Maize genome sequence in FASTA format. Gene annotation file in gff format

Size: px
Start display at page:

Download "Maize genome sequence in FASTA format. Gene annotation file in gff format"

Transcription

1 Exercise 1. Using Tophat/Cufflinks to analyze RNAseq data. Step 1. One of CBSU BioHPC Lab workstations has been allocated for your workshop exercise. The allocations are listed on the workshop exercise web page: Please consult the PDF file with instructions on how to access and use the Lab workstations for the exercises posted on this page. If you would like to carry computations outside the workshop you will need to reserve a Linux workstation of the BioHPC Lab as described in BioHPC user guide Step 2. Copy the exercise files to the directory /workdir. As /workdir is shared by many users, you will need to create a sub directory under /workdir. You will need the following files: s_1_sequence.txt and s_5_sequence.txt : maize.fa: ZmB73_5a.59_WGS.gff : Illumina data files in FASTQ format Maize genome sequence in FASTA format Gene annotation file in gff format cd /workdir mkdir MyUserName cd MyUserName cp /shared_data/rnaseq/*. Note: a) Replace MyUserName with your own login user name; b) File names are sometimes very long. To make typing easier, you can type the first few letters then use the Tab key to auto finish the file name; c) * can be used a wildcard for file names in the commands. Step 3. Build a reference genome index using bowtie build, and then run tophat. You only need to run bowtie build once for the same genome file. In this exercise, we will run tophat twice, first time guided by the gff gene annotation file, second time without the gene annotation.

2 bowtie-build maize.fa maize >& bowtie-build.log & /programs/bin/tophat p 7 -o s1_guided -G ZmB73_5a_WGS.gff --no-novel-juncs maize s_1_sequence.txt >& tophat_1.log & /programs/bin/tophat p 3 -o s1_unguided maize s_1_sequence.txt >& tophat_2.log & mv s1_unguided/accepted_hits.bam s1_unguided_tophat.bam mv s1_guided/accepted_hits.bam s1_guided_tophat.bam IMPORTANT NOTE: The above example uses old data with 36bp reads, which requires use of the previous version of Tophat (1.2.0). Currently Ilumina sequencing produces longer reads, for which the new version of Tophat should be used (version 1.3.0). The newest version of Tophat can be invoked just as tophat in the command line, without version string. Samtools will produce the same file name for each run, which you might want to change to avoid confusion. In this example, I used the mv command to change the file name to s1_guided_tophat.bam, and at the same time move the file one directory up. Step 4. Using Samtools to index the bam file, then visualize the alignment using IGV. samtools index s1_unguided_tophat.bam samtools index s1_guided_tophat.bam This step is optional. It is for visualizing the read alignment to the genome. After running samtools index, you will see a new file called s1_tophat.bam.bai. You have three options to visualize the results with IGV: 1) run IGV on Lab workstation with VNC; 2) run IGV on Lab workstation with ssh and xming; 3) download output files to your own computer and run IGV there. 1. To run IGV over VNC on the Lab workstation you need to connect to the workstation using VNC (please consult BioHPC Lab user guide for more info on VNC connections). IGV is accessible as an icon on the left on Linux desktop. Double click the icon to start IGV. 2. To run IGV on Lab workstation with ssh and xming you need to connect to the workstation using ssh with X11 forwarding enabled. Start Xming on your local computer (or allow external X11 display if your local computer is Linux). Start IGV from the command line in the ssh window. Please consult BioHPC Lab user guide for more info on ssh/xming/x If you decide to run IGV on your local computer you will need to copy both the s1_tophat.bam and s1_tophat.bam.bai files to your local computer as well as maize.fa and ZmB73_5a_WGS.gff;

3 IGV software needs all of them. Start IGV software as per the online instructions a) Start the IGV software (depends on the way you run IGV, see above). b) Import the genome and gene annotation. (Using the fasta file as the sequence file, the gff file as the gene file). c) Load data Load the bam and bai files. If you have multiple samples, you can load each one as an individual track. d) Navigate around IGV Step 5. Run cuffdiff on the BAM files. cufflinks -G ZmB73_5a_WGS.gff s1_guided_tophat.bam cuffdiff ZmB73_5a_WGS.gff s1_guided_tophat.bam s5_guided_tophat.bam Note: Use cufflinks if you have only one sample. Use cuffdiff if you have multiple samples. Step 6. Transfer the output file transcripts.expr to your local computer. You can open this file using Excel. This file gave you the FPKM values for each gene to represent the expression level. After you feel more comfortable with running this software, it is highly recommended that you read the manual pages for Tophat and Cufflinks: Please remember that /workdir is shared by many users, and each workstation has different /workdir. After you finish a session, you will need to copy the files that you want to keep to your home directory /home/myusername. Once the files are copied to your home directory, you will be able to access them from any workstations.

4 Exercise 2. Using CBSU pipeline to analyze RNAseq data. In this exercise we will use CBSU RNA Seq pipeline to process the data from Exercise 1. Step 1. One of CBSU BioHPC Lab workstations has been allocated for your workshop exercise. The allocations are listed on the workshop exercise web page: Please consult the PDF file with instructions on how to access and use the Lab workstations for the exercises posted on this page for more information. If you would like to carry computations outside the workshop you will need to reserve a Linux workstation of the BioHPC Lab as described in BioHPC user guide Step 2. Copy the exercise files to the directory /workdir. As /workdir is shared by many users, you will need to create a sub directory under /workdir. You will need the following files: s_1_sequence.txt and s_5_sequence.txt : maize.fa: ZmB73_5a.59_WGS.gff : Rnaseq.conf: Illumina data files in FASTQ format Maize genome sequence in FASTA format Gene annotation file in gff format CBSU RNASeq pipeline options file cd /workdir mkdir MyUserName cd MyUserName cp /shared_data/rnaseq/*. cp /programs/rnaseqpipeline/rnaseq.conf. NOTE: If you have already done Exercise 1 you need to execute only the last command in the box above to copy the pipeline s options file. Step 3. Build a reference genome index using bwa. bwa index maize.fa >& bwa-index.log & Step 4. Modify options file so the options used are appropriate for your particular data. The template options file has been created for long reads data, our workshop data contains short reads so we need to modify some parameters, also, our files are in different directory than the template files and may have

5 different names. Open rnaseq.conf file in your favorite text editor and change the following parameters: fastq sequence file, annotation file, genome file, number of mismatches allowed for genome alignment and number of mismatches allowed for junction alignment. Number of BWA threads should also be modified to reflect the number of cores on your current machine (8 on remote Lab workstations). # annotation file /workdir/myloginname/zmb73_5a_wgs.gff # genome file (index files must be present in the same directory!) /workdir/myloginname/maize.fa # fastq sequence file /workdir/myloginname/ s_1_sequence.txt # output files core name, output files will be named core_namexxx, where XXX are various suffixes s_1_sequence_cbsu # number of mismatches allowed (edit distance), for genome alignment 2 # number of mismatches allowed (edit distance), for junction alignment 0 Step 5. Run the pipeline. /programs/rnaseqpipeline/rnaseq.pl >& rnaseq_1.log & Step 6. Change the options file to process s_5_sequence.txt data file instead of s_1_sequence.txt as in the step 4 and 5 above. Run the pipeline for s_5_sequence.txt.

6 Step 7. Analyze the results. NOTE: Pre computed output files are available in /shared_data/rnaseq/output.

replace my_user_id in the commands with your actual user ID

replace my_user_id in the commands with your actual user ID Exercise 1. Alignment with TOPHAT Part 1. Prepare the working directory. 1. Find out the name of the computer that has been reserved for you (https://cbsu.tc.cornell.edu/ww/machines.aspx?i=57 ). Everyone

More information

Reference guided RNA-seq data analysis using BioHPC Lab computers

Reference guided RNA-seq data analysis using BioHPC Lab computers Reference guided RNA-seq data analysis using BioHPC Lab computers This document assumes that you already know some basics of how to use a Linux computer. Some of the command lines in this document are

More information

Robert Bukowski Jaroslaw Pillardy 6/27/2011

Robert Bukowski Jaroslaw Pillardy 6/27/2011 COMPUTATIONAL BIOLOGY SERVICE UNIT, 3CPG RNA Seq CBSU Computational Resources for the Workshop Robert Bukowski (bukowski@cornell.edu); Jaroslaw Pillardy (jp86@cornell.edu) 6/27/2011 In this edition of

More information

Preparation of alignments for variant calling with GATK: exercise instructions for BioHPC Lab computers

Preparation of alignments for variant calling with GATK: exercise instructions for BioHPC Lab computers Preparation of alignments for variant calling with GATK: exercise instructions for BioHPC Lab computers Data used in the exercise We will use D. melanogaster WGS paired-end Illumina data with NCBI accessions

More information

BioHPC Lab at Cornell

BioHPC Lab at Cornell BioHPC Lab at Cornell Jaroslaw Pillardy CBSU, Life Sciences Core Laboratories Center Cornell University Practical exercises for the workshop will be carried out using CBSU BioHPC Lab Software used during

More information

RNA-seq. Manpreet S. Katari

RNA-seq. Manpreet S. Katari RNA-seq Manpreet S. Katari Evolution of Sequence Technology Normalizing the Data RPKM (Reads per Kilobase of exons per million reads) Score = R NT R = # of unique reads for the gene N = Size of the gene

More information

Sequence Analysis Pipeline

Sequence Analysis Pipeline Sequence Analysis Pipeline Transcript fragments 1. PREPROCESSING 2. ASSEMBLY (today) Removal of contaminants, vector, adaptors, etc Put overlapping sequence together and calculate bigger sequences 3. Analysis/Annotation

More information

Exercise 1. RNA-seq alignment and quantification. Part 1. Prepare the working directory. Part 2. Examine qualities of the RNA-seq data files

Exercise 1. RNA-seq alignment and quantification. Part 1. Prepare the working directory. Part 2. Examine qualities of the RNA-seq data files Exercise 1. RNA-seq alignment and quantification Part 1. Prepare the working directory. 1. Connect to your assigned computer. If you do not know how, follow the instruction at http://cbsu.tc.cornell.edu/lab/doc/remote_access.pdf

More information

NGS Analysis Using Galaxy

NGS Analysis Using Galaxy NGS Analysis Using Galaxy Sequences and Alignment Format Galaxy overview and Interface Get;ng Data in Galaxy Analyzing Data in Galaxy Quality Control Mapping Data History and workflow Galaxy Exercises

More information

RNA-Seq Analysis With the Tuxedo Suite

RNA-Seq Analysis With the Tuxedo Suite June 2016 RNA-Seq Analysis With the Tuxedo Suite Dena Leshkowitz Introduction In this exercise we will learn how to analyse RNA-Seq data using the Tuxedo Suite tools: Tophat, Cuffmerge, Cufflinks and Cuffdiff.

More information

Goal: Learn how to use various tool to extract information from RNAseq reads. 4.1 Mapping RNAseq Reads to a Genome Assembly

Goal: Learn how to use various tool to extract information from RNAseq reads. 4.1 Mapping RNAseq Reads to a Genome Assembly ESSENTIALS OF NEXT GENERATION SEQUENCING WORKSHOP 2014 UNIVERSITY OF KENTUCKY AGTC Class 4 RNAseq Goal: Learn how to use various tool to extract information from RNAseq reads. Input(s): magnaporthe_oryzae_70-15_8_supercontigs.fasta

More information

Ensembl RNASeq Practical. Overview

Ensembl RNASeq Practical. Overview Ensembl RNASeq Practical The aim of this practical session is to use BWA to align 2 lanes of Zebrafish paired end Illumina RNASeq reads to chromosome 12 of the zebrafish ZV9 assembly. We have restricted

More information

RNAseq analysis: SNP calling. BTI bioinformatics course, spring 2013

RNAseq analysis: SNP calling. BTI bioinformatics course, spring 2013 RNAseq analysis: SNP calling BTI bioinformatics course, spring 2013 RNAseq overview RNAseq overview Choose technology 454 Illumina SOLiD 3 rd generation (Ion Torrent, PacBio) Library types Single reads

More information

BGGN-213: FOUNDATIONS OF BIOINFORMATICS (Lecture 14)

BGGN-213: FOUNDATIONS OF BIOINFORMATICS (Lecture 14) BGGN-213: FOUNDATIONS OF BIOINFORMATICS (Lecture 14) Genome Informatics (Part 1) https://bioboot.github.io/bggn213_f17/lectures/#14 Dr. Barry Grant Nov 2017 Overview: The purpose of this lab session is

More information

Our data for today is a small subset of Saimaa ringed seal RNA sequencing data (RNA_seq_reads.fasta). Let s first see how many reads are there:

Our data for today is a small subset of Saimaa ringed seal RNA sequencing data (RNA_seq_reads.fasta). Let s first see how many reads are there: Practical Course in Genome Bioinformatics 19.2.2016 (CORRECTED 22.2.2016) Exercises - Day 5 http://ekhidna.biocenter.helsinki.fi/downloads/teaching/spring2016/ Answer the 5 questions (Q1-Q5) according

More information

BioHPC Lab at Cornell

BioHPC Lab at Cornell BioHPC Lab at Cornell Robert Bukowski (formerly: Computational Biology Service Unit) http://cbsu.tc.cornell.edu/lab/doc/biohpclabintro20130916.pdf (CBSU) Cornell Core Facility providing services for a

More information

RNA-Seq in Galaxy: Tuxedo protocol. Igor Makunin, UQ RCC, QCIF

RNA-Seq in Galaxy: Tuxedo protocol. Igor Makunin, UQ RCC, QCIF RNA-Seq in Galaxy: Tuxedo protocol Igor Makunin, UQ RCC, QCIF Acknowledgments Genomics Virtual Lab: gvl.org.au Galaxy for tutorials: galaxy-tut.genome.edu.au Galaxy Australia: galaxy-aust.genome.edu.au

More information

NGS Data Visualization and Exploration Using IGV

NGS Data Visualization and Exploration Using IGV 1 What is Galaxy Galaxy for Bioinformaticians Galaxy for Experimental Biologists Using Galaxy for NGS Analysis NGS Data Visualization and Exploration Using IGV 2 What is Galaxy Galaxy for Bioinformaticians

More information

Linux for Beginners Part 1

Linux for Beginners Part 1 Linux for Beginners Part 1 3CPG Workshop Robert Bukowski Computational Biology Service Unit http://cbsu.tc.cornell.edu/lab/doc/linux_workshop_part1.pdf Compute clusters BioHPC infrastructure at CBSU BioHPC

More information

Cyverse tutorial 1 Logging in to Cyverse and data management. Open an Internet browser window and navigate to the Cyverse discovery environment:

Cyverse tutorial 1 Logging in to Cyverse and data management. Open an Internet browser window and navigate to the Cyverse discovery environment: Cyverse tutorial 1 Logging in to Cyverse and data management Open an Internet browser window and navigate to the Cyverse discovery environment: https://de.cyverse.org/de/ Click Log in with your CyVerse

More information

Colorado State University Bioinformatics Algorithms Assignment 6: Analysis of High- Throughput Biological Data Hamidreza Chitsaz, Ali Sharifi- Zarchi

Colorado State University Bioinformatics Algorithms Assignment 6: Analysis of High- Throughput Biological Data Hamidreza Chitsaz, Ali Sharifi- Zarchi Colorado State University Bioinformatics Algorithms Assignment 6: Analysis of High- Throughput Biological Data Hamidreza Chitsaz, Ali Sharifi- Zarchi Although a little- bit long, this is an easy exercise

More information

TopHat, Cufflinks, Cuffdiff

TopHat, Cufflinks, Cuffdiff TopHat, Cufflinks, Cuffdiff Andreas Gisel Institute for Biomedical Technologies - CNR, Bari TopHat TopHat TopHat TopHat is a program that aligns RNA-Seq reads to a genome in order to identify exon-exon

More information

How to store and visualize RNA-seq data

How to store and visualize RNA-seq data How to store and visualize RNA-seq data Gabriella Rustici Functional Genomics Group gabry@ebi.ac.uk EBI is an Outstation of the European Molecular Biology Laboratory. Talk summary How do we archive RNA-seq

More information

Galaxy Platform For NGS Data Analyses

Galaxy Platform For NGS Data Analyses Galaxy Platform For NGS Data Analyses Weihong Yan wyan@chem.ucla.edu Collaboratory Web Site http://qcb.ucla.edu/collaboratory Collaboratory Workshops Workshop Outline ü Day 1 UCLA galaxy and user account

More information

Linux for Biologists Part 2

Linux for Biologists Part 2 Linux for Biologists Part 2 Robert Bukowski Institute of Biotechnology Bioinformatics Facility (aka Computational Biology Service Unit - CBSU) http://cbsu.tc.cornell.edu/lab/doc/linux_workshop_part2.pdf

More information

preparation methods and new bacterial strains. Parts of the pipeline that can be updated will be annotated in this guide.

preparation methods and new bacterial strains. Parts of the pipeline that can be updated will be annotated in this guide. BacSeq Introduction The purpose of this guide is to aid current and future Whiteley Lab members and University of Texas microbiologists with bacterial RNA?Seq analysis. Once you have analyzed your data

More information

Single/paired-end RNAseq analysis with Galaxy

Single/paired-end RNAseq analysis with Galaxy October 016 Single/paired-end RNAseq analysis with Galaxy Contents: 1. Introduction. Quality control 3. Alignment 4. Normalization and read counts 5. Workflow overview 6. Sample data set to test the paired-end

More information

Mapping RNA sequence data (Part 1: using pathogen portal s RNAseq pipeline) Exercise 6

Mapping RNA sequence data (Part 1: using pathogen portal s RNAseq pipeline) Exercise 6 Mapping RNA sequence data (Part 1: using pathogen portal s RNAseq pipeline) Exercise 6 The goal of this exercise is to retrieve an RNA-seq dataset in FASTQ format and run it through an RNA-sequence analysis

More information

David Crossman, Ph.D. UAB Heflin Center for Genomic Science. GCC2012 Wednesday, July 25, 2012

David Crossman, Ph.D. UAB Heflin Center for Genomic Science. GCC2012 Wednesday, July 25, 2012 David Crossman, Ph.D. UAB Heflin Center for Genomic Science GCC2012 Wednesday, July 25, 2012 Galaxy Splash Page Colors Random Galaxy icons/colors Queued Running Completed Download/Save Failed Icons Display

More information

Galaxy workshop at the Winter School Igor Makunin

Galaxy workshop at the Winter School Igor Makunin Galaxy workshop at the Winter School 2016 Igor Makunin i.makunin@uq.edu.au Winter school, UQ, July 6, 2016 Plan Overview of the Genomics Virtual Lab Introduce Galaxy, a web based platform for analysis

More information

ITMO Ecole de Bioinformatique Hands-on session: smallrna-seq N. Servant 21 rd November 2013

ITMO Ecole de Bioinformatique Hands-on session: smallrna-seq N. Servant 21 rd November 2013 ITMO Ecole de Bioinformatique Hands-on session: smallrna-seq N. Servant 21 rd November 2013 1. Data and objectives We will use the data from GEO (GSE35368, Toedling, Servant et al. 2011). Two samples were

More information

Helsinki 19 Jan Practical course in genome bioinformatics DAY 0

Helsinki 19 Jan Practical course in genome bioinformatics DAY 0 Helsinki 19 Jan 2017 529028 Practical course in genome bioinformatics DAY 0 This document can be downloaded at: http://ekhidna.biocenter.helsinki.fi/downloads/teaching/spring2017/exercises_day0.pdf The

More information

Introduction to BioHPC Lab

Introduction to BioHPC Lab Introduction to BioHPC Lab BioHPC Lab Workshop Jaroslaw Pillardy Bioinformatics Facility Institute of Biotechnology Cornell University http://cbsu.tc.cornell.edu/lab/lab.aspx http://cbsu.tc.cornell.edu/lab/doc/introduction_to_biohpc_lab_v2.pdf

More information

Using the GBS Analysis Pipeline Tutorial

Using the GBS Analysis Pipeline Tutorial Using the GBS Analysis Pipeline Tutorial Cornell CBSU/IGD GBS Bioinformatics Workshop September 13 & 14 2012 Step 0: If one of the CBSU BioHPC Lab workstations was reserved for you, it will be listed on

More information

NGS FASTQ file format

NGS FASTQ file format NGS FASTQ file format Line1: Begins with @ and followed by a sequence idenefier and opeonal descripeon Line2: Raw sequence leiers Line3: + Line4: Encodes the quality values for the sequence in Line2 (see

More information

Integrative Genomics Viewer. Prat Thiru

Integrative Genomics Viewer. Prat Thiru Integrative Genomics Viewer Prat Thiru 1 Overview User Interface Basics Browsing the Data Data Formats IGV Tools Demo Outline Based on ISMB 2010 Tutorial by Robinson and Thorvaldsdottir 2 Why IGV? IGV

More information

An Introduction to Linux and Bowtie

An Introduction to Linux and Bowtie An Introduction to Linux and Bowtie Cavan Reilly November 10, 2017 Table of contents Introduction to UNIX-like operating systems Installing programs Bowtie SAMtools Introduction to Linux In order to use

More information

SAM : Sequence Alignment/Map format. A TAB-delimited text format storing the alignment information. A header section is optional.

SAM : Sequence Alignment/Map format. A TAB-delimited text format storing the alignment information. A header section is optional. Alignment of NGS reads, samtools and visualization Hands-on Software used in this practical BWA MEM : Burrows-Wheeler Aligner. A software package for mapping low-divergent sequences against a large reference

More information

Our typical RNA quantification pipeline

Our typical RNA quantification pipeline RNA-Seq primer Our typical RNA quantification pipeline Upload your sequence data (fastq) Align to the ribosome (Bow>e) Align remaining reads to genome (TopHat) or transcriptome (RSEM) Make report of quality

More information

Goal: Learn how to use various tool to extract information from RNAseq reads.

Goal: Learn how to use various tool to extract information from RNAseq reads. ESSENTIALS OF NEXT GENERATION SEQUENCING WORKSHOP 2017 Class 4 RNAseq Goal: Learn how to use various tool to extract information from RNAseq reads. Input(s): Output(s): magnaporthe_oryzae_70-15_8_supercontigs.fasta

More information

Introduction to Read Alignment. UCD Genome Center Bioinformatics Core Tuesday 15 September 2015

Introduction to Read Alignment. UCD Genome Center Bioinformatics Core Tuesday 15 September 2015 Introduction to Read Alignment UCD Genome Center Bioinformatics Core Tuesday 15 September 2015 From reads to molecules Why align? Individual A Individual B ATGATAGCATCGTCGGGTGTCTGCTCAATAATAGTGCCGTATCATGCTGGTGTTATAATCGCCGCATGACATGATCAATGG

More information

Read mapping with BWA and BOWTIE

Read mapping with BWA and BOWTIE Read mapping with BWA and BOWTIE Before We Start In order to save a lot of typing, and to allow us some flexibility in designing these courses, we will establish a UNIX shell variable BASE to point to

More information

version /1/2011 Source code Linux x86_64 binary Mac OS X x86_64 binary

version /1/2011 Source code Linux x86_64 binary Mac OS X x86_64 binary Cufflinks RNA-Seq analysis tools - Getting Started 1 of 6 14.07.2011 09:42 Cufflinks Transcript assembly, differential expression, and differential regulation for RNA-Seq Site Map Home Getting started

More information

!"#$%&$'()#$*)+,-./).01"0#,23+3,303456"6,&((46,7$+-./&((468,

!#$%&$'()#$*)+,-./).010#,23+3,3034566,&((46,7$+-./&((468, !"#$%&$'()#$*)+,-./).01"0#,23+3,303456"6,&((46,7$+-./&((468, 9"(1(02)1+(',:.;.4(*.',?9@A,!."2.4B.'#A,C(;.

More information

Visualization using CummeRbund 2014 Overview

Visualization using CummeRbund 2014 Overview Visualization using CummeRbund 2014 Overview In this lab, we'll look at how to use cummerbund to visualize our gene expression results from cuffdiff. CummeRbund is part of the tuxedo pipeline and it is

More information

RNASeq2017 Course Salerno, September 27-29, 2017

RNASeq2017 Course Salerno, September 27-29, 2017 RNASeq2017 Course Salerno, September 27-29, 2017 RNA- seq Hands on Exercise Fabrizio Ferrè, University of Bologna Alma Mater (fabrizio.ferre@unibo.it) Hands- on tutorial based on the EBI teaching materials

More information

RNA-seq Data Analysis

RNA-seq Data Analysis Seyed Abolfazl Motahari RNA-seq Data Analysis Basics Next Generation Sequencing Biological Samples Data Cost Data Volume Big Data Analysis in Biology تحلیل داده ها کنترل سیستمهای بیولوژیکی تشخیص بیماریها

More information

Short Read Sequencing Analysis Workshop

Short Read Sequencing Analysis Workshop Short Read Sequencing Analysis Workshop Day 2 Learning the Linux Compute Environment In-class Slides Matt Hynes-Grace Manager of IT Operations, BioFrontiers Institute Review of Day 2 Videos Video 1 Introduction

More information

Genomic Files. University of Massachusetts Medical School. October, 2015

Genomic Files. University of Massachusetts Medical School. October, 2015 .. Genomic Files University of Massachusetts Medical School October, 2015 2 / 55. A Typical Deep-Sequencing Workflow Samples Fastq Files Fastq Files Sam / Bam Files Various files Deep Sequencing Further

More information

Genomic Files. University of Massachusetts Medical School. October, 2014

Genomic Files. University of Massachusetts Medical School. October, 2014 .. Genomic Files University of Massachusetts Medical School October, 2014 2 / 39. A Typical Deep-Sequencing Workflow Samples Fastq Files Fastq Files Sam / Bam Files Various files Deep Sequencing Further

More information

These will serve as a basic guideline for read prep. This assumes you have demultiplexed Illumina data.

These will serve as a basic guideline for read prep. This assumes you have demultiplexed Illumina data. These will serve as a basic guideline for read prep. This assumes you have demultiplexed Illumina data. We have a few different choices for running jobs on DT2 we will explore both here. We need to alter

More information

11/8/2017 Trinity De novo Transcriptome Assembly Workshop trinityrnaseq/rnaseq_trinity_tuxedo_workshop Wiki GitHub

11/8/2017 Trinity De novo Transcriptome Assembly Workshop trinityrnaseq/rnaseq_trinity_tuxedo_workshop Wiki GitHub trinityrnaseq / RNASeq_Trinity_Tuxedo_Workshop Trinity De novo Transcriptome Assembly Workshop Brian Haas edited this page on Oct 17, 2015 14 revisions De novo RNA-Seq Assembly and Analysis Using Trinity

More information

Practical Course in Genome Bioinformatics

Practical Course in Genome Bioinformatics Practical Course in Genome Bioinformatics 20/01/2017 Exercises - Day 1 http://ekhidna.biocenter.helsinki.fi/downloads/teaching/spring2017/ Answer questions Q1-Q3 below and include requested Figures 1-5

More information

Practical Linux examples: Exercises

Practical Linux examples: Exercises Practical Linux examples: Exercises 1. Login (ssh) to the machine that you are assigned for this workshop (assigned machines: https://cbsu.tc.cornell.edu/ww/machines.aspx?i=87 ). Prepare working directory,

More information

Illumina Next Generation Sequencing Data analysis

Illumina Next Generation Sequencing Data analysis Illumina Next Generation Sequencing Data analysis Chiara Dal Fiume Sr Field Application Scientist Italy 2010 Illumina, Inc. All rights reserved. Illumina, illuminadx, Solexa, Making Sense Out of Life,

More information

Tiling Assembly for Annotation-independent Novel Gene Discovery

Tiling Assembly for Annotation-independent Novel Gene Discovery Tiling Assembly for Annotation-independent Novel Gene Discovery By Jennifer Lopez and Kenneth Watanabe Last edited on September 7, 2015 by Kenneth Watanabe The following procedure explains how to run the

More information

Introduction to UNIX command-line II

Introduction to UNIX command-line II Introduction to UNIX command-line II Boyce Thompson Institute 2017 Prashant Hosmani Class Content Terminal file system navigation Wildcards, shortcuts and special characters File permissions Compression

More information

NGS Data and Sequence Alignment

NGS Data and Sequence Alignment Applications and Servers SERVER/REMOTE Compute DB WEB Data files NGS Data and Sequence Alignment SSH WEB SCP Manpreet S. Katari App Aug 11, 2016 Service Terminal IGV Data files Window Personal Computer/Local

More information

Welcome to GenomeView 101!

Welcome to GenomeView 101! Welcome to GenomeView 101! 1. Start your computer 2. Download and extract the example data http://www.broadinstitute.org/~tabeel/broade.zip Suggestion: - Linux, Mac: make new folder in your home directory

More information

Virtual Machine. Linux flavor : Debian. Everything (except slides) preinstalled for you. https://www.virtualbox.org/

Virtual Machine. Linux flavor : Debian. Everything (except slides) preinstalled for you. https://www.virtualbox.org/ Virtual Machine Anyone have problems installing it? VM: Virtual Box - allows you to run a different operating system within the current operating system of your machine. https://www.virtualbox.org/ Linux

More information

Analysis of ChIP-seq data

Analysis of ChIP-seq data Before we start: 1. Log into tak (step 0 on the exercises) 2. Go to your lab space and create a folder for the class (see separate hand out) 3. Connect to your lab space through the wihtdata network and

More information

The software and data for the RNA-Seq exercise are already available on the USB system

The software and data for the RNA-Seq exercise are already available on the USB system BIT815 Notes on R analysis of RNA-seq data The software and data for the RNA-Seq exercise are already available on the USB system The notes below regarding installation of R packages and other software

More information

Genomics. Nolan C. Kane

Genomics. Nolan C. Kane Genomics Nolan C. Kane Nolan.Kane@Colorado.edu Course info http://nkane.weebly.com/genomics.html Emails let me know if you are not getting them! Email me at nolan.kane@colorado.edu Office hours by appointment

More information

A Hands-On Tutorial: RNA Sequencing Using High-Performance Computing

A Hands-On Tutorial: RNA Sequencing Using High-Performance Computing A Hands-On Tutorial: RNA Sequencing Using Computing February 11th and 12th, 2016 1st session (Thursday) Preliminaries: Linux, HPC, command line interface Using HPC: modules, queuing system Presented by:

More information

Linux + Galaxy Server Tutorial

Linux + Galaxy Server Tutorial Linux + Galaxy Server Tutorial Pei-Chen Peng Linux+Galaxy Pei-Chen Peng 2017 1 Introduction Exercise 1. Download lab data to flash drive. 2. Run a simple bioinformatics program on linux.. 3. Learn Galaxy

More information

High-throughout sequencing and using short-read aligners. Simon Anders

High-throughout sequencing and using short-read aligners. Simon Anders High-throughout sequencing and using short-read aligners Simon Anders High-throughput sequencing (HTS) Sequencing millions of short DNA fragments in parallel. a.k.a.: next-generation sequencing (NGS) massively-parallel

More information

Perl for Biologists. Practical example. Session 14 June 3, Robert Bukowski. Session 14: Practical example Perl for Biologists 1.

Perl for Biologists. Practical example. Session 14 June 3, Robert Bukowski. Session 14: Practical example Perl for Biologists 1. Perl for Biologists Session 14 June 3, 2015 Practical example Robert Bukowski Session 14: Practical example Perl for Biologists 1.2 1 Session 13 review Process is an object of UNIX (Linux) kernel identified

More information

Protocol: peak-calling for ChIP-seq data / segmentation analysis for histone modification data

Protocol: peak-calling for ChIP-seq data / segmentation analysis for histone modification data Protocol: peak-calling for ChIP-seq data / segmentation analysis for histone modification data Table of Contents Protocol: peak-calling for ChIP-seq data / segmentation analysis for histone modification

More information

Welcome to MAPHiTS (Mapping Analysis Pipeline for High-Throughput Sequences) tutorial page.

Welcome to MAPHiTS (Mapping Analysis Pipeline for High-Throughput Sequences) tutorial page. Welcome to MAPHiTS (Mapping Analysis Pipeline for High-Throughput Sequences) tutorial page. In this page you will learn to use the tools of the MAPHiTS suite. A little advice before starting : rename your

More information

Dr. Gabriela Salinas Dr. Orr Shomroni Kaamini Rhaithata

Dr. Gabriela Salinas Dr. Orr Shomroni Kaamini Rhaithata Analysis of RNA sequencing data sets using the Galaxy environment Dr. Gabriela Salinas Dr. Orr Shomroni Kaamini Rhaithata Microarray and Deep-sequencing core facility 30.10.2017 RNA-seq workflow I Hypothesis

More information

From the Schnable Lab:

From the Schnable Lab: From the Schnable Lab: Yang Zhang and Daniel Ngu s Pipeline for Processing RNA-seq Data (As of November 17, 2016) yzhang91@unl.edu dngu2@huskers.unl.edu Pre-processing the reads: The alignment software

More information

High-throughput sequencing: Alignment and related topic. Simon Anders EMBL Heidelberg

High-throughput sequencing: Alignment and related topic. Simon Anders EMBL Heidelberg High-throughput sequencing: Alignment and related topic Simon Anders EMBL Heidelberg Established platforms HTS Platforms Illumina HiSeq, ABI SOLiD, Roche 454 Newcomers: Benchtop machines 454 GS Junior,

More information

ChIP-seq hands-on practical using Galaxy

ChIP-seq hands-on practical using Galaxy ChIP-seq hands-on practical using Galaxy In this exercise we will cover some of the basic NGS analysis steps for ChIP-seq using the Galaxy framework: Quality control Mapping of reads using Bowtie2 Peak-calling

More information

COMPARATIVE MICROBIAL GENOMICS ANALYSIS WORKSHOP. Exercise 2: Predicting Protein-encoding Genes, BlastMatrix, BlastAtlas

COMPARATIVE MICROBIAL GENOMICS ANALYSIS WORKSHOP. Exercise 2: Predicting Protein-encoding Genes, BlastMatrix, BlastAtlas COMPARATIVE MICROBIAL GENOMICS ANALYSIS WORKSHOP Exercise 2: Predicting Protein-encoding Genes, BlastMatrix, BlastAtlas First of all connect once again to the CBS system: Open ssh shell client. Press Quick

More information

Aligners. J Fass 21 June 2017

Aligners. J Fass 21 June 2017 Aligners J Fass 21 June 2017 Definitions Assembly: I ve found the shredded remains of an important document; put it back together! UC Davis Genome Center Bioinformatics Core J Fass Aligners 2017-06-21

More information

SMRT-Portal Exercises. J Fass UCD Genome Center Bioinformatics Core Thursday April 16, 2015

SMRT-Portal Exercises. J Fass UCD Genome Center Bioinformatics Core Thursday April 16, 2015 SMRT-Portal Exercises J Fass UCD Genome Center Bioinformatics Core Thursday April 16, 2015 Running SMRT-Portal in AWS see PacBio documentation We ll be running a virtual machine (VM) in the Amazon Web

More information

Mapping NGS reads for genomics studies

Mapping NGS reads for genomics studies Mapping NGS reads for genomics studies Valencia, 28-30 Sep 2015 BIER Alejandro Alemán aaleman@cipf.es Genomics Data Analysis CIBERER Where are we? Fastq Sequence preprocessing Fastq Alignment BAM Visualization

More information

Centre (CNIO). 3rd Melchor Fernández Almagro St , Madrid, Spain. s/n, Universidad de Vigo, Ourense, Spain.

Centre (CNIO). 3rd Melchor Fernández Almagro St , Madrid, Spain. s/n, Universidad de Vigo, Ourense, Spain. O. Graña *a,b, M. Rubio-Camarillo a, F. Fdez-Riverola b, D.G. Pisano a and D. Glez-Peña b a Bioinformatics Unit, Structural Biology and BioComputing Programme, Spanish National Cancer Research Centre (CNIO).

More information

A Tutorial: Genome- based RNA- Seq Analysis Using the TUXEDO Package

A Tutorial: Genome- based RNA- Seq Analysis Using the TUXEDO Package A Tutorial: Genome- based RNA- Seq Analysis Using the TUXEDO Package The following data and software resources are required for following the tutorial. Data: ftp://ftp.broad.mit.edu/pub/users/bhaas/rnaseq_workshop/rnaseq_workshop_dat

More information

mrna-seq Basic processing Read mapping (shown here, but optional. May due if time allows) Gene expression estimation

mrna-seq Basic processing Read mapping (shown here, but optional. May due if time allows) Gene expression estimation mrna-seq Basic processing Read mapping (shown here, but optional. May due if time allows) Tophat Gene expression estimation cufflinks Confidence intervals Gene expression changes (separate use case) Sample

More information

Evaluate NimbleGen SeqCap RNA Target Enrichment Data

Evaluate NimbleGen SeqCap RNA Target Enrichment Data Roche Sequencing Technical Note November 2014 How To Evaluate NimbleGen SeqCap RNA Target Enrichment Data 1. OVERVIEW Analysis of NimbleGen SeqCap RNA target enrichment data generated using an Illumina

More information

Short Read Sequencing Analysis Workshop

Short Read Sequencing Analysis Workshop Short Read Sequencing Analysis Workshop Day 8: Introduc/on to RNA-seq Analysis In-class slides Day 7 Homework 1.) 14 GABPA ChIP-seq peaks 2.) Error: Dataset too large (> 100000). Rerun with larger maxsize

More information

Today's outline. Resources. Genome browser components. Genome browsers: Discovering biology through genomics. Genome browser tutorial materials

Today's outline. Resources. Genome browser components. Genome browsers: Discovering biology through genomics. Genome browser tutorial materials Today's outline Genome browsers: Discovering biology through genomics BaRC Hot Topics April 2013 George Bell, Ph.D. http://jura.wi.mit.edu/bio/education/hot_topics/ Genome browser introduction Popular

More information

Data: ftp://ftp.broad.mit.edu/pub/users/bhaas/rnaseq_workshop/rnaseq_workshop_dat a.tgz. Software:

Data: ftp://ftp.broad.mit.edu/pub/users/bhaas/rnaseq_workshop/rnaseq_workshop_dat a.tgz. Software: A Tutorial: De novo RNA- Seq Assembly and Analysis Using Trinity and edger The following data and software resources are required for following the tutorial: Data: ftp://ftp.broad.mit.edu/pub/users/bhaas/rnaseq_workshop/rnaseq_workshop_dat

More information

Aligners. J Fass 23 August 2017

Aligners. J Fass 23 August 2017 Aligners J Fass 23 August 2017 Definitions Assembly: I ve found the shredded remains of an important document; put it back together! UC Davis Genome Center Bioinformatics Core J Fass Aligners 2017-08-23

More information

CBSU/3CPG/CVG Joint Workshop Series Reference genome based sequence variation detection

CBSU/3CPG/CVG Joint Workshop Series Reference genome based sequence variation detection CBSU/3CPG/CVG Joint Workshop Series Reference genome based sequence variation detection Computational Biology Service Unit (CBSU) Cornell Center for Comparative and Population Genomics (3CPG) Center for

More information

Copy Number Variations Detection - TD. Using Sequenza under Galaxy

Copy Number Variations Detection - TD. Using Sequenza under Galaxy Copy Number Variations Detection - TD Using Sequenza under Galaxy I. Data loading We will analyze the copy number variations of a human tumor (parotid gland carcinoma), limited to the chr17, from a WES

More information

Exercise 1 Review. --outfiltermismatchnmax : max number of mismatch (Default 10) --outreadsunmapped fastx: output unmapped reads

Exercise 1 Review. --outfiltermismatchnmax : max number of mismatch (Default 10) --outreadsunmapped fastx: output unmapped reads Exercise 1 Review Setting parameters STAR --quantmode GeneCounts --genomedir genomedb -- runthreadn 2 --outfiltermismatchnmax 2 --readfilesin WTa.fastq.gz --readfilescommand zcat --outfilenameprefix WTa

More information

Variation among genomes

Variation among genomes Variation among genomes Comparing genomes The reference genome http://www.ncbi.nlm.nih.gov/nuccore/26556996 Arabidopsis thaliana, a model plant Col-0 variety is from Landsberg, Germany Ler is a mutant

More information

Lecture 12. Short read aligners

Lecture 12. Short read aligners Lecture 12 Short read aligners Ebola reference genome We will align ebola sequencing data against the 1976 Mayinga reference genome. We will hold the reference gnome and all indices: mkdir -p ~/reference/ebola

More information

ls /data/atrnaseq/ egrep "(fastq fasta fq fa)\.gz" ls /data/atrnaseq/ egrep "(cn ts)[1-3]ln[^3a-za-z]\."

ls /data/atrnaseq/ egrep (fastq fasta fq fa)\.gz ls /data/atrnaseq/ egrep (cn ts)[1-3]ln[^3a-za-z]\. Command line tools - bash, awk and sed We can only explore a small fraction of the capabilities of the bash shell and command-line utilities in Linux during this course. An entire course could be taught

More information

WM2 Bioinformatics. ExomeSeq data analysis part 1. Dietmar Rieder

WM2 Bioinformatics. ExomeSeq data analysis part 1. Dietmar Rieder WM2 Bioinformatics ExomeSeq data analysis part 1 Dietmar Rieder RAW data Use putty to logon to cluster.i med.ac.at In your home directory make directory to store raw data $ mkdir 00_RAW Copy raw fastq

More information

Next generation sequencing: assembly by mapping reads. Laurent Falquet, Vital-IT Helsinki, June 3, 2010

Next generation sequencing: assembly by mapping reads. Laurent Falquet, Vital-IT Helsinki, June 3, 2010 Next generation sequencing: assembly by mapping reads Laurent Falquet, Vital-IT Helsinki, June 3, 2010 Overview What is assembly by mapping? Methods BWT File formats Tools Issues Visualization Discussion

More information

ChIP-seq practical: peak detection and peak annotation. Mali Salmon-Divon Remco Loos Myrto Kostadima

ChIP-seq practical: peak detection and peak annotation. Mali Salmon-Divon Remco Loos Myrto Kostadima ChIP-seq practical: peak detection and peak annotation Mali Salmon-Divon Remco Loos Myrto Kostadima March 2012 Introduction The goal of this hands-on session is to perform some basic tasks in the analysis

More information

ChIP-Seq data analysis workshop

ChIP-Seq data analysis workshop ChIP-Seq data analysis workshop Exercise 1. ChIP-Seq peak calling 1. Using Putty (Windows) or Terminal (Mac) to connect to your assigned computer. Create a directory /workdir/myuserid (replace myuserid

More information

Getting Started With UNIX Lab Exercises

Getting Started With UNIX Lab Exercises Getting Started With UNIX Lab Exercises This is the lab exercise handout for the Getting Started with UNIX tutorial. The exercises provide hands-on experience with the topics discussed in the tutorial.

More information

Web page:

Web page: mirdeep* manual 2013-01-10 Jiyuan An, John Lai, Melanie Lehman, Colleen Nelson: Australian Prostate Cancer Research Center (APCRC-Q) and Institute of Health and Biomedical Innovation (IHBI), Queensland

More information

Variant calling using SAMtools

Variant calling using SAMtools Variant calling using SAMtools Calling variants - a trivial use of an Interactive Session We are going to conduct the variant calling exercises in an interactive idev session just so you can get a feel

More information

AgroMarker Finder manual (1.1)

AgroMarker Finder manual (1.1) AgroMarker Finder manual (1.1) 1. Introduction 2. Installation 3. How to run? 4. How to use? 5. Java program for calculating of restriction enzyme sites (TaqαI). 1. Introduction AgroMarker Finder (AMF)is

More information

Super-Fast Genome BWA-Bam-Sort on GLAD

Super-Fast Genome BWA-Bam-Sort on GLAD 1 Hututa Technologies Limited Super-Fast Genome BWA-Bam-Sort on GLAD Zhiqiang Ma, Wangjun Lv and Lin Gu May 2016 1 2 Executive Summary Aligning the sequenced reads in FASTQ files and converting the resulted

More information