle Better error rate for given yield C I A I A I B CHASTITY Formula 10
11 SAV software monitoring run quality 11
12 12 12 Secondary Analysis
13 What is CASAVA? Consensus Assessment of Sequence And VAriation (CASAVA) is a Linux application designed to: Demultiplex samples Align reads Call SNPs Find indels Count expression level for exons, genes and splice junctions in case of RNA-seq runs Primary Analysis CASAVA s output is a folder structure (called a CASAVA Build ) ready for import into GenomeStudio for visualization and further analysis Gerald (Eland v2) Secondary SNP and Analysis Multiple *_export.txt + other files script for multiplexed run Indel Calls Counting For mrna CASAVA Build Data Visualization 13
14 CASAVA 1.8 BCL converter Converter part of CASAVA Generate fastq using ASCII offset of 33 Perform demultiplexing Data analysis on a per Sample basis Data manipulation and sharing greatly facilitated Common data formats (BAM and FastQ) Easier to handle and share Lots of other software available that work with BAM/FastQ 14
15 Secondary and Tertiary Analysis The biological visualization RNA-Seq: Tuxedo suite, Bioconductor, Third party tools MetaGenomics NextGEne, CLCbio, Megan SNP & Indel Detection ELAND/CASAVA, BWA/SAMTools, DeNovo Assembly Abyss, Velvet, SoapDenovo 15
16 Burrows-Wheeler Aligner BWA aligns relatively short nucleotide sequences against a long reference sequence such as the human genome. BWA has two major components, one for read shorter than 150bp and the other for longer reads. Bwa-short: algorithm that works for query sequences shorter than 150bp BWA-SW: algorithm that works for longer sequences up to around 100kbp. BWA Main features: Gapped alignment and paired-end mapping Accurate, fast and lightweight BWA-SW component is able to find chimera. 16
17 Sequence Alignment/Map SAM is a generic format for storing large nucleotide sequence alignments. SAM main features: Flexibility: store all the alignment information generated by various alignment tools Simplicity: easily generated by alignment programs or converted from existing alignment formats Compact in file size Allows the file to be indexed by genomic position to efficiently retrieve all reads aligning to a locus. SAM Tools provide various utilities for manipulating alignments in the SAM format, including sorting, merging, indexing and generating alignments in a per-position format. 17
18 The "Tuxedo Suite : Secondary analysis applications for RNA-seq Aligning Short Reads to References with Bowtie, Tophat, and Cufflinks Provide directions on how to convert Illumina sequence output to: Measures of differential expression Discover splice forms Bowtie Tuxedo suite Cufflinks TopHat 18
19 19 Thank you
GenomeStudio Software Release Notes
GenomeStudio Software 2009.2 Release Notes 1. GenomeStudio Software 2009.2 Framework... 1 2. Illumina Genome Viewer v1.5...2 3. Genotyping Module v1.5... 4 4. Gene Expression Module v1.5... 6 5. Methylation
More informationHiSeq Instrument Software Release Notes
HiSeq Instrument Software Release Notes HCS v2.0.12 RTA v1.17.21.3 Recipe Fragments v1.3.61 Illumina BaseSpace Broker v2.0.13022.1628 SAV v1.8.20 For HiSeq 2000 and HiSeq 1000 Systems FOR RESEARCH USE
More informationImage Analysis and Base Calling Sarah Reid FAS
Image Analysis and Base Calling Sarah Reid FAS For Research Use Only. Not for use in diagnostic procedures. 2016 Illumina, Inc. All rights reserved. Illumina, 24sure, BaseSpace, BeadArray, BlueFish, BlueFuse,
More informationHigh-throughput sequencing: Alignment and related topic. Simon Anders EMBL Heidelberg
High-throughput sequencing: Alignment and related topic Simon Anders EMBL Heidelberg Established platforms HTS Platforms Illumina HiSeq, ABI SOLiD, Roche 454 Newcomers: Benchtop machines 454 GS Junior,
More informationHigh-throughput sequencing: Alignment and related topic. Simon Anders EMBL Heidelberg
High-throughput sequencing: Alignment and related topic Simon Anders EMBL Heidelberg Established platforms HTS Platforms Illumina HiSeq, ABI SOLiD, Roche 454 Newcomers: Benchtop machines: Illumina MiSeq,
More informationGalaxy Platform For NGS Data Analyses
Galaxy Platform For NGS Data Analyses Weihong Yan wyan@chem.ucla.edu Collaboratory Web Site http://qcb.ucla.edu/collaboratory Collaboratory Workshops Workshop Outline ü Day 1 UCLA galaxy and user account
More informationSequencing. Short Read Alignment. Sequencing. Paired-End Sequencing 6/10/2010. Tobias Rausch 7 th June 2010 WGS. ChIP-Seq. Applied Biosystems.
Sequencing Short Alignment Tobias Rausch 7 th June 2010 WGS RNA-Seq Exon Capture ChIP-Seq Sequencing Paired-End Sequencing Target genome Fragments Roche GS FLX Titanium Illumina Applied Biosystems SOLiD
More informationEcoStudy Software User Guide
EcoStudy Software User Guide FOR RESEARCH USE ONLY What is EcoStudy? 3 Setting Up a Study 4 Specifying Analysis Settings for your Study 6 Reviewing the Data in your Study 8 Exporting Study Data to a Report
More informationRNA Sequencing with TopHat and Cufflinks
RNA Sequencing with TopHat and Cufflinks Introduction 3 Run TopHat App 4 TopHat App Output 5 Run Cufflinks 18 Cufflinks App Output 20 RNAseq Methods 27 Technical Assistance ILLUMINA PROPRIETARY 15050962
More informationUsing Pipeline Output Data for Whole Genome Alignment
Using Pipeline Output Data for Whole Genome Alignment FOR RESEARCH ONLY Topics 4 Introduction 4 Pipeline 4 Maq 4 GBrowse 4 Hardware Requirements 5 Workflow 6 Preparing to Run Maq 6 UNIX/Linux Environment
More informationSequence Analysis Pipeline
Sequence Analysis Pipeline Transcript fragments 1. PREPROCESSING 2. ASSEMBLY (today) Removal of contaminants, vector, adaptors, etc Put overlapping sequence together and calculate bigger sequences 3. Analysis/Annotation
More informationmtdna Variant Processor v1.0 BaseSpace App Guide
mtdna Variant Processor v1.0 BaseSpace App Guide For Research Use Only. Not for use in diagnostic procedures. Introduction 3 Workflow Diagram 4 Workflow 5 Log In to BaseSpace 6 Set Analysis Parameters
More informationGalaxy workshop at the Winter School Igor Makunin
Galaxy workshop at the Winter School 2016 Igor Makunin i.makunin@uq.edu.au Winter school, UQ, July 6, 2016 Plan Overview of the Genomics Virtual Lab Introduce Galaxy, a web based platform for analysis
More informationBaseSpace User Guide FOR RESEARCH USE ONLY
BaseSpace User Guide FOR RESEARCH USE ONLY Introduction 3 How Do I Start 7 BaseSpace User Interface 11 How To Use BaseSpace 21 Workflow Reference 44 Data Reference 50 Technical Assistance ILLUMINA PROPRIETARY
More informationRNA-seq. Manpreet S. Katari
RNA-seq Manpreet S. Katari Evolution of Sequence Technology Normalizing the Data RPKM (Reads per Kilobase of exons per million reads) Score = R NT R = # of unique reads for the gene N = Size of the gene
More informationIllumina Experiment Manager User Guide
Illumina Experiment Manager User Guide For Research Use Only. Not for use in diagnostic procedures. What is Illumina Experiment Manager? 3 Getting Started 4 Creating a Sample Plate 7 Creating a Sample
More informationNGS Analysis Using Galaxy
NGS Analysis Using Galaxy Sequences and Alignment Format Galaxy overview and Interface Get;ng Data in Galaxy Analyzing Data in Galaxy Quality Control Mapping Data History and workflow Galaxy Exercises
More informationLocal Run Manager Resequencing Analysis Module Workflow Guide
Local Run Manager Resequencing Analysis Module Workflow Guide For Research Use Only. Not for use in diagnostic procedures. Overview 3 Set Parameters 4 Analysis Methods 6 View Analysis Results 8 Analysis
More informationRNA-Seq in Galaxy: Tuxedo protocol. Igor Makunin, UQ RCC, QCIF
RNA-Seq in Galaxy: Tuxedo protocol Igor Makunin, UQ RCC, QCIF Acknowledgments Genomics Virtual Lab: gvl.org.au Galaxy for tutorials: galaxy-tut.genome.edu.au Galaxy Australia: galaxy-aust.genome.edu.au
More informationMapping NGS reads for genomics studies
Mapping NGS reads for genomics studies Valencia, 28-30 Sep 2015 BIER Alejandro Alemán aaleman@cipf.es Genomics Data Analysis CIBERER Where are we? Fastq Sequence preprocessing Fastq Alignment BAM Visualization
More informationDr. Gabriela Salinas Dr. Orr Shomroni Kaamini Rhaithata
Analysis of RNA sequencing data sets using the Galaxy environment Dr. Gabriela Salinas Dr. Orr Shomroni Kaamini Rhaithata Microarray and Deep-sequencing core facility 30.10.2017 RNA-seq workflow I Hypothesis
More informationMiSeq System User Guide
MiSeq System User Guide FOR RESEARCH USE ONLY ILLUMINA PROPRIETARY Part # 15027617 Rev. A August 2011 This document and its contents are proprietary to Illumina, Inc. and its affiliates ("Illumina"), and
More informationBaseSpace User Guide. Supporting the NextSeq, MiSeq, and HiSeq Sequencing Systems FOR RESEARCH USE ONLY
BaseSpace User Guide Supporting the NextSeq, MiSeq, and HiSeq Sequencing Systems FOR RESEARCH USE ONLY Introduction 3 How Do I Start 8 BaseSpace User Interface 13 How To Use BaseSpace 25 Workflow Reference
More informationAutoLoader 2.x User Guide
AutoLoader 2.x User Guide FOR RESEARCH USE ONLY Topics 3 Introduction 4 Supported Configurations 7 AutoLoader 2.x Components 9 Process Overview 10 Powering Up the AutoLoader 2.x 11 Starting the AutoLoader
More informationUnder the Hood of Alignment Algorithms for NGS Researchers
Under the Hood of Alignment Algorithms for NGS Researchers April 16, 2014 Gabe Rudy VP of Product Development Golden Helix Questions during the presentation Use the Questions pane in your GoToWebinar window
More informationRNA-seq Data Analysis
Seyed Abolfazl Motahari RNA-seq Data Analysis Basics Next Generation Sequencing Biological Samples Data Cost Data Volume Big Data Analysis in Biology تحلیل داده ها کنترل سیستمهای بیولوژیکی تشخیص بیماریها
More informationNGS Data Visualization and Exploration Using IGV
1 What is Galaxy Galaxy for Bioinformaticians Galaxy for Experimental Biologists Using Galaxy for NGS Analysis NGS Data Visualization and Exploration Using IGV 2 What is Galaxy Galaxy for Bioinformaticians
More informationBioinformatics in next generation sequencing projects
Bioinformatics in next generation sequencing projects Rickard Sandberg Assistant Professor Department of Cell and Molecular Biology Karolinska Institutet March 2011 Once sequenced the problem becomes computational
More informationLocal Run Manager Amplicon Analysis Module Workflow Guide
Local Run Manager Amplicon Analysis Module Workflow Guide For Research Use Only. Not for use in diagnostic procedures. Overview 3 Set Parameters 4 Analysis Methods 6 View Analysis Results 9 Analysis Report
More informationAccelrys Pipeline Pilot and HP ProLiant servers
Accelrys Pipeline Pilot and HP ProLiant servers A performance overview Technical white paper Table of contents Introduction... 2 Accelrys Pipeline Pilot benchmarks on HP ProLiant servers... 2 NGS Collection
More informationKaryoStudio v1.4 User Guide
KaryoStudio v1.4 User Guide FOR RESEARCH USE ONLY ILLUMINA PROPRIETARY Part # 11328837 Rev. C June 2011 Notice This document and its contents are proprietary to Illumina, Inc. and its affiliates ("Illumina"),
More informationDemultiplexing Illumina sequencing data containing unique molecular indexes (UMIs)
next generation sequencing analysis guidelines Demultiplexing Illumina sequencing data containing unique molecular indexes (UMIs) See what more we can do for you at www.idtdna.com. For Research Use Only
More informationIntroduction to Read Alignment. UCD Genome Center Bioinformatics Core Tuesday 15 September 2015
Introduction to Read Alignment UCD Genome Center Bioinformatics Core Tuesday 15 September 2015 From reads to molecules Why align? Individual A Individual B ATGATAGCATCGTCGGGTGTCTGCTCAATAATAGTGCCGTATCATGCTGGTGTTATAATCGCCGCATGACATGATCAATGG
More informationBioinformatics for High-throughput Sequencing
Bioinformatics for High-throughput Sequencing An Overview Simon Anders EBI is an Outstation of the European Molecular Biology Laboratory. Overview In recent years, new sequencing schemes, also called high-throughput
More informationMiSeq Reporter Amplicon DS Workflow Guide
MiSeq Reporter Amplicon DS Workflow Guide For Research Use Only. Not for use in diagnostic procedures. Introduction 3 Amplicon DS Workflow Overview 4 Optional Settings for the Amplicon DS Workflow 7 Analysis
More informationColorado State University Bioinformatics Algorithms Assignment 6: Analysis of High- Throughput Biological Data Hamidreza Chitsaz, Ali Sharifi- Zarchi
Colorado State University Bioinformatics Algorithms Assignment 6: Analysis of High- Throughput Biological Data Hamidreza Chitsaz, Ali Sharifi- Zarchi Although a little- bit long, this is an easy exercise
More informationLong Read RNA-seq Mapper
UNIVERSITY OF ZAGREB FACULTY OF ELECTRICAL ENGENEERING AND COMPUTING MASTER THESIS no. 1005 Long Read RNA-seq Mapper Josip Marić Zagreb, February 2015. Table of Contents 1. Introduction... 1 2. RNA Sequencing...
More informationHigh-throughout sequencing and using short-read aligners. Simon Anders
High-throughout sequencing and using short-read aligners Simon Anders High-throughput sequencing (HTS) Sequencing millions of short DNA fragments in parallel. a.k.a.: next-generation sequencing (NGS) massively-parallel
More informationBaseSpace Onsite v2.1 HT System Guide
BaseSpace Onsite v2.1 HT System Guide For Research Use Only. Not for use in diagnostic procedures. Revision History 6 Introduction 7 Getting Started 12 BaseSpace Onsite User Interface 17 How To Use BaseSpace
More informationIllumina LIMS User Guide
This document and its contents are proprietary to Illumina, Inc. and its affiliates ("Illumina"), and are intended solely for the contractual use of its customer in connection with the use of the product(s)
More informationDesigning Custom GoldenGate Genotyping Assays
Designing Custom GoldenGate Genotyping Assays Guidelines for efficiently creating and ordering high-quality custom GoldenGate Genotyping Assays using the Illumina Assay Design Tool. Introduction The Illumina
More informationUsing Genome Analyzer Sequencing Control Software Version 2.5
Using Genome Analyzer Sequencing Control Software Version 2.5 FOR RESEARCH USE ONLY Topics 3 Introduction 4 Run Parameters Window 8 Data Collection Software Interface 12 Recipe Viewer 13 Reagent Tracking
More informationDesigning Custom GoldenGate Genotyping Assays
Designing Custom GoldenGate Genotyping Assays Guidelines for efficiently creating and ordering high-quality custom GoldenGate Genotyping Assays using the Illumina Assay Design Tool. Introduction The Illumina
More informationSequence mapping and assembly. Alistair Ward - Boston College
Sequence mapping and assembly Alistair Ward - Boston College Sequenced a genome? Fragmented a genome -> DNA library PCR amplification Sequence reads (ends of DNA fragment for mate pairs) We no longer have
More informationRNA Sequencing with TopHat Alignment v1.0 and Cufflinks Assembly & DE v1.1 App Guide
RNA Sequencing with TopHat Alignment v1.0 and Cufflinks Assembly & DE v1.1 App Guide For Research Use Only. Not for use in diagnostic procedures. Introduction 3 Set Analysis Parameters TopHat 4 Analysis
More informationOmega: an Overlap-graph de novo Assembler for Metagenomics
Omega: an Overlap-graph de novo Assembler for Metagenomics B a h l e l H a i d e r, Ta e - H y u k A h n, B r i a n B u s h n e l l, J u a n j u a n C h a i, A l e x C o p e l a n d, C h o n g l e Pa n
More informationGenomic Files. University of Massachusetts Medical School. October, 2014
.. Genomic Files University of Massachusetts Medical School October, 2014 2 / 39. A Typical Deep-Sequencing Workflow Samples Fastq Files Fastq Files Sam / Bam Files Various files Deep Sequencing Further
More informationNGS Data and Sequence Alignment
Applications and Servers SERVER/REMOTE Compute DB WEB Data files NGS Data and Sequence Alignment SSH WEB SCP Manpreet S. Katari App Aug 11, 2016 Service Terminal IGV Data files Window Personal Computer/Local
More informationMaize genome sequence in FASTA format. Gene annotation file in gff format
Exercise 1. Using Tophat/Cufflinks to analyze RNAseq data. Step 1. One of CBSU BioHPC Lab workstations has been allocated for your workshop exercise. The allocations are listed on the workshop exercise
More informationRead mapping with BWA and BOWTIE
Read mapping with BWA and BOWTIE Before We Start In order to save a lot of typing, and to allow us some flexibility in designing these courses, we will establish a UNIX shell variable BASE to point to
More informationData: ftp://ftp.broad.mit.edu/pub/users/bhaas/rnaseq_workshop/rnaseq_workshop_dat a.tgz. Software:
A Tutorial: De novo RNA- Seq Assembly and Analysis Using Trinity and edger The following data and software resources are required for following the tutorial: Data: ftp://ftp.broad.mit.edu/pub/users/bhaas/rnaseq_workshop/rnaseq_workshop_dat
More informationReview of Recent NGS Short Reads Alignment Tools BMI-231 final project, Chenxi Chen Spring 2014
Review of Recent NGS Short Reads Alignment Tools BMI-231 final project, Chenxi Chen Spring 2014 Deciphering the information contained in DNA sequences began decades ago since the time of Sanger sequencing.
More informationUsing the Galaxy Local Bioinformatics Cloud at CARC
Using the Galaxy Local Bioinformatics Cloud at CARC Lijing Bu Sr. Research Scientist Bioinformatics Specialist Center for Evolutionary and Theoretical Immunology (CETI) Department of Biology, University
More informationWelcome to MAPHiTS (Mapping Analysis Pipeline for High-Throughput Sequences) tutorial page.
Welcome to MAPHiTS (Mapping Analysis Pipeline for High-Throughput Sequences) tutorial page. In this page you will learn to use the tools of the MAPHiTS suite. A little advice before starting : rename your
More informationRead Mapping. Slides by Carl Kingsford
Read Mapping Slides by Carl Kingsford Bowtie Ultrafast and memory-efficient alignment of short DNA sequences to the human genome Ben Langmead, Cole Trapnell, Mihai Pop and Steven L Salzberg, Genome Biology
More informationTaller práctico sobre uso, manejo y gestión de recursos genómicos de abril de 2013 Assembling long-read Transcriptomics
Taller práctico sobre uso, manejo y gestión de recursos genómicos 22-24 de abril de 2013 Assembling long-read Transcriptomics Rocío Bautista Outline Introduction How assembly Tools assembling long-read
More informationHow to store and visualize RNA-seq data
How to store and visualize RNA-seq data Gabriella Rustici Functional Genomics Group gabry@ebi.ac.uk EBI is an Outstation of the European Molecular Biology Laboratory. Talk summary How do we archive RNA-seq
More informationMiSeq Reporter v2.2. Theory of Operation
MiSeq Reporter v2.2 Theory of Operation Secondary Analysis of MiSeq Sequencing Data MiSeq Reporter v2.2 Theory of Operation - Part # 15038604 Rev. C 1 Table of Contents Introduction... 3 MiSeq Reporter
More informationGenomic Files. University of Massachusetts Medical School. October, 2015
.. Genomic Files University of Massachusetts Medical School October, 2015 2 / 55. A Typical Deep-Sequencing Workflow Samples Fastq Files Fastq Files Sam / Bam Files Various files Deep Sequencing Further
More informationUsing Galaxy for NGS Analyses Luce Skrabanek
Using Galaxy for NGS Analyses Luce Skrabanek Registering for a Galaxy account Before we begin, first create an account on the main public Galaxy portal. Go to: https://main.g2.bx.psu.edu/ Under the User
More informationShort Read Alignment. Mapping Reads to a Reference
Short Read Alignment Mapping Reads to a Reference Brandi Cantarel, Ph.D. & Daehwan Kim, Ph.D. BICF 05/2018 Introduction to Mapping Short Read Aligners DNA vs RNA Alignment Quality Pitfalls and Improvements
More informationSingle/paired-end RNAseq analysis with Galaxy
October 016 Single/paired-end RNAseq analysis with Galaxy Contents: 1. Introduction. Quality control 3. Alignment 4. Normalization and read counts 5. Workflow overview 6. Sample data set to test the paired-end
More informationEnsembl RNASeq Practical. Overview
Ensembl RNASeq Practical The aim of this practical session is to use BWA to align 2 lanes of Zebrafish paired end Illumina RNASeq reads to chromosome 12 of the zebrafish ZV9 assembly. We have restricted
More informationMiSeq Reporter TruSight Tumor 15 Workflow Guide
MiSeq Reporter TruSight Tumor 15 Workflow Guide For Research Use Only. Not for use in diagnostic procedures. Introduction 3 TruSight Tumor 15 Workflow Overview 4 Reports 8 Analysis Output Files 9 Manifest
More informationBaseSpace - MiSeq Reporter Software v2.4 Release Notes
Page 1 of 5 BaseSpace - MiSeq Reporter Software v2.4 Release Notes For MiSeq Systems Connected to BaseSpace June 2, 2014 Revision Date Description of Change A May 22, 2014 Initial Version Revision History
More informationScalable RNA Sequencing on Clusters of Multicore Processors
JOAQUÍN DOPAZO JOAQUÍN TARRAGA SERGIO BARRACHINA MARÍA ISABEL CASTILLO HÉCTOR MARTÍNEZ ENRIQUE S. QUINTANA ORTÍ IGNACIO MEDINA INTRODUCTION DNA Exon 0 Exon 1 Exon 2 Intron 0 Intron 1 Reads Sequencing RNA
More informationCyverse tutorial 1 Logging in to Cyverse and data management. Open an Internet browser window and navigate to the Cyverse discovery environment:
Cyverse tutorial 1 Logging in to Cyverse and data management Open an Internet browser window and navigate to the Cyverse discovery environment: https://de.cyverse.org/de/ Click Log in with your CyVerse
More informationBGGN-213: FOUNDATIONS OF BIOINFORMATICS (Lecture 14)
BGGN-213: FOUNDATIONS OF BIOINFORMATICS (Lecture 14) Genome Informatics (Part 1) https://bioboot.github.io/bggn213_f17/lectures/#14 Dr. Barry Grant Nov 2017 Overview: The purpose of this lab session is
More informationMiSeq System User Guide
MiSeq System User Guide FOR RESEARCH USE ONLY ILLUMINA PROPRIETARY Part # 15027617 Rev. H March 2013 This document and its contents are proprietary to Illumina, Inc. and its affiliates ("Illumina"), and
More informationPeter Schweitzer, Director, DNA Sequencing and Genotyping Lab
The instruments, the runs, the QC metrics, and the output Peter Schweitzer, Director, DNA Sequencing and Genotyping Lab Overview Roche/454 GS-FLX 454 (GSRunbrowser information) Evaluating run results Errors
More information!"#$%&$'()#$*)+,-./).01"0#,23+3,303456"6,&((46,7$+-./&((468,
!"#$%&$'()#$*)+,-./).01"0#,23+3,303456"6,&((46,7$+-./&((468, 9"(1(02)1+(',:.;.4(*.',?9@A,!."2.4B.'#A,C(;.
More informationIsaac Enrichment v2.0 App
Isaac Enrichment v2.0 App Introduction 3 Running Isaac Enrichment v2.0 5 Isaac Enrichment v2.0 Output 7 Isaac Enrichment v2.0 Methods 31 Technical Assistance ILLUMINA PROPRIETARY 15050960 Rev. C December
More informationAligners. J Fass 21 June 2017
Aligners J Fass 21 June 2017 Definitions Assembly: I ve found the shredded remains of an important document; put it back together! UC Davis Genome Center Bioinformatics Core J Fass Aligners 2017-06-21
More informationGPUBwa -Parallelization of Burrows Wheeler Aligner using Graphical Processing Units
GPUBwa -Parallelization of Burrows Wheeler Aligner using Graphical Processing Units Abstract A very popular discipline in bioinformatics is Next-Generation Sequencing (NGS) or DNA sequencing. It specifies
More informationSolexaLIMS: A Laboratory Information Management System for the Solexa Sequencing Platform
SolexaLIMS: A Laboratory Information Management System for the Solexa Sequencing Platform Brian D. O Connor, 1, Jordan Mendler, 1, Ben Berman, 2, Stanley F. Nelson 1 1 Department of Human Genetics, David
More informationINTRODUCTION AUX FORMATS DE FICHIERS
INTRODUCTION AUX FORMATS DE FICHIERS Plan. Formats de séquences brutes.. Format fasta.2. Format fastq 2. Formats d alignements 2.. Format SAM 2.2. Format BAM 4. Format «Variant Calling» 4.. Format Varscan
More informationHiScanSQ System Site Preparation Guide
HiScanSQ System Site Preparation Guide FOR RESEARCH USE ONLY Introduction 3 Supported Configurations 4 User-Supplied Equipment and Materials 5 Delivery and Installation 6 Operation, Maintenance, and Service
More informationAligners. J Fass 23 August 2017
Aligners J Fass 23 August 2017 Definitions Assembly: I ve found the shredded remains of an important document; put it back together! UC Davis Genome Center Bioinformatics Core J Fass Aligners 2017-08-23
More informationRun Setup and Bioinformatic Analysis. Accel-NGS 2S MID Indexing Kits
Run Setup and Bioinformatic Analysis Accel-NGS 2S MID Indexing Kits Sequencing MID Libraries For MiSeq, HiSeq, and NextSeq instruments: Modify the config file to create a fastq for index reads Using the
More informationGSNAP: Fast and SNP-tolerant detection of complex variants and splicing in short reads by Thomas D. Wu and Serban Nacu
GSNAP: Fast and SNP-tolerant detection of complex variants and splicing in short reads by Thomas D. Wu and Serban Nacu Matt Huska Freie Universität Berlin Computational Methods for High-Throughput Omics
More informationAnalysis of ChIP-seq data
Before we start: 1. Log into tak (step 0 on the exercises) 2. Go to your lab space and create a folder for the class (see separate hand out) 3. Connect to your lab space through the wihtdata network and
More informationThe software and data for the RNA-Seq exercise are already available on the USB system
BIT815 Notes on R analysis of RNA-seq data The software and data for the RNA-Seq exercise are already available on the USB system The notes below regarding installation of R packages and other software
More informationTiling Assembly for Annotation-independent Novel Gene Discovery
Tiling Assembly for Annotation-independent Novel Gene Discovery By Jennifer Lopez and Kenneth Watanabe Last edited on September 7, 2015 by Kenneth Watanabe The following procedure explains how to run the
More informationExome sequencing. Jong Kyoung Kim
Exome sequencing Jong Kyoung Kim Genome Analysis Toolkit The GATK is the industry standard for identifying SNPs and indels in germline DNA and RNAseq data. Its scope is now expanding to include somatic
More informationNGS Data Analysis. Roberto Preste
NGS Data Analysis Roberto Preste 1 Useful info http://bit.ly/2r1y2dr Contacts: roberto.preste@gmail.com Slides: http://bit.ly/ngs-data 2 NGS data analysis Overview 3 NGS Data Analysis: the basic idea http://bit.ly/2r1y2dr
More informationDifferential gene expression analysis using RNA-seq
https://abc.med.cornell.edu/ Differential gene expression analysis using RNA-seq Applied Bioinformatics Core, September/October 2018 Friederike Dündar with Luce Skrabanek & Paul Zumbo Day 3: Counting reads
More informationPerforming whole genome SNP analysis with mapping performed locally
BioNumerics Tutorial: Performing whole genome SNP analysis with mapping performed locally 1 Introduction 1.1 An introduction to whole genome SNP analysis A Single Nucleotide Polymorphism (SNP) is a variation
More informationData Preprocessing. Next Generation Sequencing analysis DTU Bioinformatics Next Generation Sequencing Analysis
Data Preprocessing Next Generation Sequencing analysis DTU Bioinformatics Generalized NGS analysis Data size Application Assembly: Compare Raw Pre- specific: Question Alignment / samples / Answer? reads
More informationSupplementary Information. Detecting and annotating genetic variations using the HugeSeq pipeline
Supplementary Information Detecting and annotating genetic variations using the HugeSeq pipeline Hugo Y. K. Lam 1,#, Cuiping Pan 1, Michael J. Clark 1, Phil Lacroute 1, Rui Chen 1, Rajini Haraksingh 1,
More informationData Preprocessing : Next Generation Sequencing analysis CBS - DTU Next Generation Sequencing Analysis
Data Preprocessing 27626: Next Generation Sequencing analysis CBS - DTU Generalized NGS analysis Data size Application Assembly: Compare Raw Pre- specific: Question Alignment / samples / Answer? reads
More informationversion /1/2011 Source code Linux x86_64 binary Mac OS X x86_64 binary
Cufflinks RNA-Seq analysis tools - Getting Started 1 of 6 14.07.2011 09:42 Cufflinks Transcript assembly, differential expression, and differential regulation for RNA-Seq Site Map Home Getting started
More informationAnalyzing Variant Call results using EuPathDB Galaxy, Part II
Analyzing Variant Call results using EuPathDB Galaxy, Part II In this exercise, we will work in groups to examine the results from the SNP analysis workflow that we started yesterday. The first step is
More informationRNA-Seq Analysis With the Tuxedo Suite
June 2016 RNA-Seq Analysis With the Tuxedo Suite Dena Leshkowitz Introduction In this exercise we will learn how to analyse RNA-Seq data using the Tuxedo Suite tools: Tophat, Cuffmerge, Cufflinks and Cuffdiff.
More informationMolecular Identifier (MID) Analysis for TAM-ChIP Paired-End Sequencing
Molecular Identifier (MID) Analysis for TAM-ChIP Paired-End Sequencing Catalog Nos.: 53126 & 53127 Name: TAM-ChIP antibody conjugate Description Active Motif s TAM-ChIP technology combines antibody directed
More informationAnalysis of high-throughput sequencing data. Simon Anders EBI
Analysis of high-throughput sequencing data Simon Anders EBI Outline Overview on high-throughput sequencing (HTS) technologies, focusing on Solexa's GenomAnalyzer as example Software requirements to works
More informationCLC Server. End User USER MANUAL
CLC Server End User USER MANUAL Manual for CLC Server 10.0.1 Windows, macos and Linux March 8, 2018 This software is for research purposes only. QIAGEN Aarhus Silkeborgvej 2 Prismet DK-8000 Aarhus C Denmark
More informationNext generation sequencing: assembly by mapping reads. Laurent Falquet, Vital-IT Helsinki, June 3, 2010
Next generation sequencing: assembly by mapping reads Laurent Falquet, Vital-IT Helsinki, June 3, 2010 Overview What is assembly by mapping? Methods BWT File formats Tools Issues Visualization Discussion
More informationGenetics 211 Genomics Winter 2014 Problem Set 4
Genomics - Part 1 due Friday, 2/21/2014 by 9:00am Part 2 due Friday, 3/7/2014 by 9:00am For this problem set, we re going to use real data from a high-throughput sequencing project to look for differential
More informationMiSeq Reporter TruSeq Amplicon Workflow Guide
MiSeq Reporter TruSeq Amplicon Workflow Guide For Research Use Only. Not for use in diagnostic procedures. Revision History 3 Introduction 4 TruSeq Amplicon Workflow Overview 5 TruSeq Amplicon Summary
More informationNext Generation Sequencing
Next Generation Sequencing Cavan Reilly November 21, 2014 Table of contents Next generation sequencing NGS and microarrays Study design Quality assessment Burrows Wheeler transform BWT example Introduction
More information