CSCI 1820 Notes. Scribes: tl40. February 26 - March 02, Estimating size of graphs used to build the assembly.
|
|
- Maryann Anderson
- 6 years ago
- Views:
Transcription
1 CSCI 1820 Notes Scribes: tl40 February 26 - March 02, 2018 Chapter 2. Genome Assembly Algorithms 2.1. Statistical Theory 2.2. Algorithmic Theory Idury-Waterman Algorithm Estimating size of graphs used to build the assembly. de Bruijn graphs combinatorics. DNA Assembly Problem We have a G bp-long DNA target molecule, which we do not know so want to reconstruct. We know sequences of a number of fragments of the target DNA, f 1, f 2,, f N. Assume that they are all of length L. Note that the same result holds when L is the average length of the fragments. We can record their consecutive order. We use the de Bruijn graphs for algorithms used to assembly the target DNA sequence. Remark 1. The graph consists of nodes as (k 1)-mers and directed edges as k-mers, so depends on the choice of k. 2. The graph is Eulerian, which means that the in-degree and out-degree are same for every node, so there exists at least one Eulerian cycle - actually, we have exponentially many different such ones. 1
2 Estimate the size of the de Bruijn graph based on k-mers Setting: k: size of the mers. G: size of the target DNA. N: number of fragments. L: length of the fragments. a = NL G : coverage. T = f 1 + f f N N(L k + 2): number of (k 1)-mers in the fragments. r: DNA single base error rate (sequencing error rate), about 2% in substitutions. Theorem Let L = L k + 2 and R = 1 (1 r) k 1. Also, let us classify the (k 1)-mers in the de Bruijn graph (sequence graph) as TRUE if they are derived from a correctly used fragment region, and FALSE otherwise. Assume the following: 1. The error rate is small. 2. No two fragments generate the same FALSE (k 1)-mer, that is, FALSE (k 1)- mers appear at most once among fragments. Then, in the associated de Bruijn graph (sequence graph), the expected number of vertices is E[ V ] = RT + [1 e a(1 R) ]L. Proof Let X α be the number of fragments that cover the (k 1)-long region α, α + 1,, α + k 2 of the target DNA sequence. Then, each X α is a Poisson random variable with mean a, and E[ α X α] = T. Since the uniform error rate on the probability of a base being used correctly by the sequencing machine is 1 r, the probability that an entire (k 1)-mer is used correctly is (1 r) k 1, which implies that the probability that an entire (k 1)-mer being used incorrectly is R = 1 (1 r) k 1 : we can say that R is the (k 1)-mer error rate, and, by the second assumption, E[ F ALSE ] = RT 2
3 The expected number of TRUE (k 1)-mers is equal to the number of positions α such that at least one of the fragments contains no sequencing errors in the (k 1)-long region α, α + 1,, α + k 2, so, for a Poisson random variable X, E[ T RUE ] = L (1 R i )P (X = i) ( e = L (P (X = i) P (X = i)r i a ) = L a i ( e a = L a i ) ( e a (ar) i = L e a a i e a = L (1 e a e ar ) = L (1 e a(1 R) ) ) e a a i R i ) (ar) i Therefore, E[ V ] = E[ T RUE ] + E[ F ALSE ] = RT + (1 e a(1 R) )L. Theory of Combinatorics on Words Definition Let A be the alphabet, A be the set of sequences over A including an empty word ɛ, A + be the set of sequences without ɛ, and u m = uu u for a sequence u. w A + is called primitive if w = u m for u A + then m = 1. Two words x and y are conjugate if there exist words u, v such that x = uv and y = vu (cyclic shifts of one another). Definition A Lyndon word is a primitive word that is strictly smaller than any of its proper suffixes (or rotations) in lexicographic order. Lemma Let L be the set of all Lyndon words. If l < m for l, m L, then lm L. Theorem (Factorization) Any word can be factorized uniquely as a non-increasing product of Lyndon words. Example abracadabra (abracad)(abr)(a) Theorem (Fredrickson & Maiorana) Let l 1 < l 2 < < l m be the increasing sequence of Lyndon words of length dividing n. Then l 1 l 2 l m is the lex-first de Bruijn cycle of order n (all n-mers are there). 3
4 De Bruijn Graphs Combinatorics & Eulerian Cycles (Building Genome Assemblies) Example A de Bruijn graph of order n = 3 over A = {a, b}: Definition For a given graph G = (V, E) and v V, d (v)= the in-degree = number of edges coming in. d + (v)= the out-degree = number of edges going out. Definition A spanning tree directed at vertex v has the follwing properties: 1. It is connected. 2. For every vertex u v, there is a directed path in the spanning tree from u to v. Remark (How many Eulerian orders are in the de Bruijn graph?) There is a connection between Eulerian cycles and spanning trees directed towards a fixed node v, which can be used for giving a relationship between the number of Eulerian cycles and that of spanning trees. Example Two directed spanning trees directed towards the vertex bb: 4
5 Definition A directed graph G = (V, E) is strongly connected if u, v V, a directed path from u to v. Theorem A strongly connected graph G = (V, E) is Eulerian if and only if d (v) = d + (v) for any v V. Definition An Eulerian cycle is a cycle on a graph that visits every edge exactly once. Theorem (BEST) For a graph G = (V, E), define the following: Π(G) = v V (d+ (v) 1)!. For a vertex v V, t(g) is the number of spanning trees oriented towards v. Then, the number of Eulerian cycles is equal to t(g) Π(G). Theorem The number of de Bruijn cycles of order n (all n-mers in the de Bruijn cycle) over k-letter alphabets is N(n, k) = (k!)kn 1 k n. Table 1: Some Examples n N(n, 2) N(n, 3) N(n, 4) N(n, 5) 24 Theorem (The Matrix-Tree Theorem) Let G be a graph on a set of vertices V, M = (M v w) be an adjacency matrix of G, where M vw is the number of edges between v and w, D be a diagonal matrix such that D vv = w V M vw, L = D M be the Laplacian matrix of G, and K v (G) be the determinant of the matrix C v, obtained from L by removing the row and column indexed v. Then, for any v V, the number of spanning trees of G oriented towards v is K v (G). Example Let G be a de Bruijn graph of order n = 3 over A = {a, b}, so V = {aa, ab, ba, bb}. Then, the adjacency matrix M, D, and the Laplacian matrix L are given by following: M = , D = , L = Therefore, the number of spanning trees directed towards bb is 2 by following: 5
6 1 1 0 C bb = det C bb =
Characterization of Graphs with Eulerian Circuits
Eulerian Circuits 3. 73 Characterization of Graphs with Eulerian Circuits There is a simple way to determine if a graph has an Eulerian circuit. Theorems 3.. and 3..2: Let G be a pseudograph that is connected
More informationDe Bruijn Sequences and De Bruijn Graphs for a general language
De Bruijn Sequences and De Bruijn Graphs for a general language Eduardo Moreno 1 Institut Gaspard Monge, Université de Marne-la-Vallée, Champs-sur-Marne, 77454 Marne-la-Vallée cedex 2, France. Departamento
More informationSmall-Space 2D Compressed Dictionary Matching
Shoshana Neuburger and Dina Sokol City University of New York Problem Definition Compressed 2D Dictionary Matching Input: Compressed text of uncompressed size n n. Dictionary containing k compressed patterns.
More informationGraph Algorithms in Bioinformatics
Graph Algorithms in Bioinformatics Computational Biology IST Ana Teresa Freitas 2015/2016 Sequencing Clone-by-clone shotgun sequencing Human Genome Project Whole-genome shotgun sequencing Celera Genomics
More informationCSCI2950-C Lecture 4 DNA Sequencing and Fragment Assembly
CSCI2950-C Lecture 4 DNA Sequencing and Fragment Assembly Ben Raphael Sept. 22, 2009 http://cs.brown.edu/courses/csci2950-c/ l-mer composition Def: Given string s, the Spectrum ( s, l ) is unordered multiset
More informationReducing Genome Assembly Complexity with Optical Maps
Reducing Genome Assembly Complexity with Optical Maps Lee Mendelowitz LMendelo@math.umd.edu Advisor: Dr. Mihai Pop Computer Science Department Center for Bioinformatics and Computational Biology mpop@umiacs.umd.edu
More informationSequencing. Computational Biology IST Ana Teresa Freitas 2011/2012. (BACs) Whole-genome shotgun sequencing Celera Genomics
Computational Biology IST Ana Teresa Freitas 2011/2012 Sequencing Clone-by-clone shotgun sequencing Human Genome Project Whole-genome shotgun sequencing Celera Genomics (BACs) 1 Must take the fragments
More informationOn Universal Cycles of Labeled Graphs
On Universal Cycles of Labeled Graphs Greg Brockman Harvard University Cambridge, MA 02138 United States brockman@hcs.harvard.edu Bill Kay University of South Carolina Columbia, SC 29208 United States
More information02-711/ Computational Genomics and Molecular Biology Fall 2016
Literature assignment 2 Due: Nov. 3 rd, 2016 at 4:00pm Your name: Article: Phillip E C Compeau, Pavel A. Pevzner, Glenn Tesler. How to apply de Bruijn graphs to genome assembly. Nature Biotechnology 29,
More informationCME 305: Discrete Mathematics and Algorithms Instructor: Reza Zadeh HW#3 Due at the beginning of class Thursday 03/02/17
CME 305: Discrete Mathematics and Algorithms Instructor: Reza Zadeh (rezab@stanford.edu) HW#3 Due at the beginning of class Thursday 03/02/17 1. Consider a model of a nonbipartite undirected graph in which
More informationEulerian Tours and Fleury s Algorithm
Eulerian Tours and Fleury s Algorithm CSE21 Winter 2017, Day 12 (B00), Day 8 (A00) February 8, 2017 http://vlsicad.ucsd.edu/courses/cse21-w17 Vocabulary Path (or walk): describes a route from one vertex
More informationDNA Sequencing. Overview
BINF 3350, Genomics and Bioinformatics DNA Sequencing Young-Rae Cho Associate Professor Department of Computer Science Baylor University Overview Backgrounds Eulerian Cycles Problem Hamiltonian Cycles
More informationMichał Dębski. Uniwersytet Warszawski. On a topological relaxation of a conjecture of Erdős and Nešetřil
Michał Dębski Uniwersytet Warszawski On a topological relaxation of a conjecture of Erdős and Nešetřil Praca semestralna nr 3 (semestr letni 2012/13) Opiekun pracy: Tomasz Łuczak On a topological relaxation
More informationMath 778S Spectral Graph Theory Handout #2: Basic graph theory
Math 778S Spectral Graph Theory Handout #: Basic graph theory Graph theory was founded by the great Swiss mathematician Leonhard Euler (1707-178) after he solved the Königsberg Bridge problem: Is it possible
More informationCME 305: Discrete Mathematics and Algorithms Instructor: Reza Zadeh HW#3 Due at the beginning of class Thursday 02/26/15
CME 305: Discrete Mathematics and Algorithms Instructor: Reza Zadeh (rezab@stanford.edu) HW#3 Due at the beginning of class Thursday 02/26/15 1. Consider a model of a nonbipartite undirected graph in which
More information(for more info see:
Genome assembly (for more info see: http://www.cbcb.umd.edu/research/assembly_primer.shtml) Introduction Sequencing technologies can only "read" short fragments from a genome. Reconstructing the entire
More informationMAT 145: PROBLEM SET 4
MAT 145: PROBLEM SET 4 DUE TO FRIDAY FEB 22 Abstract. This problem set corresponds to the sixth week of the Combinatorics Course in the Winter Quarter 2019. It was posted online on Friday Feb 15 and is
More informationPath Finding in Graphs. Problem Set #2 will be posted by tonight
Path Finding in Graphs Problem Set #2 will be posted by tonight 1 From Last Time Two graphs representing 5-mers from the sequence "GACGGCGGCGCACGGCGCAA" Hamiltonian Path: Eulerian Path: Each k-mer is a
More informationIDBA A Practical Iterative de Bruijn Graph De Novo Assembler
IDBA A Practical Iterative de Bruijn Graph De Novo Assembler Yu Peng, Henry C.M. Leung, S.M. Yiu, and Francis Y.L. Chin Department of Computer Science, The University of Hong Kong Pokfulam Road, Hong Kong
More informationGenome Reconstruction: A Puzzle with a Billion Pieces Phillip E. C. Compeau and Pavel A. Pevzner
Genome Reconstruction: A Puzzle with a Billion Pieces Phillip E. C. Compeau and Pavel A. Pevzner Outline I. Problem II. Two Historical Detours III.Example IV.The Mathematics of DNA Sequencing V.Complications
More informationK 4 C 5. Figure 4.5: Some well known family of graphs
08 CHAPTER. TOPICS IN CLASSICAL GRAPH THEORY K, K K K, K K, K K, K C C C C 6 6 P P P P P. Graph Operations Figure.: Some well known family of graphs A graph Y = (V,E ) is said to be a subgraph of a graph
More informationCounting the number of spanning tree. Pied Piper Department of Computer Science and Engineering Shanghai Jiao Tong University
Counting the number of spanning tree Pied Piper Department of Computer Science and Engineering Shanghai Jiao Tong University 目录 Contents 1 Complete Graph 2 Proof of the Lemma 3 Arbitrary Graph 4 Proof
More information2 Eulerian digraphs and oriented trees.
2 Eulerian digraphs and oriented trees. A famous problem which goes back to Euler asks for what graphs G is there a closed walk which uses every edge exactly once. (There is also a version for non-closed
More informationIDBA - A Practical Iterative de Bruijn Graph De Novo Assembler
IDBA - A Practical Iterative de Bruijn Graph De Novo Assembler Yu Peng, Henry Leung, S.M. Yiu, Francis Y.L. Chin Department of Computer Science, The University of Hong Kong Pokfulam Road, Hong Kong {ypeng,
More informationThe Matrix-Tree Theorem and Its Applications to Complete and Complete Bipartite Graphs
The Matrix-Tree Theorem and Its Applications to Complete and Complete Bipartite Graphs Frankie Smith Nebraska Wesleyan University fsmith@nebrwesleyan.edu May 11, 2015 Abstract We will look at how to represent
More informationGenome Sequencing Algorithms
Genome Sequencing Algorithms Phillip Compaeu and Pavel Pevzner Bioinformatics Algorithms: an Active Learning Approach Leonhard Euler (1707 1783) William Hamilton (1805 1865) Nicolaas Govert de Bruijn (1918
More informationBLAST & Genome assembly
BLAST & Genome assembly Solon P. Pissis Tomáš Flouri Heidelberg Institute for Theoretical Studies May 15, 2014 1 BLAST What is BLAST? The algorithm 2 Genome assembly De novo assembly Mapping assembly 3
More informationDefinition: A graph G = (V, E) is called a tree if G is connected and acyclic. The following theorem captures many important facts about trees.
Tree 1. Trees and their Properties. Spanning trees 3. Minimum Spanning Trees 4. Applications of Minimum Spanning Trees 5. Minimum Spanning Tree Algorithms 1.1 Properties of Trees: Definition: A graph G
More informationProposition 1. The edges of an even graph can be split (partitioned) into cycles, no two of which have an edge in common.
Math 3116 Dr. Franz Rothe June 5, 2012 08SUM\3116_2012t1.tex Name: Use the back pages for extra space 1 Solution of Test 1.1 Eulerian graphs Proposition 1. The edges of an even graph can be split (partitioned)
More informationSmall-Space 2D Compressed Dictionary Matching
Small-Space 2D Compressed Dictionary Matching Shoshana Neuburger 1 and Dina Sokol 2 1 Department of Computer Science, The Graduate Center of the City University of New York, New York, NY, 10016 shoshana@sci.brooklyn.cuny.edu
More informationPACKING DIGRAPHS WITH DIRECTED CLOSED TRAILS
PACKING DIGRAPHS WITH DIRECTED CLOSED TRAILS PAUL BALISTER Abstract It has been shown [Balister, 2001] that if n is odd and m 1,, m t are integers with m i 3 and t i=1 m i = E(K n) then K n can be decomposed
More informationMath 776 Graph Theory Lecture Note 1 Basic concepts
Math 776 Graph Theory Lecture Note 1 Basic concepts Lectured by Lincoln Lu Transcribed by Lincoln Lu Graph theory was founded by the great Swiss mathematician Leonhard Euler (1707-178) after he solved
More information58093 String Processing Algorithms. Lectures, Autumn 2013, period II
58093 String Processing Algorithms Lectures, Autumn 2013, period II Juha Kärkkäinen 1 Contents 0. Introduction 1. Sets of strings Search trees, string sorting, binary search 2. Exact string matching Finding
More informationFour-Regular Graphs with Rigid Vertices Associated to DNA Recombination
Four-Regular Graphs with Rigid Vertices Associated to DNA Recombination Jonathan Burns, Egor Dolzhenko, Nataša Jonoska, Tilahun Muche, Masahico Saito Department of Mathematics and Statistics University
More informationGenome Assembly Using de Bruijn Graphs. Biostatistics 666
Genome Assembly Using de Bruijn Graphs Biostatistics 666 Previously: Reference Based Analyses Individual short reads are aligned to reference Genotypes generated by examining reads overlapping each position
More informationDefinition 2 (Projective plane). A projective plane is a class of points, and a class of lines satisfying the axioms:
Math 3181 Name: Dr. Franz Rothe January 30, 2014 All3181\3181_spr14h2.tex Homework has to be turned in this handout. The homework can be done in groups up to three due February 11/12 2 Homework 1 Definition
More informationDO NOT RE-DISTRIBUTE THIS SOLUTION FILE
Professor Kindred Math 104, Graph Theory Homework 2 Solutions February 7, 2013 Introduction to Graph Theory, West Section 1.2: 26, 38, 42 Section 1.3: 14, 18 Section 2.1: 26, 29, 30 DO NOT RE-DISTRIBUTE
More informationGenus Ranges of 4-Regular Rigid Vertex Graphs
Genus Ranges of 4-Regular Rigid Vertex Graphs Dorothy Buck Department of Mathematics Imperial College London London, England, UK d.buck@imperial.ac.uk Nataša Jonoska Egor Dolzhenko Molecular and Computational
More informationProblem Set 2 Solutions
Problem Set 2 Solutions Graph Theory 2016 EPFL Frank de Zeeuw & Claudiu Valculescu 1. Prove that the following statements about a graph G are equivalent. - G is a tree; - G is minimally connected (it is
More information4 Remainder Cordial Labeling of Some Graphs
International J.Math. Combin. Vol.(08), 8-5 Remainder Cordial Labeling of Some Graphs R.Ponraj, K.Annathurai and R.Kala. Department of Mathematics, Sri Paramakalyani College, Alwarkurichi-67, India. Department
More informationspanning trees of tree graphs Philippe Biane, CNRS-IGM-Université Paris-Est Firenze, May
Spanning trees of tree graphs, CNRS-IGM-Université Paris-Est Firenze, May 18 2015 joint work with Guillaume Chapuy, CNRS-LIAFA-Université Paris 7 V, E=directed graph w x e v Q=Laplacian matrix, indexed
More informationGenome 373: Genome Assembly. Doug Fowler
Genome 373: Genome Assembly Doug Fowler What are some of the things we ve seen we can do with HTS data? We ve seen that HTS can enable a wide variety of analyses ranging from ID ing variants to genome-
More informationGraph Theory. Chapter 4.
Graph Theory. Chapter 4. Wandering. Here is an algorithm, due to Tarry, that constructs a walk in a connected graph, starting at any vertex v 0, traversing each edge exactly once in each direction, and
More informationDiscrete Mathematics for CS Spring 2008 David Wagner Note 13. An Introduction to Graphs
CS 70 Discrete Mathematics for CS Spring 2008 David Wagner Note 13 An Introduction to Graphs Formulating a simple, precise specification of a computational problem is often a prerequisite to writing a
More informationEulerian tours. Russell Impagliazzo and Miles Jones Thanks to Janine Tiefenbruck. April 20, 2016
Eulerian tours Russell Impagliazzo and Miles Jones Thanks to Janine Tiefenbruck http://cseweb.ucsd.edu/classes/sp16/cse21-bd/ April 20, 2016 Seven Bridges of Konigsberg Is there a path that crosses each
More informationChapter 2. Splitting Operation and n-connected Matroids. 2.1 Introduction
Chapter 2 Splitting Operation and n-connected Matroids The splitting operation on an n-connected binary matroid may not yield an n-connected binary matroid. In this chapter, we provide a necessary and
More informationGraph Algorithms Using Depth First Search
Graph Algorithms Using Depth First Search Analysis of Algorithms Week 8, Lecture 1 Prepared by John Reif, Ph.D. Distinguished Professor of Computer Science Duke University Graph Algorithms Using Depth
More informationGenerating (n,2) De Bruijn Sequences with Some Balance and Uniformity Properties. Abstract
Generating (n,) De Bruijn Sequences with Some Balance and Uniformity Properties Yi-Chih Hsieh, Han-Suk Sohn, and Dennis L. Bricker Department of Industrial Management, National Huwei Institute of Technology,
More informationSequence Assembly Required!
Sequence Assembly Required! 1 October 3, ISMB 20172007 1 Sequence Assembly Genome Sequenced Fragments (reads) Assembled Contigs Finished Genome 2 Greedy solution is bounded 3 Typical assembly strategy
More informationFastA & the chaining problem
FastA & the chaining problem We will discuss: Heuristics used by the FastA program for sequence alignment Chaining problem 1 Sources for this lecture: Lectures by Volker Heun, Daniel Huson and Knut Reinert,
More informationFastA and the chaining problem, Gunnar Klau, December 1, 2005, 10:
FastA and the chaining problem, Gunnar Klau, December 1, 2005, 10:56 4001 4 FastA and the chaining problem We will discuss: Heuristics used by the FastA program for sequence alignment Chaining problem
More information1 Random Walks on Graphs
Lecture 7 Com S 633: Randomness in Computation Scribe: Ankit Agrawal In the last lecture, we looked at random walks on line and used them to devise randomized algorithms for 2-SAT and 3-SAT For 2-SAT we
More informationJo Ellis-Monaghan * St. Michaels College, Colchester, VT Irasema Sarmiento CINVESTAV, Mexico
Jo Ellis-Monaghan * St. Michaels College, Colchester, VT 05439 Irasema Sarmiento CINVESTAV, Mexico e-mail: jellis-monaghan@smcvt.edu, website: http://academics.smcvt.edu/jellis-monaghan The motivating
More informationCounting the Number of Fixed Points in the Phase Space of Circ n
Counting the Number of Fixed Points in the Phase Space of Circ n Adam Reevesman February 24, 2015 This paper will discuss a method for counting the number of fixed points in the phase space of the Circ
More informationAlgorithms for Bioinformatics
Adapted from slides by Alexandru Tomescu, Leena Salmela and Veli Mäkinen, which are partly from http://bix.ucsd.edu/bioalgorithms/slides.php 582670 Algorithms for Bioinformatics Lecture 3: Graph Algorithms
More informationMath Summer 2012
Math 481 - Summer 2012 Final Exam You have one hour and fifty minutes to complete this exam. You are not allowed to use any electronic device. Be sure to give reasonable justification to all your answers.
More informationEncoding/Decoding, Counting graphs
Encoding/Decoding, Counting graphs Russell Impagliazzo and Miles Jones Thanks to Janine Tiefenbruck http://cseweb.ucsd.edu/classes/sp16/cse21-bd/ May 13, 2016 11-avoiding binary strings Let s consider
More informationMathematics and Statistics, Part A: Graph Theory Problem Sheet 1, lectures 1-4
1. Draw Mathematics and Statistics, Part A: Graph Theory Problem Sheet 1, lectures 1-4 (i) a simple graph. A simple graph has a non-empty vertex set and no duplicated edges. For example sketch G with V
More informationMath 485, Graph Theory: Homework #3
Math 485, Graph Theory: Homework #3 Stephen G Simpson Due Monday, October 26, 2009 The assignment consists of Exercises 2129, 2135, 2137, 2218, 238, 2310, 2313, 2314, 2315 in the West textbook, plus the
More informationOn Modularity Clustering. Group III (Ying Xuan, Swati Gambhir & Ravi Tiwari)
On Modularity Clustering Presented by: Presented by: Group III (Ying Xuan, Swati Gambhir & Ravi Tiwari) Modularity A quality index for clustering a graph G=(V,E) G=(VE) q( C): EC ( ) EC ( ) + ECC (, ')
More informationReducing Genome Assembly Complexity with Optical Maps Mid-year Progress Report
Reducing Genome Assembly Complexity with Optical Maps Mid-year Progress Report Lee Mendelowitz LMendelo@math.umd.edu Advisor: Dr. Mihai Pop Computer Science Department Center for Bioinformatics and Computational
More informationExercise set 2 Solutions
Exercise set 2 Solutions Let H and H be the two components of T e and let F E(T ) consist of the edges of T with one endpoint in V (H), the other in V (H ) Since T is connected, F Furthermore, since T
More informationStructural and spectral properties of minimal strong digraphs
Structural and spectral properties of minimal strong digraphs C. Marijuán J. García-López, L.M. Pozo-Coronado Abstract In this article, we focus on structural and spectral properties of minimal strong
More informationGraph Algorithms. Tours in Graphs. Graph Algorithms
Graph Algorithms Tours in Graphs Graph Algorithms Special Paths and Cycles in Graphs Euler Path: A path that traverses all the edges of the graph exactly once. Euler Cycle: A cycle that traverses all the
More informationGraphs and Puzzles. Eulerian and Hamiltonian Tours.
Graphs and Puzzles. Eulerian and Hamiltonian Tours. CSE21 Winter 2017, Day 11 (B00), Day 7 (A00) February 3, 2017 http://vlsicad.ucsd.edu/courses/cse21-w17 Exam Announcements Seating Chart on Website Good
More information2 Solution of Homework
Math 3181 Name: Dr. Franz Rothe February 6, 2014 All3181\3181_spr14h2.tex Homework has to be turned in this handout. The homework can be done in groups up to three due February 11/12 2 Solution of Homework
More informationRESEARCH TOPIC IN BIOINFORMANTIC
RESEARCH TOPIC IN BIOINFORMANTIC GENOME ASSEMBLY Instructor: Dr. Yufeng Wu Noted by: February 25, 2012 Genome Assembly is a kind of string sequencing problems. As we all know, the human genome is very
More informationDiscrete mathematics , Fall Instructor: prof. János Pach
Discrete mathematics 2016-2017, Fall Instructor: prof. János Pach - covered material - Lecture 1. Counting problems To read: [Lov]: 1.2. Sets, 1.3. Number of subsets, 1.5. Sequences, 1.6. Permutations,
More informationCombinatorics MAP363 Sheet 1. Mark: /10. Name. Number. Hand in by 19th February. date marked: / /2007
Turn over Combinatorics MAP6 Sheet Hand in by 9th February Name Number Year Mark: /0 date marked: / /200 Please attach your working, with this sheet at the front. Guidance on notation: graphs may have
More informationCONTRIBUTIONS TO THE THEORY OF DE BRUIJN CYCLES
#A2 INTEGERS 4A (24) CONTRIBUTIONS TO THE THEORY OF DE BRUIJN CYCLES André AlexanderCampbell Department of Mathematics, East Tennessee State University, Johnson City, Tennessee campbella@goldmail.etsu.edu
More informationTheory of Computing. Lecture 10 MAS 714 Hartmut Klauck
Theory of Computing Lecture 10 MAS 714 Hartmut Klauck Seven Bridges of Königsberg Can one take a walk that crosses each bridge exactly once? Seven Bridges of Königsberg Model as a graph Is there a path
More information4 Basics of Trees. Petr Hliněný, FI MU Brno 1 FI: MA010: Trees and Forests
4 Basics of Trees Trees, actually acyclic connected simple graphs, are among the simplest graph classes. Despite their simplicity, they still have rich structure and many useful application, such as in
More informationComplexity Theory. Compiled By : Hari Prasad Pokhrel Page 1 of 20. ioenotes.edu.np
Chapter 1: Introduction Introduction Purpose of the Theory of Computation: Develop formal mathematical models of computation that reflect real-world computers. Nowadays, the Theory of Computation can be
More informationCS 68: BIOINFORMATICS. Prof. Sara Mathieson Swarthmore College Spring 2018
CS 68: BIOINFORMATICS Prof. Sara Mathieson Swarthmore College Spring 2018 Outline: Jan 31 DBG assembly in practice Velvet assembler Evaluation of assemblies (if time) Start: string alignment Candidate
More informationIntroduction to Graph Theory
Introduction to Graph Theory Tandy Warnow January 20, 2017 Graphs Tandy Warnow Graphs A graph G = (V, E) is an object that contains a vertex set V and an edge set E. We also write V (G) to denote the vertex
More informationMath 4410 Fall 2010 Exam 3. Show your work. A correct answer without any scratch work or justification may not receive much credit.
Math 4410 Fall 2010 Exam 3 Name: Directions: Complete all six questions. Show your work. A correct answer without any scratch work or justification may not receive much credit. You may not use any notes,
More informationLectures by Volker Heun, Daniel Huson and Knut Reinert, in particular last years lectures
4 FastA and the chaining problem We will discuss: Heuristics used by the FastA program for sequence alignment Chaining problem 4.1 Sources for this lecture Lectures by Volker Heun, Daniel Huson and Knut
More informationSequence Assembly. BMI/CS 576 Mark Craven Some sequencing successes
Sequence Assembly BMI/CS 576 www.biostat.wisc.edu/bmi576/ Mark Craven craven@biostat.wisc.edu Some sequencing successes Yersinia pestis Cannabis sativa The sequencing problem We want to determine the identity
More informationCpSc 421 Final Solutions
CpSc 421 Final Solutions Do any eight of the ten problems below. If you attempt more than eight problems, please indicate which ones to grade (otherwise we will make a random choice). This allows you to
More informationPractical Session No. 12 Graphs, BFS, DFS, Topological sort
Practical Session No. 12 Graphs, BFS, DFS, Topological sort Graphs and BFS Graph G = (V, E) Graph Representations (V G ) v1 v n V(G) = V - Set of all vertices in G E(G) = E - Set of all edges (u,v) in
More informationNP-Completeness. Algorithms
NP-Completeness Algorithms The NP-Completeness Theory Objective: Identify a class of problems that are hard to solve. Exponential time is hard. Polynomial time is easy. Why: Do not try to find efficient
More informationDiscrete Mathematics Course Review 3
21-228 Discrete Mathematics Course Review 3 This document contains a list of the important definitions and theorems that have been covered thus far in the course. It is not a complete listing of what has
More informationarxiv: v1 [cs.ds] 1 Jan 2013
2D Lyndon Words and Applications arxiv:1301.0103v1 [cs.ds] 1 Jan 2013 Shoshana Marcus Dina Sokol Abstract A Lyndon word is a primitive string which is lexicographically smallest among cyclic permutations
More informationStrong edge coloring of subcubic graphs
Strong edge coloring of subcubic graphs Hervé Hocquard a, Petru Valicov a a LaBRI (Université Bordeaux 1), 351 cours de la Libération, 33405 Talence Cedex, France Abstract A strong edge colouring of a
More informationGenerating edge covers of path graphs
Generating edge covers of path graphs J. Raymundo Marcial-Romero, J. A. Hernández, Vianney Muñoz-Jiménez and Héctor A. Montes-Venegas Facultad de Ingeniería, Universidad Autónoma del Estado de México,
More informationChapter 4. Triangular Sum Labeling
Chapter 4 Triangular Sum Labeling 32 Chapter 4. Triangular Sum Graphs 33 4.1 Introduction This chapter is focused on triangular sum labeling of graphs. As every graph is not a triangular sum graph it is
More informationBIL694-Lecture 1: Introduction to Graphs
BIL694-Lecture 1: Introduction to Graphs Lecturer: Lale Özkahya Resources for the presentation: http://www.math.ucsd.edu/ gptesler/184a/calendar.html http://www.inf.ed.ac.uk/teaching/courses/dmmr/ Outline
More information2-uniform words: cycle graphs, and an algorithm to verify specific word-representations of graphs
: cycle graphs, and an algorithm to verify specific word-representations of graphs, Mrityunjay Singh, Benny K. George Indian Institute of Technology, Guwahati February 20, 2018 Introduction What are word-representations
More informationDischarging and reducible configurations
Discharging and reducible configurations Zdeněk Dvořák March 24, 2018 Suppose we want to show that graphs from some hereditary class G are k- colorable. Clearly, we can restrict our attention to graphs
More informationMAT 145: PROBLEM SET 6
MAT 145: PROBLEM SET 6 DUE TO FRIDAY MAR 8 Abstract. This problem set corresponds to the eighth week of the Combinatorics Course in the Winter Quarter 2019. It was posted online on Friday Mar 1 and is
More informationVertex-Colouring Edge-Weightings
Vertex-Colouring Edge-Weightings L. Addario-Berry a, K. Dalal a, C. McDiarmid b, B. A. Reed a and A. Thomason c a School of Computer Science, McGill University, University St. Montreal, QC, H3A A7, Canada
More informationCSE 203A: Karger s Min-Cut Algorithm (Lecture Date: 5/11/06)
CSE 03A: Karger s Min-Cut Algorithm (Lecture Date: 5/11/06) Evan Ettinger May 19, 006 1 General Min-Cut Problem There are typically main types of cut problems. The s-t cut problem asks how we can find
More informationCompatible circuits in eulerian digraphs
Compatible circuits in eulerian digraphs James Carraher University of Nebraska Lincoln s-jcarrah1@math.unl.edu Joint Work with Stephen Hartke March 2012 James Carraher (UNL) Compatible circuits in eulerian
More informationCyclic matching sequencibility of graphs
AUSTRALASIAN JOURNAL OF COMBINATORICS Volume 53 (01), Pages 45 56 Cyclic matching sequencibility of graphs Richard A. Brualdi Kathleen P. Kiernan Seth A. Meyer Department of Mathematics University of Wisconsin
More informationCS473-Algorithms I. Lecture 13-A. Graphs. Cevdet Aykanat - Bilkent University Computer Engineering Department
CS473-Algorithms I Lecture 3-A Graphs Graphs A directed graph (or digraph) G is a pair (V, E), where V is a finite set, and E is a binary relation on V The set V: Vertex set of G The set E: Edge set of
More informationRead Mapping. de Novo Assembly. Genomics: Lecture #2 WS 2014/2015
Mapping de Novo Assembly Institut für Medizinische Genetik und Humangenetik Charité Universitätsmedizin Berlin Genomics: Lecture #2 WS 2014/2015 Today Genome assembly: the basics Hamiltonian and Eulerian
More informationAztec diamond. An Aztec diamond of order n is the union of the unit squares with lattice point coordinates in the region given by...
Aztec diamond An Aztec diamond of order n is the union of the unit squares with lattice point coordinates in the region given by x + y n + 1 Aztec diamond An Aztec diamond of order n is the union of the
More informationA note on the number of edges guaranteeing a C 4 in Eulerian bipartite digraphs
A note on the number of edges guaranteeing a C 4 in Eulerian bipartite digraphs Jian Shen Department of Mathematics Southwest Texas State University San Marcos, TX 78666 email: js48@swt.edu Raphael Yuster
More informationIntroduction aux Systèmes Collaboratifs Multi-Agents
M1 EEAII - Découverte de la Recherche (ViRob) Introduction aux Systèmes Collaboratifs Multi-Agents UPJV, Département EEA Fabio MORBIDI Laboratoire MIS Équipe Perception et Robotique E-mail: fabio.morbidi@u-picardie.fr
More informationMaster Theorem, Introduction to Graphs
Master Theorem, Introduction to Graphs CSE21 Winter 2017, Day 10 (B00), Day 6-7 (A00) February 1, 2017 http://vlsicad.ucsd.edu/courses/cse21-w17 Divide & Conquer: General Strategy Divide the problem of
More information