Genome 373: Mapping Short Sequence Reads III. Doug Fowler
|
|
- Brett Washington
- 5 years ago
- Views:
Transcription
1 Genome 373: Mapping Short Sequence Reads III Doug Fowler
2 What is Galaxy? Galaxy is a free, open source web platform for running all sorts of computational analyses including pretty much all of the sequencing-related stuff we ve discussed! You can use it at usegalaxy.org
3 The Data We ll Be Playing With This is a FASTA file, which contains one sequence. This sequence, which corresponds to just one gene (MYC) will be our reference
4 The Data We ll Be Playing With
5 The Data We ll Be Playing With This is a FASTQ file, which is a standard high-throughput sequencing format. This file contains ~20,000 high-throughput sequencing reads which we will align to the MYC locus
6 The FASTQ format Why might we want to store Q scores as ASCII characters rather than numbers?
7
8 Short read mapping Go to User -> Register and register, if you haven t already if you have, login
9 Short read mapping Load data using the load your own data link
10 Short read mapping Upload MYClocus.fa (type = fasta) and cas9.fq (type = fastqsanger). Make sure to set the file type correctly, then click start
11 Short read mapping The files should appear in the history section on the right
12 First, let s do a quality analysis by clicking NGS: QC and manipulation and then FastQC
13 We see information and parameters for the FastQC tool make sure cas9.fq is selected and hit execute
14 We see that the job has been started and will produce two files, a RawData file and a webpage
15 Jobs are gray when waiting, yellow when running and green when done
16 You can click on the eye button to look at the data or the job name for more information
17 Once the FastQC job is done, click on the eye button for the Webpage output file to see the quality report looks pretty good!
18 Explore these results the first plot shows Q scores along the read
19 Next, let s align our reads (the.fq file) to our reference sequence (the.fa file) by clicking NGS: Mapping -> BWA-MEM
20 We need to tell BWA-MEM to use the MYClocus.fa reference by changing the load reference genome from local cache to history
21 We need to tell BWA-MEM to use only single read data (we don t have paired end reads) by changing to Single
22 Then, execute the alignment
23 Once the alignment is done, click the Visualize in Trackster button
24 We ll need to tell Galaxy we want to use our custom MYClocus.fa reference sequence so click Add a Custom Build
25 Name the custom build, add a key name and make sure the right file (MYClocus.fa) is selected then hit submit
26 Click the Back button on the browser to get back to the main Galaxy view and click on Visualize in Trackster again
27 This time, your MYClocus custom reference will be available select it and click create then wait while the visualization is prepared
28 Now you can see the read pileup from our alignment! Try zooming, clicking and dragging, etc
29 You can also play with the display mode to see the data in different ways
30 Save the visualization
31 Click the Analyze Data link to go back to the main Galaxy page
32 Now, lets call variants from our pileup using the Mpileup tool in NGS: SAMtools
33 We need to change one parameter for Mpileup. Select Perform INDEL calling and set advanced options and then enter 100,000 in the Skip INDEL calling if the average per-sample depth is above box. Then, execute Mpileup
34 You might be wondering why we would expect to see any variants in this sequencing data It s because we used a nuclease called Cas9 to cut the genome at the MYC locus
35 When these cuts are repaired, small insertions and deletions are created at the cut site. This is what we will be looking for in our pileup
36 Once our Mpileup job has finished, we can look at the results. Click on Visualization -> Saved Visualizations
37 Now, click on the visualization of the MYC locus read pileup we saved earlier
38 To add the results of Mpileup to the existing visualization as a new track, click the Add tracks button
39 Click the Histories -> Unnamed history button and select the Mpileup data. Note that you may need to click Data Libraries first and then back to Histories, as this was a bug that happened when I tried
40 When the visualization is finished, you can see the indel density by clicking Set display mode -> Coverage. You can see that the Cas9 treatment did, indeed, induce indels!
41 If you get done with this small tutorial with time to spare, consider playing with some of the data you can access through Shared Data
Helpful Galaxy screencasts are available at:
This user guide serves as a simplified, graphic version of the CloudMap paper for applicationoriented end-users. For more details, please see the CloudMap paper. Video versions of these user guides and
More informationNGS : reads quality control
NGS : reads quality control Data used in this tutorials are available on https:/urgi.versailles.inra.fr/download/tuto/ngs-readsquality-control. Select genome solexa.fasta, illumina.fastq, solexa.fastq
More informationChIP-seq hands-on practical using Galaxy
ChIP-seq hands-on practical using Galaxy In this exercise we will cover some of the basic NGS analysis steps for ChIP-seq using the Galaxy framework: Quality control Mapping of reads using Bowtie2 Peak-calling
More informationWelcome to MAPHiTS (Mapping Analysis Pipeline for High-Throughput Sequences) tutorial page.
Welcome to MAPHiTS (Mapping Analysis Pipeline for High-Throughput Sequences) tutorial page. In this page you will learn to use the tools of the MAPHiTS suite. A little advice before starting : rename your
More informationChIP-seq hands-on practical using Galaxy
ChIP-seq hands-on practical using Galaxy In this exercise we will cover some of the basic NGS analysis steps for ChIP-seq using the Galaxy framework: Quality control Mapping of reads using Bowtie2 Peak-calling
More informationNGS Analysis Using Galaxy
NGS Analysis Using Galaxy Sequences and Alignment Format Galaxy overview and Interface Get;ng Data in Galaxy Analyzing Data in Galaxy Quality Control Mapping Data History and workflow Galaxy Exercises
More informationNGS Data Visualization and Exploration Using IGV
1 What is Galaxy Galaxy for Bioinformaticians Galaxy for Experimental Biologists Using Galaxy for NGS Analysis NGS Data Visualization and Exploration Using IGV 2 What is Galaxy Galaxy for Bioinformaticians
More informationBGGN-213: FOUNDATIONS OF BIOINFORMATICS (Lecture 14)
BGGN-213: FOUNDATIONS OF BIOINFORMATICS (Lecture 14) Genome Informatics (Part 1) https://bioboot.github.io/bggn213_f17/lectures/#14 Dr. Barry Grant Nov 2017 Overview: The purpose of this lab session is
More informationCopy Number Variations Detection - TD. Using Sequenza under Galaxy
Copy Number Variations Detection - TD Using Sequenza under Galaxy I. Data loading We will analyze the copy number variations of a human tumor (parotid gland carcinoma), limited to the chr17, from a WES
More informationGalaxy Platform For NGS Data Analyses
Galaxy Platform For NGS Data Analyses Weihong Yan wyan@chem.ucla.edu Collaboratory Web Site http://qcb.ucla.edu/collaboratory Collaboratory Workshops Workshop Outline ü Day 1 UCLA galaxy and user account
More informationRNA-Seq in Galaxy: Tuxedo protocol. Igor Makunin, UQ RCC, QCIF
RNA-Seq in Galaxy: Tuxedo protocol Igor Makunin, UQ RCC, QCIF Acknowledgments Genomics Virtual Lab: gvl.org.au Galaxy for tutorials: galaxy-tut.genome.edu.au Galaxy Australia: galaxy-aust.genome.edu.au
More informationVariant calling using SAMtools
Variant calling using SAMtools Calling variants - a trivial use of an Interactive Session We are going to conduct the variant calling exercises in an interactive idev session just so you can get a feel
More informationAnalyzing ChIP- Seq Data in Galaxy
Analyzing ChIP- Seq Data in Galaxy Lauren Mills RISS ABSTRACT Step- by- step guide to basic ChIP- Seq analysis using the Galaxy platform. Table of Contents Introduction... 3 Links to helpful information...
More informationGalaxy workshop at the Winter School Igor Makunin
Galaxy workshop at the Winter School 2016 Igor Makunin i.makunin@uq.edu.au Winter school, UQ, July 6, 2016 Plan Overview of the Genomics Virtual Lab Introduce Galaxy, a web based platform for analysis
More informationPreparation of alignments for variant calling with GATK: exercise instructions for BioHPC Lab computers
Preparation of alignments for variant calling with GATK: exercise instructions for BioHPC Lab computers Data used in the exercise We will use D. melanogaster WGS paired-end Illumina data with NCBI accessions
More informationDr. Gabriela Salinas Dr. Orr Shomroni Kaamini Rhaithata
Analysis of RNA sequencing data sets using the Galaxy environment Dr. Gabriela Salinas Dr. Orr Shomroni Kaamini Rhaithata Microarray and Deep-sequencing core facility 30.10.2017 RNA-seq workflow I Hypothesis
More information1. Download the data from ENA and QC it:
GenePool-External : Genome Assembly tutorial for NGS workshop 20121016 This page last changed on Oct 11, 2012 by tcezard. This is a whole genome sequencing of a E. coli from the 2011 German outbreak You
More informationNGS Analyses with Galaxy
1 NGS Analyses with Galaxy Introduction Every living organism on our planet possesses a genome that is composed of one or several DNA (deoxyribonucleotide acid) molecules determining the way the organism
More informationITMO Ecole de Bioinformatique Hands-on session: smallrna-seq N. Servant 21 rd November 2013
ITMO Ecole de Bioinformatique Hands-on session: smallrna-seq N. Servant 21 rd November 2013 1. Data and objectives We will use the data from GEO (GSE35368, Toedling, Servant et al. 2011). Two samples were
More informationColorado State University Bioinformatics Algorithms Assignment 6: Analysis of High- Throughput Biological Data Hamidreza Chitsaz, Ali Sharifi- Zarchi
Colorado State University Bioinformatics Algorithms Assignment 6: Analysis of High- Throughput Biological Data Hamidreza Chitsaz, Ali Sharifi- Zarchi Although a little- bit long, this is an easy exercise
More informationWM2 Bioinformatics. ExomeSeq data analysis part 1. Dietmar Rieder
WM2 Bioinformatics ExomeSeq data analysis part 1 Dietmar Rieder RAW data Use putty to logon to cluster.i med.ac.at In your home directory make directory to store raw data $ mkdir 00_RAW Copy raw fastq
More informationTutorial on gene-c ancestry es-ma-on: How to use LASER. Chaolong Wang Sequence Analysis Workshop June University of Michigan
Tutorial on gene-c ancestry es-ma-on: How to use LASER Chaolong Wang Sequence Analysis Workshop June 2014 @ University of Michigan LASER: Loca-ng Ancestry from SEquence Reads Main func:ons of the so
More informationCyverse tutorial 1 Logging in to Cyverse and data management. Open an Internet browser window and navigate to the Cyverse discovery environment:
Cyverse tutorial 1 Logging in to Cyverse and data management Open an Internet browser window and navigate to the Cyverse discovery environment: https://de.cyverse.org/de/ Click Log in with your CyVerse
More informationHandling sam and vcf data, quality control
Handling sam and vcf data, quality control We continue with the earlier analyses and get some new data: cd ~/session_3 wget http://wasabiapp.org/vbox/data/session_4/file3.tgz tar xzf file3.tgz wget http://wasabiapp.org/vbox/data/session_4/file4.tgz
More informationThe software comes with 2 installers: (1) SureCall installer (2) GenAligners (contains BWA, BWA- MEM).
Release Notes Agilent SureCall 4.0 Product Number G4980AA SureCall Client 6-month named license supports installation of one client and server (to host the SureCall database) on one machine. For additional
More informationRunning SNAP. The SNAP Team October 2012
Running SNAP The SNAP Team October 2012 1 Introduction SNAP is a tool that is intended to serve as the read aligner in a gene sequencing pipeline. Its theory of operation is described in Faster and More
More informationDecrypting your genome data privately in the cloud
Decrypting your genome data privately in the cloud Marc Sitges Data Manager@Made of Genes @madeofgenes The Human Genome 3.200 M (x2) Base pairs (bp) ~20.000 genes (~30%) (Exons ~1%) The Human Genome Project
More informationde.nbi and its Galaxy interface for RNA-Seq
de.nbi and its Galaxy interface for RNA-Seq Jörg Fallmann Thanks to Björn Grüning (RBC-Freiburg) and Sarah Diehl (MPI-Freiburg) Institute for Bioinformatics University of Leipzig http://www.bioinf.uni-leipzig.de/
More informationQuality assessment of NGS data
Quality assessment of NGS data Ines de Santiago July 27, 2015 Contents 1 Introduction 1 2 Checking read quality with FASTQC 1 3 Preprocessing with FASTX-Toolkit 2 3.1 Preprocessing with FASTX-Toolkit:
More informationUsing the Galaxy Local Bioinformatics Cloud at CARC
Using the Galaxy Local Bioinformatics Cloud at CARC Lijing Bu Sr. Research Scientist Bioinformatics Specialist Center for Evolutionary and Theoretical Immunology (CETI) Department of Biology, University
More informationCopyright 2014 Regents of the University of Minnesota
Quality Control of Illumina Data using Galaxy August 18, 2014 Contents 1 Introduction 2 1.1 What is Galaxy?..................................... 2 1.2 Galaxy at MSI......................................
More informationDNA Sequencing analysis on Artemis
DNA Sequencing analysis on Artemis Mapping and Variant Calling Tracy Chew Senior Research Bioinformatics Technical Officer Rosemarie Sadsad Informatics Services Lead Hayim Dar Informatics Technical Officer
More informationUsing Galaxy for NGS Analyses Luce Skrabanek
Using Galaxy for NGS Analyses Luce Skrabanek Registering for a Galaxy account Before we begin, first create an account on the main public Galaxy portal. Go to: https://main.g2.bx.psu.edu/ Under the User
More informationThe software comes with 2 installers: (1) SureCall installer (2) GenAligners (contains BWA, BWA-MEM).
Release Notes Agilent SureCall 3.5 Product Number G4980AA SureCall Client 6-month named license supports installation of one client and server (to host the SureCall database) on one machine. For additional
More informationEnsembl RNASeq Practical. Overview
Ensembl RNASeq Practical The aim of this practical session is to use BWA to align 2 lanes of Zebrafish paired end Illumina RNASeq reads to chromosome 12 of the zebrafish ZV9 assembly. We have restricted
More informationVariation among genomes
Variation among genomes Comparing genomes The reference genome http://www.ncbi.nlm.nih.gov/nuccore/26556996 Arabidopsis thaliana, a model plant Col-0 variety is from Landsberg, Germany Ler is a mutant
More informationCopyright 2014 Regents of the University of Minnesota
Quality Control of Illumina Data using Galaxy Contents September 16, 2014 1 Introduction 2 1.1 What is Galaxy?..................................... 2 1.2 Galaxy at MSI......................................
More informationSAMtools. SAM BAM. mapping. BAM sort & indexing (ex: IGV) SNP call
SAMtools http://samtools.sourceforge.net/ SAM/BAM mapping BAM SAM BAM BAM sort & indexing (ex: IGV) mapping SNP call SAMtools NGS Program: samtools (Tools for alignments in the SAM format) Version: 0.1.19
More informationImporting your Exeter NGS data into Galaxy:
Importing your Exeter NGS data into Galaxy: The aim of this tutorial is to show you how to import your raw Illumina FASTQ files and/or assemblies and remapping files into Galaxy. As of 1 st July 2011 Illumina
More informationIntegrative Genomics Viewer. Prat Thiru
Integrative Genomics Viewer Prat Thiru 1 Overview User Interface Basics Browsing the Data Data Formats IGV Tools Demo Outline Based on ISMB 2010 Tutorial by Robinson and Thorvaldsdottir 2 Why IGV? IGV
More informationContact: Raymond Hovey Genomics Center - SFS
Bioinformatics Lunch Seminar (Summer 2014) Every other Friday at noon. 20-30 minutes plus discussion Informal, ask questions anytime, start discussions Content will be based on feedback Targeted at broad
More informationCLC Server. End User USER MANUAL
CLC Server End User USER MANUAL Manual for CLC Server 10.0.1 Windows, macos and Linux March 8, 2018 This software is for research purposes only. QIAGEN Aarhus Silkeborgvej 2 Prismet DK-8000 Aarhus C Denmark
More informationNA12878 Platinum Genome GENALICE MAP Analysis Report
NA12878 Platinum Genome GENALICE MAP Analysis Report Bas Tolhuis, PhD Jan-Jaap Wesselink, PhD GENALICE B.V. INDEX EXECUTIVE SUMMARY...4 1. MATERIALS & METHODS...5 1.1 SEQUENCE DATA...5 1.2 WORKFLOWS......5
More informationREPORT. NA12878 Platinum Genome. GENALICE MAP Analysis Report. Bas Tolhuis, PhD GENALICE B.V.
REPORT NA12878 Platinum Genome GENALICE MAP Analysis Report Bas Tolhuis, PhD GENALICE B.V. INDEX EXECUTIVE SUMMARY...4 1. MATERIALS & METHODS...5 1.1 SEQUENCE DATA...5 1.2 WORKFLOWS......5 1.3 ACCURACY
More informationRunning SNAP. The SNAP Team February 2012
Running SNAP The SNAP Team February 2012 1 Introduction SNAP is a tool that is intended to serve as the read aligner in a gene sequencing pipeline. Its theory of operation is described in Faster and More
More informationInstalling DNA-Seq Tools for Sequencher
Installing DNA-Seq Tools for Sequencher 2017 Gene Codes Corporation Gene Codes Corporation 525 Avis Drive, Ann Arbor, MI 48108 USA 1.800.497.4939 (USA) +1.734.769.7249 (elsewhere) +1.734.769.7074 (fax)
More informationChIP-Seq Tutorial on Galaxy
1 Introduction ChIP-Seq Tutorial on Galaxy 2 December 2010 (modified April 6, 2017) Rory Stark The aim of this practical is to give you some experience handling ChIP-Seq data. We will be working with data
More informationFusion Detection Using QIAseq RNAscan Panels
Fusion Detection Using QIAseq RNAscan Panels June 11, 2018 Sample to Insight QIAGEN Aarhus Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 www.qiagenbioinformatics.com ts-bioinformatics@qiagen.com
More informationSingle/paired-end RNAseq analysis with Galaxy
October 016 Single/paired-end RNAseq analysis with Galaxy Contents: 1. Introduction. Quality control 3. Alignment 4. Normalization and read counts 5. Workflow overview 6. Sample data set to test the paired-end
More informationAccessible, Transparent and Reproducible Analysis with Galaxy
Accessible, Transparent and Reproducible Analysis with Galaxy Application of Next Generation Sequencing Technologies for Whole Transcriptome and Genome Analysis ABRF 2013 Saturday, March 2, 2013 Palm Springs,
More informationSequencing Data. Paul Agapow 2011/02/03
Webservices for Next Generation Sequencing Data Paul Agapow 2011/02/03 Aims Assumed parameters: Must have a system for non-technical users to browse and manipulate their Next Generation Sequencing (NGS)
More informationCalling variants in diploid or multiploid genomes
Calling variants in diploid or multiploid genomes Diploid genomes The initial steps in calling variants for diploid or multi-ploid organisms with NGS data are the same as what we've already seen: 1. 2.
More informationUser guide for GEM-TREND
User guide for GEM-TREND 1. Requirements for Using GEM-TREND GEM-TREND is implemented as a java applet which can be run in most common browsers and has been test with Internet Explorer 7.0, Internet Explorer
More informationHigh-throughput sequencing: Alignment and related topic. Simon Anders EMBL Heidelberg
High-throughput sequencing: Alignment and related topic Simon Anders EMBL Heidelberg Established platforms HTS Platforms Illumina HiSeq, ABI SOLiD, Roche 454 Newcomers: Benchtop machines 454 GS Junior,
More informationDavid Crossman, Ph.D. UAB Heflin Center for Genomic Science. GCC2012 Wednesday, July 25, 2012
David Crossman, Ph.D. UAB Heflin Center for Genomic Science GCC2012 Wednesday, July 25, 2012 Galaxy Splash Page Colors Random Galaxy icons/colors Queued Running Completed Download/Save Failed Icons Display
More informationBioinformatics in next generation sequencing projects
Bioinformatics in next generation sequencing projects Rickard Sandberg Assistant Professor Department of Cell and Molecular Biology Karolinska Institutet March 2011 Once sequenced the problem becomes computational
More informationRelease Notes. Version Gene Codes Corporation
Version 4.10.1 Release Notes 2010 Gene Codes Corporation Gene Codes Corporation 775 Technology Drive, Ann Arbor, MI 48108 USA 1.800.497.4939 (USA) +1.734.769.7249 (elsewhere) +1.734.769.7074 (fax) www.genecodes.com
More informationGenomes On The Cloud GotCloud. University of Michigan Center for Statistical Genetics Mary Kate Wing Goo Jun
Genomes On The Cloud GotCloud University of Michigan Center for Statistical Genetics Mary Kate Wing Goo Jun Friday, March 8, 2013 Why GotCloud? Connects sequence analysis tools together Alignment, quality
More informationCourse Outline Repository Guide
Contents... 1 How do I access the Course Outline Repository?... 1 How do I use the Course Outline Repository?... 2 How do I search the Course Repository?... 2 Where do I download the course outline?...
More information1. PURPOSE: to describe a standardized procedure for Illumina MiSeq data quality control (QC) before upload to PulseNet Central
1. PURPOSE: to describe a standardized procedure for Illumina MiSeq data quality control (QC) before upload to PulseNet Central 2. SCOPE: This procedure applies to all clinical isolates that are whole
More informationHow to Download and Re-upload a PDF File in WCMS
How to Download and Re-upload a PDF File in WCMS Login to WCMS. Click on the folder icon to expand it. (Icon is the left of the folder name). Select the folder that contains the file. Select the document
More informationUsing Galaxy-P Documentation
Using Galaxy-P Documentation Release 0.1 John Chilton, Pratik Jagtap October 26, 2015 Contents 1 Introduction 1 2 Galaxy-P 101 - Building Up and Using a Proteomics Workflow 3 2.1 What Are We Trying to
More informationINF-BIO5121/ Oct 7, Analyzing mirna data using Lifeportal PRACTICALS
INF-BIO5121/9121 - Oct 7, 2014 Analyzing mirna data using Lifeportal PRACTICALS In this experiment we have mirna data from the livers of baboons (Papio Hamadryas) before and after they are given a high
More informationSupplementary Information. Detecting and annotating genetic variations using the HugeSeq pipeline
Supplementary Information Detecting and annotating genetic variations using the HugeSeq pipeline Hugo Y. K. Lam 1,#, Cuiping Pan 1, Michael J. Clark 1, Phil Lacroute 1, Rui Chen 1, Rajini Haraksingh 1,
More informationHigh-throughput sequencing: Alignment and related topic. Simon Anders EMBL Heidelberg
High-throughput sequencing: Alignment and related topic Simon Anders EMBL Heidelberg Established platforms HTS Platforms Illumina HiSeq, ABI SOLiD, Roche 454 Newcomers: Benchtop machines: Illumina MiSeq,
More informationNext Generation Sequence Alignment on the BRC Cluster. Steve Newhouse 22 July 2010
Next Generation Sequence Alignment on the BRC Cluster Steve Newhouse 22 July 2010 Overview Practical guide to processing next generation sequencing data on the cluster No details on the inner workings
More informationTutorial: De Novo Assembly of Paired Data
: De Novo Assembly of Paired Data September 20, 2013 CLC bio Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 Fax: +45 86 20 12 22 www.clcbio.com support@clcbio.com : De Novo Assembly
More informationMetaStorm: User Manual
MetaStorm: User Manual User Account: First, either log in as a guest or login to your user account. If you login as a guest, you can visualize public MetaStorm projects, but can not run any analysis. To
More informationIntroduction to Read Alignment. UCD Genome Center Bioinformatics Core Tuesday 15 September 2015
Introduction to Read Alignment UCD Genome Center Bioinformatics Core Tuesday 15 September 2015 From reads to molecules Why align? Individual A Individual B ATGATAGCATCGTCGGGTGTCTGCTCAATAATAGTGCCGTATCATGCTGGTGTTATAATCGCCGCATGACATGATCAATGG
More informationNGS FASTQ file format
NGS FASTQ file format Line1: Begins with @ and followed by a sequence idenefier and opeonal descripeon Line2: Raw sequence leiers Line3: + Line4: Encodes the quality values for the sequence in Line2 (see
More informationExercise 2: Browser-Based Annotation and RNA-Seq Data
Exercise 2: Browser-Based Annotation and RNA-Seq Data Jeremy Buhler July 24, 2018 This exercise continues your introduction to practical issues in comparative annotation. You ll be annotating genomic sequence
More informationResequencing Analysis. (Pseudomonas aeruginosa MAPO1 ) Sample to Insight
Resequencing Analysis (Pseudomonas aeruginosa MAPO1 ) 1 Workflow Import NGS raw data Trim reads Import Reference Sequence Reference Mapping QC on reads Variant detection Case Study Pseudomonas aeruginosa
More informationTutorial: How to use the Wheat TILLING database
Tutorial: How to use the Wheat TILLING database Last Updated: 9/7/16 1. Visit http://dubcovskylab.ucdavis.edu/wheat_blast to go to the BLAST page or click on the Wheat BLAST button on the homepage. 2.
More informationTutorial. Find Very Low Frequency Variants With QIAGEN GeneRead Panels. Sample to Insight. November 21, 2017
Find Very Low Frequency Variants With QIAGEN GeneRead Panels November 21, 2017 Sample to Insight QIAGEN Aarhus Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 www.qiagenbioinformatics.com
More informationTOTAL CONTROL SECURITY END USER GUIDE
TOTAL CONTROL EMAIL SECURITY END USER GUIDE Welcome to the Total Control email security solution, which protects you against spam, viruses, phishing exploits, and other email-borne threats. In this guide,
More informationPRACTICAL SESSION 8 SEQUENCE-BASED ASSOCIATION, INTERPRETATION, VISUALIZATION USING EPACTS JAN 7 TH, 2014 STOM 2014 WORKSHOP
PRACTICAL SESSION 8 SEQUENCE-BASED ASSOCIATION, INTERPRETATION, VISUALIZATION USING EPACTS JAN 7 TH, 2014 STOM 2014 WORKSHOP HYUN MIN KANG UNIVERSITY OF MICHIGAN, ANN ARBOR EPACTS ASSOCIATION ANALYSIS
More informationTutorial: RNA-Seq Analysis Part II (Tracks): Non-Specific Matches, Mapping Modes and Expression measures
: RNA-Seq Analysis Part II (Tracks): Non-Specific Matches, Mapping Modes and February 24, 2014 Sample to Insight : RNA-Seq Analysis Part II (Tracks): Non-Specific Matches, Mapping Modes and : RNA-Seq Analysis
More informationSELF COACHING SCHOLARS TECH FAQ
SELF COACHING SCHOLARS TECH FAQ TABLE OF CONTENTS LOG IN TO THE MEMBERSHIP SITE 2 FORGOT PASSWORD 2 CALL SCHEDULE AND ZOOM INFORMATION 3 BEING COACHED LIVE ON A CALL 6 LIVE CALL RECORDINGS 7 HOW TO LISTEN
More informationProtocol: peak-calling for ChIP-seq data / segmentation analysis for histone modification data
Protocol: peak-calling for ChIP-seq data / segmentation analysis for histone modification data Table of Contents Protocol: peak-calling for ChIP-seq data / segmentation analysis for histone modification
More informationAgroMarker Finder manual (1.1)
AgroMarker Finder manual (1.1) 1. Introduction 2. Installation 3. How to run? 4. How to use? 5. Java program for calculating of restriction enzyme sites (TaqαI). 1. Introduction AgroMarker Finder (AMF)is
More informationTP RNA-seq : Differential expression analysis
TP RNA-seq : Differential expression analysis Overview of RNA-seq analysis Fusion transcripts detection Differential expresssion Gene level RNA-seq Transcript level Transcripts and isoforms detection 2
More informationNGS Data Analysis. Roberto Preste
NGS Data Analysis Roberto Preste 1 Useful info http://bit.ly/2r1y2dr Contacts: roberto.preste@gmail.com Slides: http://bit.ly/ngs-data 2 NGS data analysis Overview 3 NGS Data Analysis: the basic idea http://bit.ly/2r1y2dr
More informationLab 8: Using POY from your desktop and through CIPRES
Integrative Biology 200A University of California, Berkeley PRINCIPLES OF PHYLOGENETICS Spring 2012 Updated by Michael Landis Lab 8: Using POY from your desktop and through CIPRES In this lab we re going
More informationWelcome to Liscio Pro Setup & Tutorial
Welcome to Liscio Pro Setup & Tutorial Welcome to secure sharing. To set up your new account and familiarize yourself with how Liscio works, simply follow our step-by-step walkthrough. Invite to Liscio
More informationMapping and Viewing Deep Sequencing Data bowtie2, samtools, igv
Mapping and Viewing Deep Sequencing Data bowtie2, samtools, igv Frederick J Tan Bioinformatics Research Faculty Carnegie Institution of Washington, Department of Embryology tan@ciwemb.edu 27 August 2013
More informationIntroduction to Galaxy
Introduction to Galaxy Dr Jason Wong Prince of Wales Clinical School Introductory bioinformatics for human genomics workshop, UNSW Day 1 Thurs 28 th January 2016 Overview What is Galaxy? Description of
More informationAnnotating sequences in batch
BioNumerics Tutorial: Annotating sequences in batch 1 Aim The annotation application in BioNumerics has been designed for the annotation of coding regions on sequences. In this tutorial you will learn
More informationAn Introduction to Linux and Bowtie
An Introduction to Linux and Bowtie Cavan Reilly November 10, 2017 Table of contents Introduction to UNIX-like operating systems Installing programs Bowtie SAMtools Introduction to Linux In order to use
More informationA short Introduction to UCSC Genome Browser
A short Introduction to UCSC Genome Browser Elodie Girard, Nicolas Servant Institut Curie/INSERM U900 Bioinformatics, Biostatistics, Epidemiology and computational Systems Biology of Cancer 1 Why using
More informationMapping RNA sequence data (Part 1: using pathogen portal s RNAseq pipeline) Exercise 6
Mapping RNA sequence data (Part 1: using pathogen portal s RNAseq pipeline) Exercise 6 The goal of this exercise is to retrieve an RNA-seq dataset in FASTQ format and run it through an RNA-sequence analysis
More informationAnalyzing Variant Call results using EuPathDB Galaxy, Part II
Analyzing Variant Call results using EuPathDB Galaxy, Part II In this exercise, we will work in groups to examine the results from the SNP analysis workflow that we started yesterday. The first step is
More informationRNA-seq. Manpreet S. Katari
RNA-seq Manpreet S. Katari Evolution of Sequence Technology Normalizing the Data RPKM (Reads per Kilobase of exons per million reads) Score = R NT R = # of unique reads for the gene N = Size of the gene
More informationSequence Mapping and Assembly
Practical Introduction Sequence Mapping and Assembly December 8, 2014 Mary Kate Wing University of Michigan Center for Statistical Genetics Goals of This Session Learn basics of sequence data file formats
More informationChIP-seq practical: peak detection and peak annotation. Mali Salmon-Divon Remco Loos Myrto Kostadima
ChIP-seq practical: peak detection and peak annotation Mali Salmon-Divon Remco Loos Myrto Kostadima March 2012 Introduction The goal of this hands-on session is to perform some basic tasks in the analysis
More informationGenome Browsers - The UCSC Genome Browser
Genome Browsers - The UCSC Genome Browser Background The UCSC Genome Browser is a well-curated site that provides users with a view of gene or sequence information in genomic context for a specific species,
More informationINTRODUCTION AUX FORMATS DE FICHIERS
INTRODUCTION AUX FORMATS DE FICHIERS Plan. Formats de séquences brutes.. Format fasta.2. Format fastq 2. Formats d alignements 2.. Format SAM 2.2. Format BAM 4. Format «Variant Calling» 4.. Format Varscan
More informationTutorial for Windows and Macintosh. De Novo Sequence Assembly with Velvet
Tutorial for Windows and Macintosh De Novo Sequence Assembly with Velvet 2017 Gene Codes Corporation Gene Codes Corporation 525 Avis Drive, Ann Arbor, MI 48108 USA 1.800.497.4939 (USA) +1.734.769.7249
More informationExercise 1. RNA-seq alignment and quantification. Part 1. Prepare the working directory. Part 2. Examine qualities of the RNA-seq data files
Exercise 1. RNA-seq alignment and quantification Part 1. Prepare the working directory. 1. Connect to your assigned computer. If you do not know how, follow the instruction at http://cbsu.tc.cornell.edu/lab/doc/remote_access.pdf
More informationIntroduction to Galaxy
Introduction to Galaxy Saint Louis University St. Louis, Missouri April 30, 2013 Dave Clements, Emory University http://galaxyproject.org/ Agenda 9:00 Welcome 9:20 Basic Analysis with Galaxy 10:30 Basic
More informationTutorial: chloroplast genomes
Tutorial: chloroplast genomes Stacia Wyman Department of Computer Sciences Williams College Williamstown, MA 01267 March 10, 2005 ASSUMPTIONS: You are using Internet Explorer under OS X on the Mac. You
More information