Maize genome sequence in FASTA format. Gene annotation file in gff format
|
|
- Jeremy Melton
- 5 years ago
- Views:
Transcription
1 Exercise 1. Using Tophat/Cufflinks to analyze RNAseq data. Step 1. One of CBSU BioHPC Lab workstations has been allocated for your workshop exercise. The allocations are listed on the workshop exercise web page: Please consult the PDF file with instructions on how to access and use the Lab workstations for the exercises posted on this page. If you would like to carry computations outside the workshop you will need to reserve a Linux workstation of the BioHPC Lab as described in BioHPC user guide Step 2. Copy the exercise files to the directory /workdir. As /workdir is shared by many users, you will need to create a sub directory under /workdir. You will need the following files: s_1_sequence.txt and s_5_sequence.txt : maize.fa: ZmB73_5a.59_WGS.gff : Illumina data files in FASTQ format Maize genome sequence in FASTA format Gene annotation file in gff format cd /workdir mkdir MyUserName cd MyUserName cp /shared_data/rnaseq/*. Note: a) Replace MyUserName with your own login user name; b) File names are sometimes very long. To make typing easier, you can type the first few letters then use the Tab key to auto finish the file name; c) * can be used a wildcard for file names in the commands. Step 3. Build a reference genome index using bowtie build, and then run tophat. You only need to run bowtie build once for the same genome file. In this exercise, we will run tophat twice, first time guided by the gff gene annotation file, second time without the gene annotation.
2 bowtie-build maize.fa maize >& bowtie-build.log & /programs/bin/tophat p 7 -o s1_guided -G ZmB73_5a_WGS.gff --no-novel-juncs maize s_1_sequence.txt >& tophat_1.log & /programs/bin/tophat p 3 -o s1_unguided maize s_1_sequence.txt >& tophat_2.log & mv s1_unguided/accepted_hits.bam s1_unguided_tophat.bam mv s1_guided/accepted_hits.bam s1_guided_tophat.bam IMPORTANT NOTE: The above example uses old data with 36bp reads, which requires use of the previous version of Tophat (1.2.0). Currently Ilumina sequencing produces longer reads, for which the new version of Tophat should be used (version 1.3.0). The newest version of Tophat can be invoked just as tophat in the command line, without version string. Samtools will produce the same file name for each run, which you might want to change to avoid confusion. In this example, I used the mv command to change the file name to s1_guided_tophat.bam, and at the same time move the file one directory up. Step 4. Using Samtools to index the bam file, then visualize the alignment using IGV. samtools index s1_unguided_tophat.bam samtools index s1_guided_tophat.bam This step is optional. It is for visualizing the read alignment to the genome. After running samtools index, you will see a new file called s1_tophat.bam.bai. You have three options to visualize the results with IGV: 1) run IGV on Lab workstation with VNC; 2) run IGV on Lab workstation with ssh and xming; 3) download output files to your own computer and run IGV there. 1. To run IGV over VNC on the Lab workstation you need to connect to the workstation using VNC (please consult BioHPC Lab user guide for more info on VNC connections). IGV is accessible as an icon on the left on Linux desktop. Double click the icon to start IGV. 2. To run IGV on Lab workstation with ssh and xming you need to connect to the workstation using ssh with X11 forwarding enabled. Start Xming on your local computer (or allow external X11 display if your local computer is Linux). Start IGV from the command line in the ssh window. Please consult BioHPC Lab user guide for more info on ssh/xming/x If you decide to run IGV on your local computer you will need to copy both the s1_tophat.bam and s1_tophat.bam.bai files to your local computer as well as maize.fa and ZmB73_5a_WGS.gff;
3 IGV software needs all of them. Start IGV software as per the online instructions a) Start the IGV software (depends on the way you run IGV, see above). b) Import the genome and gene annotation. (Using the fasta file as the sequence file, the gff file as the gene file). c) Load data Load the bam and bai files. If you have multiple samples, you can load each one as an individual track. d) Navigate around IGV Step 5. Run cuffdiff on the BAM files. cufflinks -G ZmB73_5a_WGS.gff s1_guided_tophat.bam cuffdiff ZmB73_5a_WGS.gff s1_guided_tophat.bam s5_guided_tophat.bam Note: Use cufflinks if you have only one sample. Use cuffdiff if you have multiple samples. Step 6. Transfer the output file transcripts.expr to your local computer. You can open this file using Excel. This file gave you the FPKM values for each gene to represent the expression level. After you feel more comfortable with running this software, it is highly recommended that you read the manual pages for Tophat and Cufflinks: Please remember that /workdir is shared by many users, and each workstation has different /workdir. After you finish a session, you will need to copy the files that you want to keep to your home directory /home/myusername. Once the files are copied to your home directory, you will be able to access them from any workstations.
4 Exercise 2. Using CBSU pipeline to analyze RNAseq data. In this exercise we will use CBSU RNA Seq pipeline to process the data from Exercise 1. Step 1. One of CBSU BioHPC Lab workstations has been allocated for your workshop exercise. The allocations are listed on the workshop exercise web page: Please consult the PDF file with instructions on how to access and use the Lab workstations for the exercises posted on this page for more information. If you would like to carry computations outside the workshop you will need to reserve a Linux workstation of the BioHPC Lab as described in BioHPC user guide Step 2. Copy the exercise files to the directory /workdir. As /workdir is shared by many users, you will need to create a sub directory under /workdir. You will need the following files: s_1_sequence.txt and s_5_sequence.txt : maize.fa: ZmB73_5a.59_WGS.gff : Rnaseq.conf: Illumina data files in FASTQ format Maize genome sequence in FASTA format Gene annotation file in gff format CBSU RNASeq pipeline options file cd /workdir mkdir MyUserName cd MyUserName cp /shared_data/rnaseq/*. cp /programs/rnaseqpipeline/rnaseq.conf. NOTE: If you have already done Exercise 1 you need to execute only the last command in the box above to copy the pipeline s options file. Step 3. Build a reference genome index using bwa. bwa index maize.fa >& bwa-index.log & Step 4. Modify options file so the options used are appropriate for your particular data. The template options file has been created for long reads data, our workshop data contains short reads so we need to modify some parameters, also, our files are in different directory than the template files and may have
5 different names. Open rnaseq.conf file in your favorite text editor and change the following parameters: fastq sequence file, annotation file, genome file, number of mismatches allowed for genome alignment and number of mismatches allowed for junction alignment. Number of BWA threads should also be modified to reflect the number of cores on your current machine (8 on remote Lab workstations). # annotation file /workdir/myloginname/zmb73_5a_wgs.gff # genome file (index files must be present in the same directory!) /workdir/myloginname/maize.fa # fastq sequence file /workdir/myloginname/ s_1_sequence.txt # output files core name, output files will be named core_namexxx, where XXX are various suffixes s_1_sequence_cbsu # number of mismatches allowed (edit distance), for genome alignment 2 # number of mismatches allowed (edit distance), for junction alignment 0 Step 5. Run the pipeline. /programs/rnaseqpipeline/rnaseq.pl >& rnaseq_1.log & Step 6. Change the options file to process s_5_sequence.txt data file instead of s_1_sequence.txt as in the step 4 and 5 above. Run the pipeline for s_5_sequence.txt.
6 Step 7. Analyze the results. NOTE: Pre computed output files are available in /shared_data/rnaseq/output.
replace my_user_id in the commands with your actual user ID
Exercise 1. Alignment with TOPHAT Part 1. Prepare the working directory. 1. Find out the name of the computer that has been reserved for you (https://cbsu.tc.cornell.edu/ww/machines.aspx?i=57 ). Everyone
More informationReference guided RNA-seq data analysis using BioHPC Lab computers
Reference guided RNA-seq data analysis using BioHPC Lab computers This document assumes that you already know some basics of how to use a Linux computer. Some of the command lines in this document are
More informationRobert Bukowski Jaroslaw Pillardy 6/27/2011
COMPUTATIONAL BIOLOGY SERVICE UNIT, 3CPG RNA Seq CBSU Computational Resources for the Workshop Robert Bukowski (bukowski@cornell.edu); Jaroslaw Pillardy (jp86@cornell.edu) 6/27/2011 In this edition of
More informationPreparation of alignments for variant calling with GATK: exercise instructions for BioHPC Lab computers
Preparation of alignments for variant calling with GATK: exercise instructions for BioHPC Lab computers Data used in the exercise We will use D. melanogaster WGS paired-end Illumina data with NCBI accessions
More informationBioHPC Lab at Cornell
BioHPC Lab at Cornell Jaroslaw Pillardy CBSU, Life Sciences Core Laboratories Center Cornell University Practical exercises for the workshop will be carried out using CBSU BioHPC Lab Software used during
More informationRNA-seq. Manpreet S. Katari
RNA-seq Manpreet S. Katari Evolution of Sequence Technology Normalizing the Data RPKM (Reads per Kilobase of exons per million reads) Score = R NT R = # of unique reads for the gene N = Size of the gene
More informationSequence Analysis Pipeline
Sequence Analysis Pipeline Transcript fragments 1. PREPROCESSING 2. ASSEMBLY (today) Removal of contaminants, vector, adaptors, etc Put overlapping sequence together and calculate bigger sequences 3. Analysis/Annotation
More informationExercise 1. RNA-seq alignment and quantification. Part 1. Prepare the working directory. Part 2. Examine qualities of the RNA-seq data files
Exercise 1. RNA-seq alignment and quantification Part 1. Prepare the working directory. 1. Connect to your assigned computer. If you do not know how, follow the instruction at http://cbsu.tc.cornell.edu/lab/doc/remote_access.pdf
More informationNGS Analysis Using Galaxy
NGS Analysis Using Galaxy Sequences and Alignment Format Galaxy overview and Interface Get;ng Data in Galaxy Analyzing Data in Galaxy Quality Control Mapping Data History and workflow Galaxy Exercises
More informationRNA-Seq Analysis With the Tuxedo Suite
June 2016 RNA-Seq Analysis With the Tuxedo Suite Dena Leshkowitz Introduction In this exercise we will learn how to analyse RNA-Seq data using the Tuxedo Suite tools: Tophat, Cuffmerge, Cufflinks and Cuffdiff.
More informationGoal: Learn how to use various tool to extract information from RNAseq reads. 4.1 Mapping RNAseq Reads to a Genome Assembly
ESSENTIALS OF NEXT GENERATION SEQUENCING WORKSHOP 2014 UNIVERSITY OF KENTUCKY AGTC Class 4 RNAseq Goal: Learn how to use various tool to extract information from RNAseq reads. Input(s): magnaporthe_oryzae_70-15_8_supercontigs.fasta
More informationEnsembl RNASeq Practical. Overview
Ensembl RNASeq Practical The aim of this practical session is to use BWA to align 2 lanes of Zebrafish paired end Illumina RNASeq reads to chromosome 12 of the zebrafish ZV9 assembly. We have restricted
More informationRNAseq analysis: SNP calling. BTI bioinformatics course, spring 2013
RNAseq analysis: SNP calling BTI bioinformatics course, spring 2013 RNAseq overview RNAseq overview Choose technology 454 Illumina SOLiD 3 rd generation (Ion Torrent, PacBio) Library types Single reads
More informationBGGN-213: FOUNDATIONS OF BIOINFORMATICS (Lecture 14)
BGGN-213: FOUNDATIONS OF BIOINFORMATICS (Lecture 14) Genome Informatics (Part 1) https://bioboot.github.io/bggn213_f17/lectures/#14 Dr. Barry Grant Nov 2017 Overview: The purpose of this lab session is
More informationOur data for today is a small subset of Saimaa ringed seal RNA sequencing data (RNA_seq_reads.fasta). Let s first see how many reads are there:
Practical Course in Genome Bioinformatics 19.2.2016 (CORRECTED 22.2.2016) Exercises - Day 5 http://ekhidna.biocenter.helsinki.fi/downloads/teaching/spring2016/ Answer the 5 questions (Q1-Q5) according
More informationBioHPC Lab at Cornell
BioHPC Lab at Cornell Robert Bukowski (formerly: Computational Biology Service Unit) http://cbsu.tc.cornell.edu/lab/doc/biohpclabintro20130916.pdf (CBSU) Cornell Core Facility providing services for a
More informationRNA-Seq in Galaxy: Tuxedo protocol. Igor Makunin, UQ RCC, QCIF
RNA-Seq in Galaxy: Tuxedo protocol Igor Makunin, UQ RCC, QCIF Acknowledgments Genomics Virtual Lab: gvl.org.au Galaxy for tutorials: galaxy-tut.genome.edu.au Galaxy Australia: galaxy-aust.genome.edu.au
More informationNGS Data Visualization and Exploration Using IGV
1 What is Galaxy Galaxy for Bioinformaticians Galaxy for Experimental Biologists Using Galaxy for NGS Analysis NGS Data Visualization and Exploration Using IGV 2 What is Galaxy Galaxy for Bioinformaticians
More informationLinux for Beginners Part 1
Linux for Beginners Part 1 3CPG Workshop Robert Bukowski Computational Biology Service Unit http://cbsu.tc.cornell.edu/lab/doc/linux_workshop_part1.pdf Compute clusters BioHPC infrastructure at CBSU BioHPC
More informationCyverse tutorial 1 Logging in to Cyverse and data management. Open an Internet browser window and navigate to the Cyverse discovery environment:
Cyverse tutorial 1 Logging in to Cyverse and data management Open an Internet browser window and navigate to the Cyverse discovery environment: https://de.cyverse.org/de/ Click Log in with your CyVerse
More informationColorado State University Bioinformatics Algorithms Assignment 6: Analysis of High- Throughput Biological Data Hamidreza Chitsaz, Ali Sharifi- Zarchi
Colorado State University Bioinformatics Algorithms Assignment 6: Analysis of High- Throughput Biological Data Hamidreza Chitsaz, Ali Sharifi- Zarchi Although a little- bit long, this is an easy exercise
More informationTopHat, Cufflinks, Cuffdiff
TopHat, Cufflinks, Cuffdiff Andreas Gisel Institute for Biomedical Technologies - CNR, Bari TopHat TopHat TopHat TopHat is a program that aligns RNA-Seq reads to a genome in order to identify exon-exon
More informationHow to store and visualize RNA-seq data
How to store and visualize RNA-seq data Gabriella Rustici Functional Genomics Group gabry@ebi.ac.uk EBI is an Outstation of the European Molecular Biology Laboratory. Talk summary How do we archive RNA-seq
More informationGalaxy Platform For NGS Data Analyses
Galaxy Platform For NGS Data Analyses Weihong Yan wyan@chem.ucla.edu Collaboratory Web Site http://qcb.ucla.edu/collaboratory Collaboratory Workshops Workshop Outline ü Day 1 UCLA galaxy and user account
More informationLinux for Biologists Part 2
Linux for Biologists Part 2 Robert Bukowski Institute of Biotechnology Bioinformatics Facility (aka Computational Biology Service Unit - CBSU) http://cbsu.tc.cornell.edu/lab/doc/linux_workshop_part2.pdf
More informationpreparation methods and new bacterial strains. Parts of the pipeline that can be updated will be annotated in this guide.
BacSeq Introduction The purpose of this guide is to aid current and future Whiteley Lab members and University of Texas microbiologists with bacterial RNA?Seq analysis. Once you have analyzed your data
More informationSingle/paired-end RNAseq analysis with Galaxy
October 016 Single/paired-end RNAseq analysis with Galaxy Contents: 1. Introduction. Quality control 3. Alignment 4. Normalization and read counts 5. Workflow overview 6. Sample data set to test the paired-end
More informationMapping RNA sequence data (Part 1: using pathogen portal s RNAseq pipeline) Exercise 6
Mapping RNA sequence data (Part 1: using pathogen portal s RNAseq pipeline) Exercise 6 The goal of this exercise is to retrieve an RNA-seq dataset in FASTQ format and run it through an RNA-sequence analysis
More informationDavid Crossman, Ph.D. UAB Heflin Center for Genomic Science. GCC2012 Wednesday, July 25, 2012
David Crossman, Ph.D. UAB Heflin Center for Genomic Science GCC2012 Wednesday, July 25, 2012 Galaxy Splash Page Colors Random Galaxy icons/colors Queued Running Completed Download/Save Failed Icons Display
More informationGalaxy workshop at the Winter School Igor Makunin
Galaxy workshop at the Winter School 2016 Igor Makunin i.makunin@uq.edu.au Winter school, UQ, July 6, 2016 Plan Overview of the Genomics Virtual Lab Introduce Galaxy, a web based platform for analysis
More informationITMO Ecole de Bioinformatique Hands-on session: smallrna-seq N. Servant 21 rd November 2013
ITMO Ecole de Bioinformatique Hands-on session: smallrna-seq N. Servant 21 rd November 2013 1. Data and objectives We will use the data from GEO (GSE35368, Toedling, Servant et al. 2011). Two samples were
More informationHelsinki 19 Jan Practical course in genome bioinformatics DAY 0
Helsinki 19 Jan 2017 529028 Practical course in genome bioinformatics DAY 0 This document can be downloaded at: http://ekhidna.biocenter.helsinki.fi/downloads/teaching/spring2017/exercises_day0.pdf The
More informationIntroduction to BioHPC Lab
Introduction to BioHPC Lab BioHPC Lab Workshop Jaroslaw Pillardy Bioinformatics Facility Institute of Biotechnology Cornell University http://cbsu.tc.cornell.edu/lab/lab.aspx http://cbsu.tc.cornell.edu/lab/doc/introduction_to_biohpc_lab_v2.pdf
More informationUsing the GBS Analysis Pipeline Tutorial
Using the GBS Analysis Pipeline Tutorial Cornell CBSU/IGD GBS Bioinformatics Workshop September 13 & 14 2012 Step 0: If one of the CBSU BioHPC Lab workstations was reserved for you, it will be listed on
More informationNGS FASTQ file format
NGS FASTQ file format Line1: Begins with @ and followed by a sequence idenefier and opeonal descripeon Line2: Raw sequence leiers Line3: + Line4: Encodes the quality values for the sequence in Line2 (see
More informationIntegrative Genomics Viewer. Prat Thiru
Integrative Genomics Viewer Prat Thiru 1 Overview User Interface Basics Browsing the Data Data Formats IGV Tools Demo Outline Based on ISMB 2010 Tutorial by Robinson and Thorvaldsdottir 2 Why IGV? IGV
More informationAn Introduction to Linux and Bowtie
An Introduction to Linux and Bowtie Cavan Reilly November 10, 2017 Table of contents Introduction to UNIX-like operating systems Installing programs Bowtie SAMtools Introduction to Linux In order to use
More informationSAM : Sequence Alignment/Map format. A TAB-delimited text format storing the alignment information. A header section is optional.
Alignment of NGS reads, samtools and visualization Hands-on Software used in this practical BWA MEM : Burrows-Wheeler Aligner. A software package for mapping low-divergent sequences against a large reference
More informationOur typical RNA quantification pipeline
RNA-Seq primer Our typical RNA quantification pipeline Upload your sequence data (fastq) Align to the ribosome (Bow>e) Align remaining reads to genome (TopHat) or transcriptome (RSEM) Make report of quality
More informationGoal: Learn how to use various tool to extract information from RNAseq reads.
ESSENTIALS OF NEXT GENERATION SEQUENCING WORKSHOP 2017 Class 4 RNAseq Goal: Learn how to use various tool to extract information from RNAseq reads. Input(s): Output(s): magnaporthe_oryzae_70-15_8_supercontigs.fasta
More informationIntroduction to Read Alignment. UCD Genome Center Bioinformatics Core Tuesday 15 September 2015
Introduction to Read Alignment UCD Genome Center Bioinformatics Core Tuesday 15 September 2015 From reads to molecules Why align? Individual A Individual B ATGATAGCATCGTCGGGTGTCTGCTCAATAATAGTGCCGTATCATGCTGGTGTTATAATCGCCGCATGACATGATCAATGG
More informationRead mapping with BWA and BOWTIE
Read mapping with BWA and BOWTIE Before We Start In order to save a lot of typing, and to allow us some flexibility in designing these courses, we will establish a UNIX shell variable BASE to point to
More informationversion /1/2011 Source code Linux x86_64 binary Mac OS X x86_64 binary
Cufflinks RNA-Seq analysis tools - Getting Started 1 of 6 14.07.2011 09:42 Cufflinks Transcript assembly, differential expression, and differential regulation for RNA-Seq Site Map Home Getting started
More information!"#$%&$'()#$*)+,-./).01"0#,23+3,303456"6,&((46,7$+-./&((468,
!"#$%&$'()#$*)+,-./).01"0#,23+3,303456"6,&((46,7$+-./&((468, 9"(1(02)1+(',:.;.4(*.',?9@A,!."2.4B.'#A,C(;.
More informationVisualization using CummeRbund 2014 Overview
Visualization using CummeRbund 2014 Overview In this lab, we'll look at how to use cummerbund to visualize our gene expression results from cuffdiff. CummeRbund is part of the tuxedo pipeline and it is
More informationRNASeq2017 Course Salerno, September 27-29, 2017
RNASeq2017 Course Salerno, September 27-29, 2017 RNA- seq Hands on Exercise Fabrizio Ferrè, University of Bologna Alma Mater (fabrizio.ferre@unibo.it) Hands- on tutorial based on the EBI teaching materials
More informationRNA-seq Data Analysis
Seyed Abolfazl Motahari RNA-seq Data Analysis Basics Next Generation Sequencing Biological Samples Data Cost Data Volume Big Data Analysis in Biology تحلیل داده ها کنترل سیستمهای بیولوژیکی تشخیص بیماریها
More informationShort Read Sequencing Analysis Workshop
Short Read Sequencing Analysis Workshop Day 2 Learning the Linux Compute Environment In-class Slides Matt Hynes-Grace Manager of IT Operations, BioFrontiers Institute Review of Day 2 Videos Video 1 Introduction
More informationGenomic Files. University of Massachusetts Medical School. October, 2015
.. Genomic Files University of Massachusetts Medical School October, 2015 2 / 55. A Typical Deep-Sequencing Workflow Samples Fastq Files Fastq Files Sam / Bam Files Various files Deep Sequencing Further
More informationGenomic Files. University of Massachusetts Medical School. October, 2014
.. Genomic Files University of Massachusetts Medical School October, 2014 2 / 39. A Typical Deep-Sequencing Workflow Samples Fastq Files Fastq Files Sam / Bam Files Various files Deep Sequencing Further
More informationThese will serve as a basic guideline for read prep. This assumes you have demultiplexed Illumina data.
These will serve as a basic guideline for read prep. This assumes you have demultiplexed Illumina data. We have a few different choices for running jobs on DT2 we will explore both here. We need to alter
More information11/8/2017 Trinity De novo Transcriptome Assembly Workshop trinityrnaseq/rnaseq_trinity_tuxedo_workshop Wiki GitHub
trinityrnaseq / RNASeq_Trinity_Tuxedo_Workshop Trinity De novo Transcriptome Assembly Workshop Brian Haas edited this page on Oct 17, 2015 14 revisions De novo RNA-Seq Assembly and Analysis Using Trinity
More informationPractical Course in Genome Bioinformatics
Practical Course in Genome Bioinformatics 20/01/2017 Exercises - Day 1 http://ekhidna.biocenter.helsinki.fi/downloads/teaching/spring2017/ Answer questions Q1-Q3 below and include requested Figures 1-5
More informationPractical Linux examples: Exercises
Practical Linux examples: Exercises 1. Login (ssh) to the machine that you are assigned for this workshop (assigned machines: https://cbsu.tc.cornell.edu/ww/machines.aspx?i=87 ). Prepare working directory,
More informationIllumina Next Generation Sequencing Data analysis
Illumina Next Generation Sequencing Data analysis Chiara Dal Fiume Sr Field Application Scientist Italy 2010 Illumina, Inc. All rights reserved. Illumina, illuminadx, Solexa, Making Sense Out of Life,
More informationTiling Assembly for Annotation-independent Novel Gene Discovery
Tiling Assembly for Annotation-independent Novel Gene Discovery By Jennifer Lopez and Kenneth Watanabe Last edited on September 7, 2015 by Kenneth Watanabe The following procedure explains how to run the
More informationIntroduction to UNIX command-line II
Introduction to UNIX command-line II Boyce Thompson Institute 2017 Prashant Hosmani Class Content Terminal file system navigation Wildcards, shortcuts and special characters File permissions Compression
More informationNGS Data and Sequence Alignment
Applications and Servers SERVER/REMOTE Compute DB WEB Data files NGS Data and Sequence Alignment SSH WEB SCP Manpreet S. Katari App Aug 11, 2016 Service Terminal IGV Data files Window Personal Computer/Local
More informationWelcome to GenomeView 101!
Welcome to GenomeView 101! 1. Start your computer 2. Download and extract the example data http://www.broadinstitute.org/~tabeel/broade.zip Suggestion: - Linux, Mac: make new folder in your home directory
More informationVirtual Machine. Linux flavor : Debian. Everything (except slides) preinstalled for you. https://www.virtualbox.org/
Virtual Machine Anyone have problems installing it? VM: Virtual Box - allows you to run a different operating system within the current operating system of your machine. https://www.virtualbox.org/ Linux
More informationAnalysis of ChIP-seq data
Before we start: 1. Log into tak (step 0 on the exercises) 2. Go to your lab space and create a folder for the class (see separate hand out) 3. Connect to your lab space through the wihtdata network and
More informationThe software and data for the RNA-Seq exercise are already available on the USB system
BIT815 Notes on R analysis of RNA-seq data The software and data for the RNA-Seq exercise are already available on the USB system The notes below regarding installation of R packages and other software
More informationGenomics. Nolan C. Kane
Genomics Nolan C. Kane Nolan.Kane@Colorado.edu Course info http://nkane.weebly.com/genomics.html Emails let me know if you are not getting them! Email me at nolan.kane@colorado.edu Office hours by appointment
More informationA Hands-On Tutorial: RNA Sequencing Using High-Performance Computing
A Hands-On Tutorial: RNA Sequencing Using Computing February 11th and 12th, 2016 1st session (Thursday) Preliminaries: Linux, HPC, command line interface Using HPC: modules, queuing system Presented by:
More informationLinux + Galaxy Server Tutorial
Linux + Galaxy Server Tutorial Pei-Chen Peng Linux+Galaxy Pei-Chen Peng 2017 1 Introduction Exercise 1. Download lab data to flash drive. 2. Run a simple bioinformatics program on linux.. 3. Learn Galaxy
More informationHigh-throughout sequencing and using short-read aligners. Simon Anders
High-throughout sequencing and using short-read aligners Simon Anders High-throughput sequencing (HTS) Sequencing millions of short DNA fragments in parallel. a.k.a.: next-generation sequencing (NGS) massively-parallel
More informationPerl for Biologists. Practical example. Session 14 June 3, Robert Bukowski. Session 14: Practical example Perl for Biologists 1.
Perl for Biologists Session 14 June 3, 2015 Practical example Robert Bukowski Session 14: Practical example Perl for Biologists 1.2 1 Session 13 review Process is an object of UNIX (Linux) kernel identified
More informationProtocol: peak-calling for ChIP-seq data / segmentation analysis for histone modification data
Protocol: peak-calling for ChIP-seq data / segmentation analysis for histone modification data Table of Contents Protocol: peak-calling for ChIP-seq data / segmentation analysis for histone modification
More informationWelcome to MAPHiTS (Mapping Analysis Pipeline for High-Throughput Sequences) tutorial page.
Welcome to MAPHiTS (Mapping Analysis Pipeline for High-Throughput Sequences) tutorial page. In this page you will learn to use the tools of the MAPHiTS suite. A little advice before starting : rename your
More informationDr. Gabriela Salinas Dr. Orr Shomroni Kaamini Rhaithata
Analysis of RNA sequencing data sets using the Galaxy environment Dr. Gabriela Salinas Dr. Orr Shomroni Kaamini Rhaithata Microarray and Deep-sequencing core facility 30.10.2017 RNA-seq workflow I Hypothesis
More informationFrom the Schnable Lab:
From the Schnable Lab: Yang Zhang and Daniel Ngu s Pipeline for Processing RNA-seq Data (As of November 17, 2016) yzhang91@unl.edu dngu2@huskers.unl.edu Pre-processing the reads: The alignment software
More informationHigh-throughput sequencing: Alignment and related topic. Simon Anders EMBL Heidelberg
High-throughput sequencing: Alignment and related topic Simon Anders EMBL Heidelberg Established platforms HTS Platforms Illumina HiSeq, ABI SOLiD, Roche 454 Newcomers: Benchtop machines 454 GS Junior,
More informationChIP-seq hands-on practical using Galaxy
ChIP-seq hands-on practical using Galaxy In this exercise we will cover some of the basic NGS analysis steps for ChIP-seq using the Galaxy framework: Quality control Mapping of reads using Bowtie2 Peak-calling
More informationCOMPARATIVE MICROBIAL GENOMICS ANALYSIS WORKSHOP. Exercise 2: Predicting Protein-encoding Genes, BlastMatrix, BlastAtlas
COMPARATIVE MICROBIAL GENOMICS ANALYSIS WORKSHOP Exercise 2: Predicting Protein-encoding Genes, BlastMatrix, BlastAtlas First of all connect once again to the CBS system: Open ssh shell client. Press Quick
More informationAligners. J Fass 21 June 2017
Aligners J Fass 21 June 2017 Definitions Assembly: I ve found the shredded remains of an important document; put it back together! UC Davis Genome Center Bioinformatics Core J Fass Aligners 2017-06-21
More informationSMRT-Portal Exercises. J Fass UCD Genome Center Bioinformatics Core Thursday April 16, 2015
SMRT-Portal Exercises J Fass UCD Genome Center Bioinformatics Core Thursday April 16, 2015 Running SMRT-Portal in AWS see PacBio documentation We ll be running a virtual machine (VM) in the Amazon Web
More informationMapping NGS reads for genomics studies
Mapping NGS reads for genomics studies Valencia, 28-30 Sep 2015 BIER Alejandro Alemán aaleman@cipf.es Genomics Data Analysis CIBERER Where are we? Fastq Sequence preprocessing Fastq Alignment BAM Visualization
More informationCentre (CNIO). 3rd Melchor Fernández Almagro St , Madrid, Spain. s/n, Universidad de Vigo, Ourense, Spain.
O. Graña *a,b, M. Rubio-Camarillo a, F. Fdez-Riverola b, D.G. Pisano a and D. Glez-Peña b a Bioinformatics Unit, Structural Biology and BioComputing Programme, Spanish National Cancer Research Centre (CNIO).
More informationA Tutorial: Genome- based RNA- Seq Analysis Using the TUXEDO Package
A Tutorial: Genome- based RNA- Seq Analysis Using the TUXEDO Package The following data and software resources are required for following the tutorial. Data: ftp://ftp.broad.mit.edu/pub/users/bhaas/rnaseq_workshop/rnaseq_workshop_dat
More informationmrna-seq Basic processing Read mapping (shown here, but optional. May due if time allows) Gene expression estimation
mrna-seq Basic processing Read mapping (shown here, but optional. May due if time allows) Tophat Gene expression estimation cufflinks Confidence intervals Gene expression changes (separate use case) Sample
More informationEvaluate NimbleGen SeqCap RNA Target Enrichment Data
Roche Sequencing Technical Note November 2014 How To Evaluate NimbleGen SeqCap RNA Target Enrichment Data 1. OVERVIEW Analysis of NimbleGen SeqCap RNA target enrichment data generated using an Illumina
More informationShort Read Sequencing Analysis Workshop
Short Read Sequencing Analysis Workshop Day 8: Introduc/on to RNA-seq Analysis In-class slides Day 7 Homework 1.) 14 GABPA ChIP-seq peaks 2.) Error: Dataset too large (> 100000). Rerun with larger maxsize
More informationToday's outline. Resources. Genome browser components. Genome browsers: Discovering biology through genomics. Genome browser tutorial materials
Today's outline Genome browsers: Discovering biology through genomics BaRC Hot Topics April 2013 George Bell, Ph.D. http://jura.wi.mit.edu/bio/education/hot_topics/ Genome browser introduction Popular
More informationData: ftp://ftp.broad.mit.edu/pub/users/bhaas/rnaseq_workshop/rnaseq_workshop_dat a.tgz. Software:
A Tutorial: De novo RNA- Seq Assembly and Analysis Using Trinity and edger The following data and software resources are required for following the tutorial: Data: ftp://ftp.broad.mit.edu/pub/users/bhaas/rnaseq_workshop/rnaseq_workshop_dat
More informationAligners. J Fass 23 August 2017
Aligners J Fass 23 August 2017 Definitions Assembly: I ve found the shredded remains of an important document; put it back together! UC Davis Genome Center Bioinformatics Core J Fass Aligners 2017-08-23
More informationCBSU/3CPG/CVG Joint Workshop Series Reference genome based sequence variation detection
CBSU/3CPG/CVG Joint Workshop Series Reference genome based sequence variation detection Computational Biology Service Unit (CBSU) Cornell Center for Comparative and Population Genomics (3CPG) Center for
More informationCopy Number Variations Detection - TD. Using Sequenza under Galaxy
Copy Number Variations Detection - TD Using Sequenza under Galaxy I. Data loading We will analyze the copy number variations of a human tumor (parotid gland carcinoma), limited to the chr17, from a WES
More informationExercise 1 Review. --outfiltermismatchnmax : max number of mismatch (Default 10) --outreadsunmapped fastx: output unmapped reads
Exercise 1 Review Setting parameters STAR --quantmode GeneCounts --genomedir genomedb -- runthreadn 2 --outfiltermismatchnmax 2 --readfilesin WTa.fastq.gz --readfilescommand zcat --outfilenameprefix WTa
More informationVariation among genomes
Variation among genomes Comparing genomes The reference genome http://www.ncbi.nlm.nih.gov/nuccore/26556996 Arabidopsis thaliana, a model plant Col-0 variety is from Landsberg, Germany Ler is a mutant
More informationLecture 12. Short read aligners
Lecture 12 Short read aligners Ebola reference genome We will align ebola sequencing data against the 1976 Mayinga reference genome. We will hold the reference gnome and all indices: mkdir -p ~/reference/ebola
More informationls /data/atrnaseq/ egrep "(fastq fasta fq fa)\.gz" ls /data/atrnaseq/ egrep "(cn ts)[1-3]ln[^3a-za-z]\."
Command line tools - bash, awk and sed We can only explore a small fraction of the capabilities of the bash shell and command-line utilities in Linux during this course. An entire course could be taught
More informationWM2 Bioinformatics. ExomeSeq data analysis part 1. Dietmar Rieder
WM2 Bioinformatics ExomeSeq data analysis part 1 Dietmar Rieder RAW data Use putty to logon to cluster.i med.ac.at In your home directory make directory to store raw data $ mkdir 00_RAW Copy raw fastq
More informationNext generation sequencing: assembly by mapping reads. Laurent Falquet, Vital-IT Helsinki, June 3, 2010
Next generation sequencing: assembly by mapping reads Laurent Falquet, Vital-IT Helsinki, June 3, 2010 Overview What is assembly by mapping? Methods BWT File formats Tools Issues Visualization Discussion
More informationChIP-seq practical: peak detection and peak annotation. Mali Salmon-Divon Remco Loos Myrto Kostadima
ChIP-seq practical: peak detection and peak annotation Mali Salmon-Divon Remco Loos Myrto Kostadima March 2012 Introduction The goal of this hands-on session is to perform some basic tasks in the analysis
More informationChIP-Seq data analysis workshop
ChIP-Seq data analysis workshop Exercise 1. ChIP-Seq peak calling 1. Using Putty (Windows) or Terminal (Mac) to connect to your assigned computer. Create a directory /workdir/myuserid (replace myuserid
More informationGetting Started With UNIX Lab Exercises
Getting Started With UNIX Lab Exercises This is the lab exercise handout for the Getting Started with UNIX tutorial. The exercises provide hands-on experience with the topics discussed in the tutorial.
More informationWeb page:
mirdeep* manual 2013-01-10 Jiyuan An, John Lai, Melanie Lehman, Colleen Nelson: Australian Prostate Cancer Research Center (APCRC-Q) and Institute of Health and Biomedical Innovation (IHBI), Queensland
More informationVariant calling using SAMtools
Variant calling using SAMtools Calling variants - a trivial use of an Interactive Session We are going to conduct the variant calling exercises in an interactive idev session just so you can get a feel
More informationAgroMarker Finder manual (1.1)
AgroMarker Finder manual (1.1) 1. Introduction 2. Installation 3. How to run? 4. How to use? 5. Java program for calculating of restriction enzyme sites (TaqαI). 1. Introduction AgroMarker Finder (AMF)is
More informationSuper-Fast Genome BWA-Bam-Sort on GLAD
1 Hututa Technologies Limited Super-Fast Genome BWA-Bam-Sort on GLAD Zhiqiang Ma, Wangjun Lv and Lin Gu May 2016 1 2 Executive Summary Aligning the sequenced reads in FASTQ files and converting the resulted
More information