Genome 373: Mapping Short Sequence Reads III. Doug Fowler

Size: px
Start display at page:

Download "Genome 373: Mapping Short Sequence Reads III. Doug Fowler"

Transcription

1 Genome 373: Mapping Short Sequence Reads III Doug Fowler

2 What is Galaxy? Galaxy is a free, open source web platform for running all sorts of computational analyses including pretty much all of the sequencing-related stuff we ve discussed! You can use it at usegalaxy.org

3 The Data We ll Be Playing With This is a FASTA file, which contains one sequence. This sequence, which corresponds to just one gene (MYC) will be our reference

4 The Data We ll Be Playing With

5 The Data We ll Be Playing With This is a FASTQ file, which is a standard high-throughput sequencing format. This file contains ~20,000 high-throughput sequencing reads which we will align to the MYC locus

6 The FASTQ format Why might we want to store Q scores as ASCII characters rather than numbers?

7

8 Short read mapping Go to User -> Register and register, if you haven t already if you have, login

9 Short read mapping Load data using the load your own data link

10 Short read mapping Upload MYClocus.fa (type = fasta) and cas9.fq (type = fastqsanger). Make sure to set the file type correctly, then click start

11 Short read mapping The files should appear in the history section on the right

12 First, let s do a quality analysis by clicking NGS: QC and manipulation and then FastQC

13 We see information and parameters for the FastQC tool make sure cas9.fq is selected and hit execute

14 We see that the job has been started and will produce two files, a RawData file and a webpage

15 Jobs are gray when waiting, yellow when running and green when done

16 You can click on the eye button to look at the data or the job name for more information

17 Once the FastQC job is done, click on the eye button for the Webpage output file to see the quality report looks pretty good!

18 Explore these results the first plot shows Q scores along the read

19 Next, let s align our reads (the.fq file) to our reference sequence (the.fa file) by clicking NGS: Mapping -> BWA-MEM

20 We need to tell BWA-MEM to use the MYClocus.fa reference by changing the load reference genome from local cache to history

21 We need to tell BWA-MEM to use only single read data (we don t have paired end reads) by changing to Single

22 Then, execute the alignment

23 Once the alignment is done, click the Visualize in Trackster button

24 We ll need to tell Galaxy we want to use our custom MYClocus.fa reference sequence so click Add a Custom Build

25 Name the custom build, add a key name and make sure the right file (MYClocus.fa) is selected then hit submit

26 Click the Back button on the browser to get back to the main Galaxy view and click on Visualize in Trackster again

27 This time, your MYClocus custom reference will be available select it and click create then wait while the visualization is prepared

28 Now you can see the read pileup from our alignment! Try zooming, clicking and dragging, etc

29 You can also play with the display mode to see the data in different ways

30 Save the visualization

31 Click the Analyze Data link to go back to the main Galaxy page

32 Now, lets call variants from our pileup using the Mpileup tool in NGS: SAMtools

33 We need to change one parameter for Mpileup. Select Perform INDEL calling and set advanced options and then enter 100,000 in the Skip INDEL calling if the average per-sample depth is above box. Then, execute Mpileup

34 You might be wondering why we would expect to see any variants in this sequencing data It s because we used a nuclease called Cas9 to cut the genome at the MYC locus

35 When these cuts are repaired, small insertions and deletions are created at the cut site. This is what we will be looking for in our pileup

36 Once our Mpileup job has finished, we can look at the results. Click on Visualization -> Saved Visualizations

37 Now, click on the visualization of the MYC locus read pileup we saved earlier

38 To add the results of Mpileup to the existing visualization as a new track, click the Add tracks button

39 Click the Histories -> Unnamed history button and select the Mpileup data. Note that you may need to click Data Libraries first and then back to Histories, as this was a bug that happened when I tried

40 When the visualization is finished, you can see the indel density by clicking Set display mode -> Coverage. You can see that the Cas9 treatment did, indeed, induce indels!

41 If you get done with this small tutorial with time to spare, consider playing with some of the data you can access through Shared Data

Helpful Galaxy screencasts are available at:

Helpful Galaxy screencasts are available at: This user guide serves as a simplified, graphic version of the CloudMap paper for applicationoriented end-users. For more details, please see the CloudMap paper. Video versions of these user guides and

More information

NGS : reads quality control

NGS : reads quality control NGS : reads quality control Data used in this tutorials are available on https:/urgi.versailles.inra.fr/download/tuto/ngs-readsquality-control. Select genome solexa.fasta, illumina.fastq, solexa.fastq

More information

ChIP-seq hands-on practical using Galaxy

ChIP-seq hands-on practical using Galaxy ChIP-seq hands-on practical using Galaxy In this exercise we will cover some of the basic NGS analysis steps for ChIP-seq using the Galaxy framework: Quality control Mapping of reads using Bowtie2 Peak-calling

More information

Welcome to MAPHiTS (Mapping Analysis Pipeline for High-Throughput Sequences) tutorial page.

Welcome to MAPHiTS (Mapping Analysis Pipeline for High-Throughput Sequences) tutorial page. Welcome to MAPHiTS (Mapping Analysis Pipeline for High-Throughput Sequences) tutorial page. In this page you will learn to use the tools of the MAPHiTS suite. A little advice before starting : rename your

More information

ChIP-seq hands-on practical using Galaxy

ChIP-seq hands-on practical using Galaxy ChIP-seq hands-on practical using Galaxy In this exercise we will cover some of the basic NGS analysis steps for ChIP-seq using the Galaxy framework: Quality control Mapping of reads using Bowtie2 Peak-calling

More information

NGS Analysis Using Galaxy

NGS Analysis Using Galaxy NGS Analysis Using Galaxy Sequences and Alignment Format Galaxy overview and Interface Get;ng Data in Galaxy Analyzing Data in Galaxy Quality Control Mapping Data History and workflow Galaxy Exercises

More information

NGS Data Visualization and Exploration Using IGV

NGS Data Visualization and Exploration Using IGV 1 What is Galaxy Galaxy for Bioinformaticians Galaxy for Experimental Biologists Using Galaxy for NGS Analysis NGS Data Visualization and Exploration Using IGV 2 What is Galaxy Galaxy for Bioinformaticians

More information

BGGN-213: FOUNDATIONS OF BIOINFORMATICS (Lecture 14)

BGGN-213: FOUNDATIONS OF BIOINFORMATICS (Lecture 14) BGGN-213: FOUNDATIONS OF BIOINFORMATICS (Lecture 14) Genome Informatics (Part 1) https://bioboot.github.io/bggn213_f17/lectures/#14 Dr. Barry Grant Nov 2017 Overview: The purpose of this lab session is

More information

Copy Number Variations Detection - TD. Using Sequenza under Galaxy

Copy Number Variations Detection - TD. Using Sequenza under Galaxy Copy Number Variations Detection - TD Using Sequenza under Galaxy I. Data loading We will analyze the copy number variations of a human tumor (parotid gland carcinoma), limited to the chr17, from a WES

More information

Galaxy Platform For NGS Data Analyses

Galaxy Platform For NGS Data Analyses Galaxy Platform For NGS Data Analyses Weihong Yan wyan@chem.ucla.edu Collaboratory Web Site http://qcb.ucla.edu/collaboratory Collaboratory Workshops Workshop Outline ü Day 1 UCLA galaxy and user account

More information

RNA-Seq in Galaxy: Tuxedo protocol. Igor Makunin, UQ RCC, QCIF

RNA-Seq in Galaxy: Tuxedo protocol. Igor Makunin, UQ RCC, QCIF RNA-Seq in Galaxy: Tuxedo protocol Igor Makunin, UQ RCC, QCIF Acknowledgments Genomics Virtual Lab: gvl.org.au Galaxy for tutorials: galaxy-tut.genome.edu.au Galaxy Australia: galaxy-aust.genome.edu.au

More information

Variant calling using SAMtools

Variant calling using SAMtools Variant calling using SAMtools Calling variants - a trivial use of an Interactive Session We are going to conduct the variant calling exercises in an interactive idev session just so you can get a feel

More information

Analyzing ChIP- Seq Data in Galaxy

Analyzing ChIP- Seq Data in Galaxy Analyzing ChIP- Seq Data in Galaxy Lauren Mills RISS ABSTRACT Step- by- step guide to basic ChIP- Seq analysis using the Galaxy platform. Table of Contents Introduction... 3 Links to helpful information...

More information

Galaxy workshop at the Winter School Igor Makunin

Galaxy workshop at the Winter School Igor Makunin Galaxy workshop at the Winter School 2016 Igor Makunin i.makunin@uq.edu.au Winter school, UQ, July 6, 2016 Plan Overview of the Genomics Virtual Lab Introduce Galaxy, a web based platform for analysis

More information

Preparation of alignments for variant calling with GATK: exercise instructions for BioHPC Lab computers

Preparation of alignments for variant calling with GATK: exercise instructions for BioHPC Lab computers Preparation of alignments for variant calling with GATK: exercise instructions for BioHPC Lab computers Data used in the exercise We will use D. melanogaster WGS paired-end Illumina data with NCBI accessions

More information

Dr. Gabriela Salinas Dr. Orr Shomroni Kaamini Rhaithata

Dr. Gabriela Salinas Dr. Orr Shomroni Kaamini Rhaithata Analysis of RNA sequencing data sets using the Galaxy environment Dr. Gabriela Salinas Dr. Orr Shomroni Kaamini Rhaithata Microarray and Deep-sequencing core facility 30.10.2017 RNA-seq workflow I Hypothesis

More information

1. Download the data from ENA and QC it:

1. Download the data from ENA and QC it: GenePool-External : Genome Assembly tutorial for NGS workshop 20121016 This page last changed on Oct 11, 2012 by tcezard. This is a whole genome sequencing of a E. coli from the 2011 German outbreak You

More information

NGS Analyses with Galaxy

NGS Analyses with Galaxy 1 NGS Analyses with Galaxy Introduction Every living organism on our planet possesses a genome that is composed of one or several DNA (deoxyribonucleotide acid) molecules determining the way the organism

More information

ITMO Ecole de Bioinformatique Hands-on session: smallrna-seq N. Servant 21 rd November 2013

ITMO Ecole de Bioinformatique Hands-on session: smallrna-seq N. Servant 21 rd November 2013 ITMO Ecole de Bioinformatique Hands-on session: smallrna-seq N. Servant 21 rd November 2013 1. Data and objectives We will use the data from GEO (GSE35368, Toedling, Servant et al. 2011). Two samples were

More information

Colorado State University Bioinformatics Algorithms Assignment 6: Analysis of High- Throughput Biological Data Hamidreza Chitsaz, Ali Sharifi- Zarchi

Colorado State University Bioinformatics Algorithms Assignment 6: Analysis of High- Throughput Biological Data Hamidreza Chitsaz, Ali Sharifi- Zarchi Colorado State University Bioinformatics Algorithms Assignment 6: Analysis of High- Throughput Biological Data Hamidreza Chitsaz, Ali Sharifi- Zarchi Although a little- bit long, this is an easy exercise

More information

WM2 Bioinformatics. ExomeSeq data analysis part 1. Dietmar Rieder

WM2 Bioinformatics. ExomeSeq data analysis part 1. Dietmar Rieder WM2 Bioinformatics ExomeSeq data analysis part 1 Dietmar Rieder RAW data Use putty to logon to cluster.i med.ac.at In your home directory make directory to store raw data $ mkdir 00_RAW Copy raw fastq

More information

Tutorial on gene-c ancestry es-ma-on: How to use LASER. Chaolong Wang Sequence Analysis Workshop June University of Michigan

Tutorial on gene-c ancestry es-ma-on: How to use LASER. Chaolong Wang Sequence Analysis Workshop June University of Michigan Tutorial on gene-c ancestry es-ma-on: How to use LASER Chaolong Wang Sequence Analysis Workshop June 2014 @ University of Michigan LASER: Loca-ng Ancestry from SEquence Reads Main func:ons of the so

More information

Cyverse tutorial 1 Logging in to Cyverse and data management. Open an Internet browser window and navigate to the Cyverse discovery environment:

Cyverse tutorial 1 Logging in to Cyverse and data management. Open an Internet browser window and navigate to the Cyverse discovery environment: Cyverse tutorial 1 Logging in to Cyverse and data management Open an Internet browser window and navigate to the Cyverse discovery environment: https://de.cyverse.org/de/ Click Log in with your CyVerse

More information

Handling sam and vcf data, quality control

Handling sam and vcf data, quality control Handling sam and vcf data, quality control We continue with the earlier analyses and get some new data: cd ~/session_3 wget http://wasabiapp.org/vbox/data/session_4/file3.tgz tar xzf file3.tgz wget http://wasabiapp.org/vbox/data/session_4/file4.tgz

More information

The software comes with 2 installers: (1) SureCall installer (2) GenAligners (contains BWA, BWA- MEM).

The software comes with 2 installers: (1) SureCall installer (2) GenAligners (contains BWA, BWA- MEM). Release Notes Agilent SureCall 4.0 Product Number G4980AA SureCall Client 6-month named license supports installation of one client and server (to host the SureCall database) on one machine. For additional

More information

Running SNAP. The SNAP Team October 2012

Running SNAP. The SNAP Team October 2012 Running SNAP The SNAP Team October 2012 1 Introduction SNAP is a tool that is intended to serve as the read aligner in a gene sequencing pipeline. Its theory of operation is described in Faster and More

More information

Decrypting your genome data privately in the cloud

Decrypting your genome data privately in the cloud Decrypting your genome data privately in the cloud Marc Sitges Data Manager@Made of Genes @madeofgenes The Human Genome 3.200 M (x2) Base pairs (bp) ~20.000 genes (~30%) (Exons ~1%) The Human Genome Project

More information

de.nbi and its Galaxy interface for RNA-Seq

de.nbi and its Galaxy interface for RNA-Seq de.nbi and its Galaxy interface for RNA-Seq Jörg Fallmann Thanks to Björn Grüning (RBC-Freiburg) and Sarah Diehl (MPI-Freiburg) Institute for Bioinformatics University of Leipzig http://www.bioinf.uni-leipzig.de/

More information

Quality assessment of NGS data

Quality assessment of NGS data Quality assessment of NGS data Ines de Santiago July 27, 2015 Contents 1 Introduction 1 2 Checking read quality with FASTQC 1 3 Preprocessing with FASTX-Toolkit 2 3.1 Preprocessing with FASTX-Toolkit:

More information

Using the Galaxy Local Bioinformatics Cloud at CARC

Using the Galaxy Local Bioinformatics Cloud at CARC Using the Galaxy Local Bioinformatics Cloud at CARC Lijing Bu Sr. Research Scientist Bioinformatics Specialist Center for Evolutionary and Theoretical Immunology (CETI) Department of Biology, University

More information

Copyright 2014 Regents of the University of Minnesota

Copyright 2014 Regents of the University of Minnesota Quality Control of Illumina Data using Galaxy August 18, 2014 Contents 1 Introduction 2 1.1 What is Galaxy?..................................... 2 1.2 Galaxy at MSI......................................

More information

DNA Sequencing analysis on Artemis

DNA Sequencing analysis on Artemis DNA Sequencing analysis on Artemis Mapping and Variant Calling Tracy Chew Senior Research Bioinformatics Technical Officer Rosemarie Sadsad Informatics Services Lead Hayim Dar Informatics Technical Officer

More information

Using Galaxy for NGS Analyses Luce Skrabanek

Using Galaxy for NGS Analyses Luce Skrabanek Using Galaxy for NGS Analyses Luce Skrabanek Registering for a Galaxy account Before we begin, first create an account on the main public Galaxy portal. Go to: https://main.g2.bx.psu.edu/ Under the User

More information

The software comes with 2 installers: (1) SureCall installer (2) GenAligners (contains BWA, BWA-MEM).

The software comes with 2 installers: (1) SureCall installer (2) GenAligners (contains BWA, BWA-MEM). Release Notes Agilent SureCall 3.5 Product Number G4980AA SureCall Client 6-month named license supports installation of one client and server (to host the SureCall database) on one machine. For additional

More information

Ensembl RNASeq Practical. Overview

Ensembl RNASeq Practical. Overview Ensembl RNASeq Practical The aim of this practical session is to use BWA to align 2 lanes of Zebrafish paired end Illumina RNASeq reads to chromosome 12 of the zebrafish ZV9 assembly. We have restricted

More information

Variation among genomes

Variation among genomes Variation among genomes Comparing genomes The reference genome http://www.ncbi.nlm.nih.gov/nuccore/26556996 Arabidopsis thaliana, a model plant Col-0 variety is from Landsberg, Germany Ler is a mutant

More information

Copyright 2014 Regents of the University of Minnesota

Copyright 2014 Regents of the University of Minnesota Quality Control of Illumina Data using Galaxy Contents September 16, 2014 1 Introduction 2 1.1 What is Galaxy?..................................... 2 1.2 Galaxy at MSI......................................

More information

SAMtools. SAM BAM. mapping. BAM sort & indexing (ex: IGV) SNP call

SAMtools.   SAM BAM. mapping. BAM sort & indexing (ex: IGV) SNP call SAMtools http://samtools.sourceforge.net/ SAM/BAM mapping BAM SAM BAM BAM sort & indexing (ex: IGV) mapping SNP call SAMtools NGS Program: samtools (Tools for alignments in the SAM format) Version: 0.1.19

More information

Importing your Exeter NGS data into Galaxy:

Importing your Exeter NGS data into Galaxy: Importing your Exeter NGS data into Galaxy: The aim of this tutorial is to show you how to import your raw Illumina FASTQ files and/or assemblies and remapping files into Galaxy. As of 1 st July 2011 Illumina

More information

Integrative Genomics Viewer. Prat Thiru

Integrative Genomics Viewer. Prat Thiru Integrative Genomics Viewer Prat Thiru 1 Overview User Interface Basics Browsing the Data Data Formats IGV Tools Demo Outline Based on ISMB 2010 Tutorial by Robinson and Thorvaldsdottir 2 Why IGV? IGV

More information

Contact: Raymond Hovey Genomics Center - SFS

Contact: Raymond Hovey Genomics Center - SFS Bioinformatics Lunch Seminar (Summer 2014) Every other Friday at noon. 20-30 minutes plus discussion Informal, ask questions anytime, start discussions Content will be based on feedback Targeted at broad

More information

CLC Server. End User USER MANUAL

CLC Server. End User USER MANUAL CLC Server End User USER MANUAL Manual for CLC Server 10.0.1 Windows, macos and Linux March 8, 2018 This software is for research purposes only. QIAGEN Aarhus Silkeborgvej 2 Prismet DK-8000 Aarhus C Denmark

More information

NA12878 Platinum Genome GENALICE MAP Analysis Report

NA12878 Platinum Genome GENALICE MAP Analysis Report NA12878 Platinum Genome GENALICE MAP Analysis Report Bas Tolhuis, PhD Jan-Jaap Wesselink, PhD GENALICE B.V. INDEX EXECUTIVE SUMMARY...4 1. MATERIALS & METHODS...5 1.1 SEQUENCE DATA...5 1.2 WORKFLOWS......5

More information

REPORT. NA12878 Platinum Genome. GENALICE MAP Analysis Report. Bas Tolhuis, PhD GENALICE B.V.

REPORT. NA12878 Platinum Genome. GENALICE MAP Analysis Report. Bas Tolhuis, PhD GENALICE B.V. REPORT NA12878 Platinum Genome GENALICE MAP Analysis Report Bas Tolhuis, PhD GENALICE B.V. INDEX EXECUTIVE SUMMARY...4 1. MATERIALS & METHODS...5 1.1 SEQUENCE DATA...5 1.2 WORKFLOWS......5 1.3 ACCURACY

More information

Running SNAP. The SNAP Team February 2012

Running SNAP. The SNAP Team February 2012 Running SNAP The SNAP Team February 2012 1 Introduction SNAP is a tool that is intended to serve as the read aligner in a gene sequencing pipeline. Its theory of operation is described in Faster and More

More information

Installing DNA-Seq Tools for Sequencher

Installing DNA-Seq Tools for Sequencher Installing DNA-Seq Tools for Sequencher 2017 Gene Codes Corporation Gene Codes Corporation 525 Avis Drive, Ann Arbor, MI 48108 USA 1.800.497.4939 (USA) +1.734.769.7249 (elsewhere) +1.734.769.7074 (fax)

More information

ChIP-Seq Tutorial on Galaxy

ChIP-Seq Tutorial on Galaxy 1 Introduction ChIP-Seq Tutorial on Galaxy 2 December 2010 (modified April 6, 2017) Rory Stark The aim of this practical is to give you some experience handling ChIP-Seq data. We will be working with data

More information

Fusion Detection Using QIAseq RNAscan Panels

Fusion Detection Using QIAseq RNAscan Panels Fusion Detection Using QIAseq RNAscan Panels June 11, 2018 Sample to Insight QIAGEN Aarhus Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 www.qiagenbioinformatics.com ts-bioinformatics@qiagen.com

More information

Single/paired-end RNAseq analysis with Galaxy

Single/paired-end RNAseq analysis with Galaxy October 016 Single/paired-end RNAseq analysis with Galaxy Contents: 1. Introduction. Quality control 3. Alignment 4. Normalization and read counts 5. Workflow overview 6. Sample data set to test the paired-end

More information

Accessible, Transparent and Reproducible Analysis with Galaxy

Accessible, Transparent and Reproducible Analysis with Galaxy Accessible, Transparent and Reproducible Analysis with Galaxy Application of Next Generation Sequencing Technologies for Whole Transcriptome and Genome Analysis ABRF 2013 Saturday, March 2, 2013 Palm Springs,

More information

Sequencing Data. Paul Agapow 2011/02/03

Sequencing Data. Paul Agapow 2011/02/03 Webservices for Next Generation Sequencing Data Paul Agapow 2011/02/03 Aims Assumed parameters: Must have a system for non-technical users to browse and manipulate their Next Generation Sequencing (NGS)

More information

Calling variants in diploid or multiploid genomes

Calling variants in diploid or multiploid genomes Calling variants in diploid or multiploid genomes Diploid genomes The initial steps in calling variants for diploid or multi-ploid organisms with NGS data are the same as what we've already seen: 1. 2.

More information

User guide for GEM-TREND

User guide for GEM-TREND User guide for GEM-TREND 1. Requirements for Using GEM-TREND GEM-TREND is implemented as a java applet which can be run in most common browsers and has been test with Internet Explorer 7.0, Internet Explorer

More information

High-throughput sequencing: Alignment and related topic. Simon Anders EMBL Heidelberg

High-throughput sequencing: Alignment and related topic. Simon Anders EMBL Heidelberg High-throughput sequencing: Alignment and related topic Simon Anders EMBL Heidelberg Established platforms HTS Platforms Illumina HiSeq, ABI SOLiD, Roche 454 Newcomers: Benchtop machines 454 GS Junior,

More information

David Crossman, Ph.D. UAB Heflin Center for Genomic Science. GCC2012 Wednesday, July 25, 2012

David Crossman, Ph.D. UAB Heflin Center for Genomic Science. GCC2012 Wednesday, July 25, 2012 David Crossman, Ph.D. UAB Heflin Center for Genomic Science GCC2012 Wednesday, July 25, 2012 Galaxy Splash Page Colors Random Galaxy icons/colors Queued Running Completed Download/Save Failed Icons Display

More information

Bioinformatics in next generation sequencing projects

Bioinformatics in next generation sequencing projects Bioinformatics in next generation sequencing projects Rickard Sandberg Assistant Professor Department of Cell and Molecular Biology Karolinska Institutet March 2011 Once sequenced the problem becomes computational

More information

Release Notes. Version Gene Codes Corporation

Release Notes. Version Gene Codes Corporation Version 4.10.1 Release Notes 2010 Gene Codes Corporation Gene Codes Corporation 775 Technology Drive, Ann Arbor, MI 48108 USA 1.800.497.4939 (USA) +1.734.769.7249 (elsewhere) +1.734.769.7074 (fax) www.genecodes.com

More information

Genomes On The Cloud GotCloud. University of Michigan Center for Statistical Genetics Mary Kate Wing Goo Jun

Genomes On The Cloud GotCloud. University of Michigan Center for Statistical Genetics Mary Kate Wing Goo Jun Genomes On The Cloud GotCloud University of Michigan Center for Statistical Genetics Mary Kate Wing Goo Jun Friday, March 8, 2013 Why GotCloud? Connects sequence analysis tools together Alignment, quality

More information

Course Outline Repository Guide

Course Outline Repository Guide Contents... 1 How do I access the Course Outline Repository?... 1 How do I use the Course Outline Repository?... 2 How do I search the Course Repository?... 2 Where do I download the course outline?...

More information

1. PURPOSE: to describe a standardized procedure for Illumina MiSeq data quality control (QC) before upload to PulseNet Central

1. PURPOSE: to describe a standardized procedure for Illumina MiSeq data quality control (QC) before upload to PulseNet Central 1. PURPOSE: to describe a standardized procedure for Illumina MiSeq data quality control (QC) before upload to PulseNet Central 2. SCOPE: This procedure applies to all clinical isolates that are whole

More information

How to Download and Re-upload a PDF File in WCMS

How to Download and Re-upload a PDF File in WCMS How to Download and Re-upload a PDF File in WCMS Login to WCMS. Click on the folder icon to expand it. (Icon is the left of the folder name). Select the folder that contains the file. Select the document

More information

Using Galaxy-P Documentation

Using Galaxy-P Documentation Using Galaxy-P Documentation Release 0.1 John Chilton, Pratik Jagtap October 26, 2015 Contents 1 Introduction 1 2 Galaxy-P 101 - Building Up and Using a Proteomics Workflow 3 2.1 What Are We Trying to

More information

INF-BIO5121/ Oct 7, Analyzing mirna data using Lifeportal PRACTICALS

INF-BIO5121/ Oct 7, Analyzing mirna data using Lifeportal PRACTICALS INF-BIO5121/9121 - Oct 7, 2014 Analyzing mirna data using Lifeportal PRACTICALS In this experiment we have mirna data from the livers of baboons (Papio Hamadryas) before and after they are given a high

More information

Supplementary Information. Detecting and annotating genetic variations using the HugeSeq pipeline

Supplementary Information. Detecting and annotating genetic variations using the HugeSeq pipeline Supplementary Information Detecting and annotating genetic variations using the HugeSeq pipeline Hugo Y. K. Lam 1,#, Cuiping Pan 1, Michael J. Clark 1, Phil Lacroute 1, Rui Chen 1, Rajini Haraksingh 1,

More information

High-throughput sequencing: Alignment and related topic. Simon Anders EMBL Heidelberg

High-throughput sequencing: Alignment and related topic. Simon Anders EMBL Heidelberg High-throughput sequencing: Alignment and related topic Simon Anders EMBL Heidelberg Established platforms HTS Platforms Illumina HiSeq, ABI SOLiD, Roche 454 Newcomers: Benchtop machines: Illumina MiSeq,

More information

Next Generation Sequence Alignment on the BRC Cluster. Steve Newhouse 22 July 2010

Next Generation Sequence Alignment on the BRC Cluster. Steve Newhouse 22 July 2010 Next Generation Sequence Alignment on the BRC Cluster Steve Newhouse 22 July 2010 Overview Practical guide to processing next generation sequencing data on the cluster No details on the inner workings

More information

Tutorial: De Novo Assembly of Paired Data

Tutorial: De Novo Assembly of Paired Data : De Novo Assembly of Paired Data September 20, 2013 CLC bio Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 Fax: +45 86 20 12 22 www.clcbio.com support@clcbio.com : De Novo Assembly

More information

MetaStorm: User Manual

MetaStorm: User Manual MetaStorm: User Manual User Account: First, either log in as a guest or login to your user account. If you login as a guest, you can visualize public MetaStorm projects, but can not run any analysis. To

More information

Introduction to Read Alignment. UCD Genome Center Bioinformatics Core Tuesday 15 September 2015

Introduction to Read Alignment. UCD Genome Center Bioinformatics Core Tuesday 15 September 2015 Introduction to Read Alignment UCD Genome Center Bioinformatics Core Tuesday 15 September 2015 From reads to molecules Why align? Individual A Individual B ATGATAGCATCGTCGGGTGTCTGCTCAATAATAGTGCCGTATCATGCTGGTGTTATAATCGCCGCATGACATGATCAATGG

More information

NGS FASTQ file format

NGS FASTQ file format NGS FASTQ file format Line1: Begins with @ and followed by a sequence idenefier and opeonal descripeon Line2: Raw sequence leiers Line3: + Line4: Encodes the quality values for the sequence in Line2 (see

More information

Exercise 2: Browser-Based Annotation and RNA-Seq Data

Exercise 2: Browser-Based Annotation and RNA-Seq Data Exercise 2: Browser-Based Annotation and RNA-Seq Data Jeremy Buhler July 24, 2018 This exercise continues your introduction to practical issues in comparative annotation. You ll be annotating genomic sequence

More information

Resequencing Analysis. (Pseudomonas aeruginosa MAPO1 ) Sample to Insight

Resequencing Analysis. (Pseudomonas aeruginosa MAPO1 ) Sample to Insight Resequencing Analysis (Pseudomonas aeruginosa MAPO1 ) 1 Workflow Import NGS raw data Trim reads Import Reference Sequence Reference Mapping QC on reads Variant detection Case Study Pseudomonas aeruginosa

More information

Tutorial: How to use the Wheat TILLING database

Tutorial: How to use the Wheat TILLING database Tutorial: How to use the Wheat TILLING database Last Updated: 9/7/16 1. Visit http://dubcovskylab.ucdavis.edu/wheat_blast to go to the BLAST page or click on the Wheat BLAST button on the homepage. 2.

More information

Tutorial. Find Very Low Frequency Variants With QIAGEN GeneRead Panels. Sample to Insight. November 21, 2017

Tutorial. Find Very Low Frequency Variants With QIAGEN GeneRead Panels. Sample to Insight. November 21, 2017 Find Very Low Frequency Variants With QIAGEN GeneRead Panels November 21, 2017 Sample to Insight QIAGEN Aarhus Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 www.qiagenbioinformatics.com

More information

TOTAL CONTROL SECURITY END USER GUIDE

TOTAL CONTROL  SECURITY END USER GUIDE TOTAL CONTROL EMAIL SECURITY END USER GUIDE Welcome to the Total Control email security solution, which protects you against spam, viruses, phishing exploits, and other email-borne threats. In this guide,

More information

PRACTICAL SESSION 8 SEQUENCE-BASED ASSOCIATION, INTERPRETATION, VISUALIZATION USING EPACTS JAN 7 TH, 2014 STOM 2014 WORKSHOP

PRACTICAL SESSION 8 SEQUENCE-BASED ASSOCIATION, INTERPRETATION, VISUALIZATION USING EPACTS JAN 7 TH, 2014 STOM 2014 WORKSHOP PRACTICAL SESSION 8 SEQUENCE-BASED ASSOCIATION, INTERPRETATION, VISUALIZATION USING EPACTS JAN 7 TH, 2014 STOM 2014 WORKSHOP HYUN MIN KANG UNIVERSITY OF MICHIGAN, ANN ARBOR EPACTS ASSOCIATION ANALYSIS

More information

Tutorial: RNA-Seq Analysis Part II (Tracks): Non-Specific Matches, Mapping Modes and Expression measures

Tutorial: RNA-Seq Analysis Part II (Tracks): Non-Specific Matches, Mapping Modes and Expression measures : RNA-Seq Analysis Part II (Tracks): Non-Specific Matches, Mapping Modes and February 24, 2014 Sample to Insight : RNA-Seq Analysis Part II (Tracks): Non-Specific Matches, Mapping Modes and : RNA-Seq Analysis

More information

SELF COACHING SCHOLARS TECH FAQ

SELF COACHING SCHOLARS TECH FAQ SELF COACHING SCHOLARS TECH FAQ TABLE OF CONTENTS LOG IN TO THE MEMBERSHIP SITE 2 FORGOT PASSWORD 2 CALL SCHEDULE AND ZOOM INFORMATION 3 BEING COACHED LIVE ON A CALL 6 LIVE CALL RECORDINGS 7 HOW TO LISTEN

More information

Protocol: peak-calling for ChIP-seq data / segmentation analysis for histone modification data

Protocol: peak-calling for ChIP-seq data / segmentation analysis for histone modification data Protocol: peak-calling for ChIP-seq data / segmentation analysis for histone modification data Table of Contents Protocol: peak-calling for ChIP-seq data / segmentation analysis for histone modification

More information

AgroMarker Finder manual (1.1)

AgroMarker Finder manual (1.1) AgroMarker Finder manual (1.1) 1. Introduction 2. Installation 3. How to run? 4. How to use? 5. Java program for calculating of restriction enzyme sites (TaqαI). 1. Introduction AgroMarker Finder (AMF)is

More information

TP RNA-seq : Differential expression analysis

TP RNA-seq : Differential expression analysis TP RNA-seq : Differential expression analysis Overview of RNA-seq analysis Fusion transcripts detection Differential expresssion Gene level RNA-seq Transcript level Transcripts and isoforms detection 2

More information

NGS Data Analysis. Roberto Preste

NGS Data Analysis. Roberto Preste NGS Data Analysis Roberto Preste 1 Useful info http://bit.ly/2r1y2dr Contacts: roberto.preste@gmail.com Slides: http://bit.ly/ngs-data 2 NGS data analysis Overview 3 NGS Data Analysis: the basic idea http://bit.ly/2r1y2dr

More information

Lab 8: Using POY from your desktop and through CIPRES

Lab 8: Using POY from your desktop and through CIPRES Integrative Biology 200A University of California, Berkeley PRINCIPLES OF PHYLOGENETICS Spring 2012 Updated by Michael Landis Lab 8: Using POY from your desktop and through CIPRES In this lab we re going

More information

Welcome to Liscio Pro Setup & Tutorial

Welcome to Liscio Pro Setup & Tutorial Welcome to Liscio Pro Setup & Tutorial Welcome to secure sharing. To set up your new account and familiarize yourself with how Liscio works, simply follow our step-by-step walkthrough. Invite to Liscio

More information

Mapping and Viewing Deep Sequencing Data bowtie2, samtools, igv

Mapping and Viewing Deep Sequencing Data bowtie2, samtools, igv Mapping and Viewing Deep Sequencing Data bowtie2, samtools, igv Frederick J Tan Bioinformatics Research Faculty Carnegie Institution of Washington, Department of Embryology tan@ciwemb.edu 27 August 2013

More information

Introduction to Galaxy

Introduction to Galaxy Introduction to Galaxy Dr Jason Wong Prince of Wales Clinical School Introductory bioinformatics for human genomics workshop, UNSW Day 1 Thurs 28 th January 2016 Overview What is Galaxy? Description of

More information

Annotating sequences in batch

Annotating sequences in batch BioNumerics Tutorial: Annotating sequences in batch 1 Aim The annotation application in BioNumerics has been designed for the annotation of coding regions on sequences. In this tutorial you will learn

More information

An Introduction to Linux and Bowtie

An Introduction to Linux and Bowtie An Introduction to Linux and Bowtie Cavan Reilly November 10, 2017 Table of contents Introduction to UNIX-like operating systems Installing programs Bowtie SAMtools Introduction to Linux In order to use

More information

A short Introduction to UCSC Genome Browser

A short Introduction to UCSC Genome Browser A short Introduction to UCSC Genome Browser Elodie Girard, Nicolas Servant Institut Curie/INSERM U900 Bioinformatics, Biostatistics, Epidemiology and computational Systems Biology of Cancer 1 Why using

More information

Mapping RNA sequence data (Part 1: using pathogen portal s RNAseq pipeline) Exercise 6

Mapping RNA sequence data (Part 1: using pathogen portal s RNAseq pipeline) Exercise 6 Mapping RNA sequence data (Part 1: using pathogen portal s RNAseq pipeline) Exercise 6 The goal of this exercise is to retrieve an RNA-seq dataset in FASTQ format and run it through an RNA-sequence analysis

More information

Analyzing Variant Call results using EuPathDB Galaxy, Part II

Analyzing Variant Call results using EuPathDB Galaxy, Part II Analyzing Variant Call results using EuPathDB Galaxy, Part II In this exercise, we will work in groups to examine the results from the SNP analysis workflow that we started yesterday. The first step is

More information

RNA-seq. Manpreet S. Katari

RNA-seq. Manpreet S. Katari RNA-seq Manpreet S. Katari Evolution of Sequence Technology Normalizing the Data RPKM (Reads per Kilobase of exons per million reads) Score = R NT R = # of unique reads for the gene N = Size of the gene

More information

Sequence Mapping and Assembly

Sequence Mapping and Assembly Practical Introduction Sequence Mapping and Assembly December 8, 2014 Mary Kate Wing University of Michigan Center for Statistical Genetics Goals of This Session Learn basics of sequence data file formats

More information

ChIP-seq practical: peak detection and peak annotation. Mali Salmon-Divon Remco Loos Myrto Kostadima

ChIP-seq practical: peak detection and peak annotation. Mali Salmon-Divon Remco Loos Myrto Kostadima ChIP-seq practical: peak detection and peak annotation Mali Salmon-Divon Remco Loos Myrto Kostadima March 2012 Introduction The goal of this hands-on session is to perform some basic tasks in the analysis

More information

Genome Browsers - The UCSC Genome Browser

Genome Browsers - The UCSC Genome Browser Genome Browsers - The UCSC Genome Browser Background The UCSC Genome Browser is a well-curated site that provides users with a view of gene or sequence information in genomic context for a specific species,

More information

INTRODUCTION AUX FORMATS DE FICHIERS

INTRODUCTION AUX FORMATS DE FICHIERS INTRODUCTION AUX FORMATS DE FICHIERS Plan. Formats de séquences brutes.. Format fasta.2. Format fastq 2. Formats d alignements 2.. Format SAM 2.2. Format BAM 4. Format «Variant Calling» 4.. Format Varscan

More information

Tutorial for Windows and Macintosh. De Novo Sequence Assembly with Velvet

Tutorial for Windows and Macintosh. De Novo Sequence Assembly with Velvet Tutorial for Windows and Macintosh De Novo Sequence Assembly with Velvet 2017 Gene Codes Corporation Gene Codes Corporation 525 Avis Drive, Ann Arbor, MI 48108 USA 1.800.497.4939 (USA) +1.734.769.7249

More information

Exercise 1. RNA-seq alignment and quantification. Part 1. Prepare the working directory. Part 2. Examine qualities of the RNA-seq data files

Exercise 1. RNA-seq alignment and quantification. Part 1. Prepare the working directory. Part 2. Examine qualities of the RNA-seq data files Exercise 1. RNA-seq alignment and quantification Part 1. Prepare the working directory. 1. Connect to your assigned computer. If you do not know how, follow the instruction at http://cbsu.tc.cornell.edu/lab/doc/remote_access.pdf

More information

Introduction to Galaxy

Introduction to Galaxy Introduction to Galaxy Saint Louis University St. Louis, Missouri April 30, 2013 Dave Clements, Emory University http://galaxyproject.org/ Agenda 9:00 Welcome 9:20 Basic Analysis with Galaxy 10:30 Basic

More information

Tutorial: chloroplast genomes

Tutorial: chloroplast genomes Tutorial: chloroplast genomes Stacia Wyman Department of Computer Sciences Williams College Williamstown, MA 01267 March 10, 2005 ASSUMPTIONS: You are using Internet Explorer under OS X on the Mac. You

More information