Molecular Index Error correction
|
|
- Melina Davidson
- 5 years ago
- Views:
Transcription
1 Molecular Index Error correction Overview: This section provides directions for generating SSCS (Single Strand Consensus Sequence) reads and trimming molecular indexes from raw fastq files. Learning Objectives: Use python script to generate SSCS Reads. Use flexbar to trim molecular indexes from duplex seq libraries. Tutorial: SSCS Reads Since this will take longer we will first use First we want to generate SSCS reads where we take advantage of the molecular indexes added during library prep. For the purpose of this tutorial, the paired end sequencing of sample DED110 has been placed in the $BI/gva_course /mixed_population directory. To do so we will use a "majority rules" python script (named SSCS_DCS.py) which was heavily modified by DED from a script originally created by Mike Schmitt and Scott Kennedy for the original duplex seq paper. This script can be found in the $BI/scripts directory. Invoking the script is as simple as typing SSCS_DCS.py; adding -h will give a list of the available options. The goal of this command is to generate SSCS reads, for any molecular index where we have at least 2 reads present, and to generate a log file which will tell us some information about the data. Click here for solution of how to copy the DED110 fastq files to a new directorry called BDIB_Error_Correction cds mkdir BDIB_Error_Correction cd BDIB_Error_Correction cp $BI/gva_course/mixed_population/DED110*.fastq. Interrogate the SSCS_DCS.py script to determine how to invoke it. Click here for hints before the answer You can often get more information about python scripts by typing the name of the script followed by the -h command.
2 If you see an error message check here for a probable solution Traceback (most recent call last): File "/corral-repl/utexas/bioiteam/bin/sscs_dcs.py", line 45, in <module> import numpy / init.py", line 170, in <module> from. import add_newdocs /add_newdocs.py", line 13, in <module> from numpy.lib import add_newdoc /lib/ init.py", line 8, in <module> from.type_check import * /lib/type_check.py", line 11, in <module> import numpy.core.numeric as _nx /core/ init.py", line 46, in <module> from numpy.testing import Tester /testing/ init.py", line 13, in <module> from.utils import * /testing/utils.py", line 15, in <module> from tempfile import mkdtemp File "/opt/apps/python/epd/7.3.2/lib/python2.7/tempfile.py", line 34, in <module> from random import Random as _Random File "/opt/apps/python/epd/7.3.2/lib/python2.7/random.py", line 47, in <module> from os import urandom as _urandom ImportError: cannot import name urandom # this error message seems to be being caused by the default version of python which is loaded on login from your.profile module swap python/2.7.3-epd python/2.7.1 # will swap 1 version of python for another. If you start having other problems with other programs you may need to switch back to the other version
3 The -h command should show you these options as being the key options to use/consider -f1 FASTQ1, --fastq1 FASTQ1 fastq read1 file to check -f2 FASTQ2, --fastq2 FASTQ2 fastq read2 file to check -p PREFIX, --prefix PREFIX prefix for output files -s, --SSCS calculate SSCS sequence, off by default. IF DCS specificed, automatically on -m MINIMUM_READS, --minimum_reads MINIMUM_READS minimum number of reads needed to support SSCS reads --log LOG name of output log file Using that information, see if you can figure out how to put the command together SSCS_DCS.py -f1 DED110_CATGGC_L006_R1_001.fastq -f2 DED110_CATGGC_L006_R2_001.fastq -p DED110 -s -m 2 --log SSCS_Log This should take ~15 minutes to complete in an idev shell. While this is completing we suggest generating.fastq files where the molecular index has been trimmed from the read to familiarize yourself with flexbar and to set up input files for a more advanced optional breseq tutorial. Error correction evaluation: The SSCS_Log is a great place to start. Use the tail command to look at the last 8 lines of the log file to determine how many reads made it from raw reads to error corrected SSCS reads. tail -n 8 SSCS_Log help with the tail command Approximately what fraction of raw reads became SSCS reads? There are approximately 1/6th as many SSCS reads as raw reads: Total Reads: SSCS count: While this is somewhat misleading as it takes a minimum of 2 reads to generate a single SSCS read, we do have some additional information regarding what happened to the other reads. The first thing is to consider is the "Dual MI Reads" these represent the reads which correctly had the 12bp of degenerate sequence and the 4bp anchor. In this case, more than 1.5 million reads lacked an identifyable molecular index on read 1 and/or read 2. By that regard, we had ~1/4 as many SSCS reads as raw reads. Perhaps more interesting is the number of errors removed. This is also available in the SSC_Log file, but in the middle of the file and don't have any good handle to grep with. One option is to cat the entire file and scroll around, another is to use tail/head commands you can get the specific lines only: tail -n 94 SSCS_Log head -n 86 help with the tail command
4 The 3 columns are the read posistion, the number of bases changed, and the number of bases not changed. If you copy and paste these 3 columns into excel you can easily calculate the sum of the 2nd column to see that 446,104 bases were changed. The read position is based on the 5-3' sequence, and you should notice that generally the higher the read position, the more errors were corrected. This should make sense based on what we have talked about with decreasing quality scores as read length increases. Tutorial (Trimmed Reads): For the purpose of this tutorial, we will be working with flexbar which like breseq is something that we have installed in the BioITeam as it is not a tacc module. Test that flexbar is installed and working correctly using the which command and 'flexbar -h'. If these commands work, note that this is the perfect example of the benefits of the BioITeam. This is has proven to be an extremely difficult command to install and configure and install in the past, leading me to place it in the $BI/bin directory, but it still required additional options (expand the next section to see what those may have been). Yet if it is working it strongly suggests some other member of the BioITeam found it available, and fixed it in some way so it works by default. If error messages are displayed you may need to try the following as has been necessary in previous years Some additional modules must be loaded in order for it to work correctly, and the LD_LIBRARY_PATH variable must be modified as listed below. module swap intel gcc export LD_LIBRARY_PATH=/corral-repl/utexas/BioITeam/flexbar_v2. 23_linux64:$LD_LIBRARY_PATH For this tutorial, it is sufficient to simply type these commands out, if this becomes something you want to do more often, or want to submit as a job, it would be important to add these lines to your.profile so they are loaded each time you log in, and available by default to the compute nodes. If the above commands are executed properly, typing flexbar -h should display a lengthy list of optional arguments which can be used for a variety of purposes. For the purpose of this tutorial, we will only focus on trimming the first 16 bases off each read as this represents the 12 bases of the molecular index and a 4 base constant region. See if you can figure out what the command is based on the help output pay special attention to the -t option. If you need a hint without the answer click the triangle... The following arguments are the ones that are needed to successfully trim the first 16 bases of the sequence: -u, --max-uncalled NUM Allowed uncalled bases (N or.) in reads, default: 0 -x, --pre-trim-left NUM Trim specified number of bases on 5' end of reads before alignment -t, --target STR Prefix for output file names -r, --reads FILE Input file with reads, that may contain barcodes -p, --reads2 FILE Second input file for paired read scenario -f, --format STR Input format of reads: csfasta, csfastq, fasta, fastq, fastqsanger, fastq-solexa, fastq-i1.3, fastq-i1.5, fastq-i1.8 (illumina 1.8+) -d, --length-dist Write length distribution for read output files
5 click here for the answer flexbar -u 100 -x 16 -t trimmed -r DED110_CATGGC_L006_R1_001.fastq -p DED110_CATGGC_L006_R2_001.fastq -f fastq -d In an idev shell this should take less than 5 minutes to complete. Once completed there should be 4 new files, all of which begin with "trimmed" if you took the answer from the above help, or whatever string you entered for the -t argument if you did not use the above help. These 4 files represent the trimmed fastq files, the length distribution. Using the head command, see if you can figure out which file is which. click here for the answer to which file is which the trimmed_1/2.fastq is the trimmed fastq files the trimmed_1/2.fastq.lengthdist is the length distribution file (which should have 2 lines: a header line and a line showing that all of the reads are 85 bp long now Next step: You should now have 3 new.fastq files which we will use to call variants in: DED110_SSCS.fastq, trimmed_1.fastq, and trimmed_2.fastq. You could take these files into a more in depth breseq tutorial that was prepared last year for comparisons of the specific mutations that are eliminated using the error correction (SSCS). Link to other optional tutorial.
Preparation of alignments for variant calling with GATK: exercise instructions for BioHPC Lab computers
Preparation of alignments for variant calling with GATK: exercise instructions for BioHPC Lab computers Data used in the exercise We will use D. melanogaster WGS paired-end Illumina data with NCBI accessions
More informationRead mapping with BWA and BOWTIE
Read mapping with BWA and BOWTIE Before We Start In order to save a lot of typing, and to allow us some flexibility in designing these courses, we will establish a UNIX shell variable BASE to point to
More informationIntroduction to Linux Environment. Yun-Wen Chen
Introduction to Linux Environment Yun-Wen Chen 1 The Text (Command) Mode in Linux Environment 2 The Main Operating Systems We May Meet 1. Windows 2. Mac 3. Linux (Unix) 3 Windows Command Mode and DOS Type
More informationChIP-seq Analysis Practical
ChIP-seq Analysis Practical Vladimir Teif (vteif@essex.ac.uk) An updated version of this document will be available at http://generegulation.info/index.php/teaching In this practical we will learn how
More informationCalling variants in diploid or multiploid genomes
Calling variants in diploid or multiploid genomes Diploid genomes The initial steps in calling variants for diploid or multi-ploid organisms with NGS data are the same as what we've already seen: 1. 2.
More informationBy Ludovic Duvaux (27 November 2013)
Array of jobs using SGE - an example using stampy, a mapping software. Running java applications on the cluster - merge sam files using the Picard tools By Ludovic Duvaux (27 November 2013) The idea ==========
More informationEssential Skills for Bioinformatics: Unix/Linux
Essential Skills for Bioinformatics: Unix/Linux SHELL SCRIPTING Overview Bash, the shell we have used interactively in this course, is a full-fledged scripting language. Unlike Python, Bash is not a general-purpose
More informationCSC209. Software Tools and Systems Programming. https://mcs.utm.utoronto.ca/~209
CSC209 Software Tools and Systems Programming https://mcs.utm.utoronto.ca/~209 What is this Course About? Software Tools Using them Building them Systems Programming Quirks of C The file system System
More informationpreparation methods and new bacterial strains. Parts of the pipeline that can be updated will be annotated in this guide.
BacSeq Introduction The purpose of this guide is to aid current and future Whiteley Lab members and University of Texas microbiologists with bacterial RNA?Seq analysis. Once you have analyzed your data
More informationSAM : Sequence Alignment/Map format. A TAB-delimited text format storing the alignment information. A header section is optional.
Alignment of NGS reads, samtools and visualization Hands-on Software used in this practical BWA MEM : Burrows-Wheeler Aligner. A software package for mapping low-divergent sequences against a large reference
More informationWorking With Unix. Scott A. Handley* September 15, *Adapted from UNIX introduction material created by Dr. Julian Catchen
Working With Unix Scott A. Handley* September 15, 2014 *Adapted from UNIX introduction material created by Dr. Julian Catchen What is UNIX? An operating system (OS) Designed to be multiuser and multitasking
More informationSequence Data Quality Assessment Exercises and Solutions.
Sequence Data Quality Assessment Exercises and Solutions. Starting Note: Please do not copy and paste the commands. Characters in this document may not be copied correctly. Please type the commands and
More informationUser Manual. This is the example for Oases: make color 'VELVET_DIR=/full_path_of_velvet_dir/' 'MAXKMERLENGTH=63' 'LONGSEQUENCES=1'
SATRAP v0.1 - Solid Assembly TRAnslation Program User Manual Introduction A color space assembly must be translated into bases before applying bioinformatics analyses. SATRAP is designed to accomplish
More informationLecture 8. Sequence alignments
Lecture 8 Sequence alignments DATA FORMATS bioawk bioawk is a program that extends awk s powerful processing of tabular data to processing tasks involving common bioinformatics formats like FASTA/FASTQ,
More informationThese will serve as a basic guideline for read prep. This assumes you have demultiplexed Illumina data.
These will serve as a basic guideline for read prep. This assumes you have demultiplexed Illumina data. We have a few different choices for running jobs on DT2 we will explore both here. We need to alter
More informationMar. Guide. Edico Genome Inc North Torrey Pines Court, Plaza Level, La Jolla, CA 92037
Mar 2017 DRAGEN TM Quick Start Guide www.edicogenome.com info@edicogenome.com Edico Genome Inc. 3344 North Torrey Pines Court, Plaza Level, La Jolla, CA 92037 Notice Contents of this document and associated
More information2018/04/11 00:10 1/6 NuttX Protected Build
2018/04/11 00:10 1/6 NuttX Protected Build NuttX Protected Build The Traditional "Flat" Build The traditional NuttX build is a flat build. By flat, I mean that when you build NuttX, you end up with a single
More informationWhole genome assembly comparison of duplication originally described in Bailey et al
WGAC Whole genome assembly comparison of duplication originally described in Bailey et al. 2001. Inputs species name path to FASTA sequence(s) to be processed either a directory of chromosomal FASTA files
More informationEssential Linux Shell Commands
Essential Linux Shell Commands Special Characters Quoting and Escaping Change Directory Show Current Directory List Directory Contents Working with Files Working with Directories Special Characters There
More informationResequencing Analysis. (Pseudomonas aeruginosa MAPO1 ) Sample to Insight
Resequencing Analysis (Pseudomonas aeruginosa MAPO1 ) 1 Workflow Import NGS raw data Trim reads Import Reference Sequence Reference Mapping QC on reads Variant detection Case Study Pseudomonas aeruginosa
More informationUnix/Linux Basics. Cpt S 223, Fall 2007 Copyright: Washington State University
Unix/Linux Basics 1 Some basics to remember Everything is case sensitive Eg., you can have two different files of the same name but different case in the same folder Console-driven (same as terminal )
More informationVariation among genomes
Variation among genomes Comparing genomes The reference genome http://www.ncbi.nlm.nih.gov/nuccore/26556996 Arabidopsis thaliana, a model plant Col-0 variety is from Landsberg, Germany Ler is a mutant
More informationUnix basics exercise MBV-INFX410
Unix basics exercise MBV-INFX410 In order to start this exercise, you need to be logged in on a UNIX computer with a terminal window open on your computer. It is best if you are logged in on freebee.abel.uio.no.
More informationLinux Bash Shell Scripting
University of Chicago Initiative in Biomedical Informatics Computation Institute Linux Bash Shell Scripting Present by: Mohammad Reza Gerami gerami@ipm.ir Day 2 Outline Support Review of Day 1 exercise
More informationCENG 334 Computer Networks. Laboratory I Linux Tutorial
CENG 334 Computer Networks Laboratory I Linux Tutorial Contents 1. Logging In and Starting Session 2. Using Commands 1. Basic Commands 2. Working With Files and Directories 3. Permission Bits 3. Introduction
More informationCOMS 6100 Class Notes 3
COMS 6100 Class Notes 3 Daniel Solus September 1, 2016 1 General Remarks The class was split into two main sections. We finished our introduction to Linux commands by reviewing Linux commands I and II
More informationShared Memory Programming With OpenMP Computer Lab Exercises
Shared Memory Programming With OpenMP Computer Lab Exercises Advanced Computational Science II John Burkardt Department of Scientific Computing Florida State University http://people.sc.fsu.edu/ jburkardt/presentations/fsu
More informationComputer Stuff. This FEA output is for a fairly simple geometry and the hot-spot is obvious.
Computer Stuff Thus far in this course we have only used computers for display, a bit of digitization and some graphing. In the up-coming calculation sections things are going to get much more compute
More informationVariant calling using SAMtools
Variant calling using SAMtools Calling variants - a trivial use of an Interactive Session We are going to conduct the variant calling exercises in an interactive idev session just so you can get a feel
More informationScripting Languages Course 1. Diana Trandabăț
Scripting Languages Course 1 Diana Trandabăț Master in Computational Linguistics - 1 st year 2017-2018 Today s lecture Introduction to scripting languages What is a script? What is a scripting language
More informationGenome 373: Mapping Short Sequence Reads III. Doug Fowler
Genome 373: Mapping Short Sequence Reads III Doug Fowler What is Galaxy? Galaxy is a free, open source web platform for running all sorts of computational analyses including pretty much all of the sequencing-related
More informationCSC BioWeek 2018: Using Taito cluster for high throughput data analysis
CSC BioWeek 2018: Using Taito cluster for high throughput data analysis 7. 2. 2018 Running Jobs in CSC Servers Exercise 1: Running a simple batch job in Taito We will run a small alignment using BWA: https://research.csc.fi/-/bwa
More informationBIOS 546 Midterm March 26, Write the line of code that all Perl programs on biolinx must start with so they can be executed.
1. What values are false in Perl? BIOS 546 Midterm March 26, 2007 2. Write the line of code that all Perl programs on biolinx must start with so they can be executed. 3. How do you make a comment in Perl?
More informationContents. Note: pay attention to where you are. Note: Plaintext version. Note: pay attention to where you are... 1 Note: Plaintext version...
Contents Note: pay attention to where you are........................................... 1 Note: Plaintext version................................................... 1 Hello World of the Bash shell 2 Accessing
More informationumicount Documentation
umicount Documentation Release 1.0 Mickael June 30, 2015 Contents 1 Introduction 3 2 Recommendations 5 3 Install 7 4 How to use umicount 9 4.1 Working with a single bed file......................................
More informationLinux Command Line Interface. December 27, 2017
Linux Command Line Interface December 27, 2017 Foreword It is supposed to be a refresher (?!) If you are familiar with UNIX/Linux/MacOS X CLI, this is going to be boring... I will not talk about editors
More informationDOWNLOAD OR READ : UNIX SHELL OBJECTS WITH CONTAINS ALL CODE FROM THE BOOK TOOLS PDF EBOOK EPUB MOBI
DOWNLOAD OR READ : UNIX SHELL OBJECTS WITH CONTAINS ALL CODE FROM THE BOOK TOOLS PDF EBOOK EPUB MOBI Page 1 Page 2 unix shell objects with contains all code from the book tools unix shell objects with
More informationDNA / RNA sequencing
Outline Ways to generate large amounts of sequence Understanding the contents of large sequence files Fasta format Fastq format Sequence quality metrics Summarizing sequence data quality/quantity Using
More informationLab 8: Using POY from your desktop and through CIPRES
Integrative Biology 200A University of California, Berkeley PRINCIPLES OF PHYLOGENETICS Spring 2012 Updated by Michael Landis Lab 8: Using POY from your desktop and through CIPRES In this lab we re going
More informationImporting your Exeter NGS data into Galaxy:
Importing your Exeter NGS data into Galaxy: The aim of this tutorial is to show you how to import your raw Illumina FASTQ files and/or assemblies and remapping files into Galaxy. As of 1 st July 2011 Illumina
More informationSep. Guide. Edico Genome Corp North Torrey Pines Court, Plaza Level, La Jolla, CA 92037
Sep 2017 DRAGEN TM Quick Start Guide www.edicogenome.com info@edicogenome.com Edico Genome Corp. 3344 North Torrey Pines Court, Plaza Level, La Jolla, CA 92037 Notice Contents of this document and associated
More informationRelease Notes. Version Gene Codes Corporation
Version 4.10.1 Release Notes 2010 Gene Codes Corporation Gene Codes Corporation 775 Technology Drive, Ann Arbor, MI 48108 USA 1.800.497.4939 (USA) +1.734.769.7249 (elsewhere) +1.734.769.7074 (fax) www.genecodes.com
More informationIntroduction: What is Unix?
Introduction Introduction: What is Unix? An operating system Developed at AT&T Bell Labs in the 1960 s Command Line Interpreter GUIs (Window systems) are now available Introduction: Unix vs. Linux Unix
More informationIntroduction to Python Code Quality
Introduction to Python Code Quality Clarity and readability are important (easter egg: type import this at the Python prompt), as well as extensibility, meaning code that can be easily enhanced and extended.
More informationDepartment of Computer Science and Technology
M.Sc. (CA) (2 nd Semester) 040020202 : UNIX Internals and Shell Programming Teaching Schedule Objective: To acquaint the students with the basic internal structure & operations of UNIX operating system,
More informationASAP - Allele-specific alignment pipeline
ASAP - Allele-specific alignment pipeline Jan 09, 2012 (1) ASAP - Quick Reference ASAP needs a working version of Perl and is run from the command line. Furthermore, Bowtie needs to be installed on your
More informationPROJECT INFRASTRUCTURE AND BASH INTRODUCTION MARKUS PILMAN<
PROJECT INFRASTRUCTURE AND BASH INTRODUCTION MARKUS PILMAN< MPILMAN@INF.ETHZ.CH> ORGANIZATION Tutorials on Tuesdays - Sometimes, will be announced In General: no exercise sessions (unless you get an email
More informationMaize genome sequence in FASTA format. Gene annotation file in gff format
Exercise 1. Using Tophat/Cufflinks to analyze RNAseq data. Step 1. One of CBSU BioHPC Lab workstations has been allocated for your workshop exercise. The allocations are listed on the workshop exercise
More informationWhen talking about how to launch commands and other things that is to be typed into the terminal, the following syntax is used:
Linux Tutorial How to read the examples When talking about how to launch commands and other things that is to be typed into the terminal, the following syntax is used: $ application file.txt
More informationLab 2: Training monophone models
v. 1.1 Lab 2: Training monophone models University of Edinburgh January 29, 2018 Last time we begun to get familiar with some of Kaldi s tools and set up a data directory for TIMIT. This time we will train
More informationAn Introduction to Linux and Bowtie
An Introduction to Linux and Bowtie Cavan Reilly November 10, 2017 Table of contents Introduction to UNIX-like operating systems Installing programs Bowtie SAMtools Introduction to Linux In order to use
More informationLAB 5, THE HIDDEN DELIGHTS OF LINKED LISTS
LAB 5, THE HIDDEN DELIGHTS OF LINKED LISTS Questions are based on the Main and Savitch review questions for chapter 5 in the Exam Preparation section of the webct course page. In case you haven t observed
More informationSAM / BAM Tutorial. EMBL Heidelberg. Course Materials. Tobias Rausch September 2012
SAM / BAM Tutorial EMBL Heidelberg Course Materials Tobias Rausch September 2012 Contents 1 SAM / BAM 3 1.1 Introduction................................... 3 1.2 Tasks.......................................
More informationThe Directory Structure
The Directory Structure All the files are grouped together in the directory structure. The file-system is arranged in a hierarchical structure, like an inverted tree. The top of the hierarchy is traditionally
More informationCS 1110 SPRING 2016: GETTING STARTED (Jan 27-28) First Name: Last Name: NetID:
CS 1110 SPRING 2016: GETTING STARTED (Jan 27-28) http://www.cs.cornell.edu/courses/cs1110/2016sp/labs/lab01/lab01.pdf First Name: Last Name: NetID: Goals. Learning a computer language is a lot like learning
More informationExercise 1: Basic Tools
Exercise 1: Basic Tools This exercise is created so everybody can learn the basic tools we will use during this course. It is really more like a tutorial than an exercise and, you are not required to submit
More informationCSC209. Software Tools and Systems Programming. https://mcs.utm.utoronto.ca/~209
CSC209 Software Tools and Systems Programming https://mcs.utm.utoronto.ca/~209 What is this Course About? Software Tools Using them Building them Systems Programming Quirks of C The file system System
More informationENCM 339 Fall 2017: Editing and Running Programs in the Lab
page 1 of 8 ENCM 339 Fall 2017: Editing and Running Programs in the Lab Steve Norman Department of Electrical & Computer Engineering University of Calgary September 2017 Introduction This document is a
More informationLinux + Galaxy Server Tutorial
Linux + Galaxy Server Tutorial Pei-Chen Peng Linux+Galaxy Pei-Chen Peng 2017 1 Introduction Exercise 1. Download lab data to flash drive. 2. Run a simple bioinformatics program on linux.. 3. Learn Galaxy
More informationIntroduction to Unix: Fundamental Commands
Introduction to Unix: Fundamental Commands Ricky Patterson UVA Library Based on slides from Turgut Yilmaz Istanbul Teknik University 1 What We Will Learn The fundamental commands of the Unix operating
More informationRNA-Seq in Galaxy: Tuxedo protocol. Igor Makunin, UQ RCC, QCIF
RNA-Seq in Galaxy: Tuxedo protocol Igor Makunin, UQ RCC, QCIF Acknowledgments Genomics Virtual Lab: gvl.org.au Galaxy for tutorials: galaxy-tut.genome.edu.au Galaxy Australia: galaxy-aust.genome.edu.au
More informationhttp://xkcd.com/208/ 1. Review of pipes 2. Regular expressions 3. sed 4. awk 5. Editing Files 6. Shell loops 7. Shell scripts cat seqs.fa >0! TGCAGGTATATCTATTAGCAGGTTTAATTTTGCCTGCACTTGGTTGGGTACATTATTTTAAGTGTATTTGACAAG!
More informationLecture 3. Essential skills for bioinformatics: Unix/Linux
Lecture 3 Essential skills for bioinformatics: Unix/Linux RETRIEVING DATA Overview Whether downloading large sequencing datasets or accessing a web application hundreds of times to download specific files,
More informationCS 1510: Intro to Computing - Fall 2017 Assignment 8: Tracking the Greats of the NBA
CS 1510: Intro to Computing - Fall 2017 Assignment 8: Tracking the Greats of the NBA Code Due: Tuesday, November 7, 2017, by 11:59 p.m. The Assignment The purpose of this assignment is to give you more
More informationConnect to login8.stampede.tacc.utexas.edu. Sample Datasets
Alignment Overview Connect to login8.stampede.tacc.utexas.edu Sample Datasets Reference Genomes Exercise #1: BWA global alignment Yeast ChIP-seq Overview ChIP-seq alignment workflow with BWA Introducing
More informationShared Memory Programming With OpenMP Exercise Instructions
Shared Memory Programming With OpenMP Exercise Instructions John Burkardt Interdisciplinary Center for Applied Mathematics & Information Technology Department Virginia Tech... Advanced Computational Science
More informationMIC Lab Parallel Computing on Stampede
MIC Lab Parallel Computing on Stampede Aaron Birkland and Steve Lantz Cornell Center for Advanced Computing June 11 & 18, 2013 1 Interactive Launching This exercise will walk through interactively launching
More informationVariables: Objects in R
Variables: Objects in R Basic R Functionality Introduction to R for Public Health Researchers Common new users frustations 1. Different versions of software 2. Data type problems (is that a string or a
More informationRun Setup and Bioinformatic Analysis. Accel-NGS 2S MID Indexing Kits
Run Setup and Bioinformatic Analysis Accel-NGS 2S MID Indexing Kits Sequencing MID Libraries For MiSeq, HiSeq, and NextSeq instruments: Modify the config file to create a fastq for index reads Using the
More informationTrimming and quality control ( )
Trimming and quality control (2015-06-03) Alexander Jueterbock, Martin Jakt PhD course: High throughput sequencing of non-model organisms Contents 1 Overview of sequence lengths 2 2 Quality control 3 3
More informationHelpful Galaxy screencasts are available at:
This user guide serves as a simplified, graphic version of the CloudMap paper for applicationoriented end-users. For more details, please see the CloudMap paper. Video versions of these user guides and
More informationExsys RuleBook Selector Tutorial. Copyright 2004 EXSYS Inc. All right reserved. Printed in the United States of America.
Exsys RuleBook Selector Tutorial Copyright 2004 EXSYS Inc. All right reserved. Printed in the United States of America. This documentation, as well as the software described in it, is furnished under license
More information6.033 Computer System Engineering
MIT OpenCourseWare http://ocw.mit.edu 6.033 Computer System Engineering Spring 2009 For information about citing these materials or our Terms of Use, visit: http://ocw.mit.edu/terms. M.I.T. DEPARTMENT
More informationExercise 1. RNA-seq alignment and quantification. Part 1. Prepare the working directory. Part 2. Examine qualities of the RNA-seq data files
Exercise 1. RNA-seq alignment and quantification Part 1. Prepare the working directory. 1. Connect to your assigned computer. If you do not know how, follow the instruction at http://cbsu.tc.cornell.edu/lab/doc/remote_access.pdf
More informationAssignment 2. Summary. Some Important bash Instructions. CSci132 Practical UNIX and Programming Assignment 2, Fall Prof.
Assignment 2 Summary The purpose of this assignment is to give you some practice in bash scripting. When you write a bash script, you are really writing a program in the bash programming language. In class
More informationA Brief Introduction to the Linux Shell for Data Science
A Brief Introduction to the Linux Shell for Data Science Aris Anagnostopoulos 1 Introduction Here we will see a brief introduction of the Linux command line or shell as it is called. Linux is a Unix-like
More informationITMO Ecole de Bioinformatique Hands-on session: smallrna-seq N. Servant 21 rd November 2013
ITMO Ecole de Bioinformatique Hands-on session: smallrna-seq N. Servant 21 rd November 2013 1. Data and objectives We will use the data from GEO (GSE35368, Toedling, Servant et al. 2011). Two samples were
More information1. mirmod (Version: 0.3)
1. mirmod (Version: 0.3) mirmod is a mirna modification prediction tool. It identifies modified mirnas (5' and 3' non-templated nucleotide addition as well as trimming) using small RNA (srna) sequencing
More informationCopyright 2014 Regents of the University of Minnesota
Quality Control of Illumina Data using Galaxy August 18, 2014 Contents 1 Introduction 2 1.1 What is Galaxy?..................................... 2 1.2 Galaxy at MSI......................................
More informationPractical Linux examples: Exercises
Practical Linux examples: Exercises 1. Login (ssh) to the machine that you are assigned for this workshop (assigned machines: https://cbsu.tc.cornell.edu/ww/machines.aspx?i=87 ). Prepare working directory,
More informationFalcon Accelerated Genomics Data Analysis Solutions. User Guide
Falcon Accelerated Genomics Data Analysis Solutions User Guide Falcon Computing Solutions, Inc. Version 1.0 3/30/2018 Table of Contents Introduction... 3 System Requirements and Installation... 4 Software
More informationShort Read Sequencing Analysis Workshop
Short Read Sequencing Analysis Workshop Day 2 Learning the Linux Compute Environment In-class Slides Matt Hynes-Grace Manager of IT Operations, BioFrontiers Institute Review of Day 2 Videos Video 1 Introduction
More informationAnalyzing ChIP- Seq Data in Galaxy
Analyzing ChIP- Seq Data in Galaxy Lauren Mills RISS ABSTRACT Step- by- step guide to basic ChIP- Seq analysis using the Galaxy platform. Table of Contents Introduction... 3 Links to helpful information...
More informationCopyright 2014 Regents of the University of Minnesota
Quality Control of Illumina Data using Galaxy Contents September 16, 2014 1 Introduction 2 1.1 What is Galaxy?..................................... 2 1.2 Galaxy at MSI......................................
More informationUSEARCH Suite and UPARSE Pipeline. Susan Huse Brown University August 7, 2015
USEARCH Suite and UPARSE Pipeline Susan Huse Brown University August 7, 2015 USEARCH Robert Edgar USEARCH and UCLUST Edgar (201) Bioinforma)cs 26(19) UCHIME Edgar et al. (2011) Bioinforma)cs 27(16) UPARSE
More informationUnix Tutorial Haverford Astronomy 2014/2015
Unix Tutorial Haverford Astronomy 2014/2015 Overview of Haverford astronomy computing resources This tutorial is intended for use on computers running the Linux operating system, including those in the
More informationNBIC TechTrack PBS Tutorial. by Marcel Kempenaar, NBIC Bioinformatics Research Support group, University Medical Center Groningen
NBIC TechTrack PBS Tutorial by Marcel Kempenaar, NBIC Bioinformatics Research Support group, University Medical Center Groningen 1 NBIC PBS Tutorial This part is an introduction to clusters and the PBS
More informationIntroduction to UNIX. Logging in. Basic System Architecture 10/7/10. most systems have graphical login on Linux machines
Introduction to UNIX Logging in Basic system architecture Getting help Intro to shell (tcsh) Basic UNIX File Maintenance Intro to emacs I/O Redirection Shell scripts Logging in most systems have graphical
More informationUNIX Tutorial One
1.1 Listing files and directories ls (list) When you first login, your current working directory is your home directory. Your home directory has the same name as your user-name, for example, ee91ab, and
More informationEssential Skills for Bioinformatics: Unix/Linux
Essential Skills for Bioinformatics: Unix/Linux WORKING WITH COMPRESSED DATA Overview Data compression, the process of condensing data so that it takes up less space (on disk drives, in memory, or across
More informationIntroduction p. 1 Who Should Read This Book? p. 1 What You Need to Know Before Reading This Book p. 2 How This Book Is Organized p.
Introduction p. 1 Who Should Read This Book? p. 1 What You Need to Know Before Reading This Book p. 2 How This Book Is Organized p. 2 Conventions Used in This Book p. 2 Introduction to UNIX p. 5 An Overview
More informationbwunicluster Tutorial Access, Data Transfer, Compiling, Modulefiles, Batch Jobs
bwunicluster Tutorial Access, Data Transfer, Compiling, Modulefiles, Batch Jobs Frauke Bösert, SCC, KIT 1 Material: Slides & Scripts https://indico.scc.kit.edu/indico/event/263/ @bwunicluster/forhlr I/ForHLR
More informationLinux Software Installation Exercises 2 Part 1. Install PYTHON software with PIP
Linux Software Installation Exercises 2 Part 1. Install PYTHON software with PIP 1.1 Login to the BioHPC machine and install deeptools; Login (ssh) to the machine that you are assigned for this workshop
More informationAssignment 3, Due October 4
Assignment 3, Due October 4 1 Summary This assignment gives you practice with writing shell scripts. Shell scripting is also known as bash programming. Your shell is bash, and when you write a shell script
More informationLecture 1. A. Sahu and S. V. Rao. Indian Institute of Technology Guwahati
Lecture 1 Introduction to Computing A. Sahu and S. V. Rao Dept of Comp. Sc. & Engg. Indian Institute of Technology Guwahati 1 Outline Computer System Problem Solving and Flow Chart Linux Command ls, mkdir,
More informationSoftware Installation - Accessing Linux and Checking your Environmental Variables
Accessing Linux and Checking your Environmental Although you may be fortunate enough to have a powerful multi-processor desktop running Linux, most of our sponsors do not. Most of our sponsors will have
More informationChapter-3. Introduction to Unix: Fundamental Commands
Chapter-3 Introduction to Unix: Fundamental Commands What You Will Learn The fundamental commands of the Unix operating system. Everything told for Unix here is applicable to the Linux operating system
More informationAppendix B WORKSHOP. SYS-ED/ Computer Education Techniques, Inc.
Appendix B WORKSHOP SYS-ED/ Computer Education Techniques, Inc. 1 Introduction There are no workshops for this chapter. The instructor will provide demonstrations and examples. SYS-ED/COMPUTER EDUCATION
More informationCSC BioWeek 2016: Using Taito cluster for high throughput data analysis
CSC BioWeek 2016: Using Taito cluster for high throughput data analysis 4. 2. 2016 Running Jobs in CSC Servers A note on typography: Some command lines are too long to fit a line in printed form. These
More informationUsing LINUX a BCMB/CHEM 8190 Tutorial Updated (1/17/12)
Using LINUX a BCMB/CHEM 8190 Tutorial Updated (1/17/12) Objective: Learn some basic aspects of the UNIX operating system and how to use it. What is UNIX? UNIX is the operating system used by most computers
More information