CSCI2950-C Lecture 4 DNA Sequencing and Fragment Assembly

Size: px
Start display at page:

Download "CSCI2950-C Lecture 4 DNA Sequencing and Fragment Assembly"

Transcription

1 CSCI2950-C Lecture 4 DNA Sequencing and Fragment Assembly Ben Raphael Sept. 22, l-mer composition Def: Given string s, the Spectrum ( s, l ) is unordered multiset of all possible (n l + 1) l-mers in a string s of length n The order of individual elements in Spectrum ( s, l ) does not matter For s = TATGGTGC all of the following are equivalent representations of Spectrum ( s, 3 ): {TAT, ATG, TGG, GGT, GTG, TGC} {ATG, GGT, GTG, TAT, TGC, TGG} {TGG, TGC, TAT, GTG, GGT, ATG} 1

2 The SBH Problem Goal: Reconstruct a string from its l-mer composition Input: A multiset S, representing all l-mers from an (unknown) string s Output: String s such that Spectrum ( s,l ) = S SBH: An Example DNA Sequencing AGT CCA ATC ATCCAGT TCC CAG S = { ATC, CCA, CAG, TCC, AGT } 2

3 SBH: Hamiltonian Path Approach S = { ATG AGG TGC TCC GTC GGT GCA CAG } Directed graph G = (S,E). e s,t E if suffix of s = prefix of t, where length(suffix/prefix) = l - 1 H ATG AGG TGC TCC GTC GGT GCA CAG ATG C A G G T C C Path visited every VERTEX once: Hamiltonian Path SBH: Hamiltonian Path Approach A more complicated graph: S = { ATG TGG TGC GTG GGC GCA GCG CGT } 3

4 SBH: Hamiltonian Path Approach S = { ATG TGG TGC GTG GGC GCA GCG CGT } Path 1: ATGCGTGGCA Path 2: ATGGCGTGCA SBH: Eulerian Path Approach S = { ATG, TGG, TGC, GTG, GGC, GCA, GCG, CGT } Vertices correspond to ( l 1 ) mers : { AT, TG, GC, GG, GT, CA, CG } Edges correspond to l mers from S GT CG (l-1) debruijn graph of S: Vertices: (l-1)-mers in S Directed edges: consecutive (l-1) mers in S AT TG GC CA GG Find path that visits every EDGE once 4

5 SBH: Eulerian Path Approach S = {ATG, TGG, TGC, GTG, GGC, GCA, GCG, CGT } Two different paths give different sequence reconstructions: GT CG GT CG AT TG GC CA AT TG GC CA GG GG ATGGCGTGCA ATGCGTGGCA Euler Theorem A graph is balanced if for every vertex the number of incoming edges equals to the number of outgoing edges: in(v)=out(v) Theorem: A connected graph is Eulerian if and only if each of its vertices is balanced. 5

6 Euler Theorem: Proof Eulerian balanced for every edge entering v (incoming edge) there exists an edge leaving v (outgoing edge). Therefore in(v)=out(v) Balanced Eulerian??? Algorithm for Constructing an Eulerian Cycle a. Start with an arbitrary vertex v and form an arbitrary cycle with unused edges until a dead end is reached. Since the graph is Eulerian this dead end is necessarily the starting point, i.e., vertex v. 6

7 Algorithm for Constructing an Eulerian Cycle (cont d) b. If cycle from (a) above is not an Eulerian cycle, it must contain a vertex w, which has untraversed edges. Perform step (a) again, using vertex w as the starting point. Once again, we will end up in the starting vertex w. Algorithm for Constructing an Eulerian Cycle (cont d) c. Combine the cycles from (a) and (b) into a single cycle and iterate step (b). 7

8 Euler Theorem: Extension Theorem: A connected graph has an Eulerian path if and only if it contains at most two semi-balanced vertices and all other vertices are balanced. Back to sequence assembly Overlap Graph Each vertex represents a read from the original sequence. Vertices from repeats are connected to many others. Repeat Repeat Repeat Find a path visiting every VERTEX exactly once: Hamiltonian path problem 8

9 Fragment Assembly: Overlap Graph Find a path visiting every VERTEX exactly once in the OVERLAP graph: Hamiltonian path problem NP-complete: algorithms unknown Repeat Graph: Eulerian Approach Repeat Repeat Repeat Suppose each repeat and unique string (non-repeat) represented by directed edge. Edge of multiplicity 3 Genome sequence is path visiting every EDGE exactly once: Eulerian path problem 9

10 Multiple Repeats Repeat1 Repeat2 Repeat1 Repeat2 Can be easily constructed with any number of repeats Approaches to Fragment Assembly (cont d) Find a path visiting every EDGE exactly once in the REPEAT graph: Eulerian path problem Linear time algorithms are known 10

11 Repeat Graph (a) DNA sequence with a triple repeat R; (b) the layout graph; (c) construction of the de Bruijn graph by gluing repeats; (d) de Bruijn graph. Pevzner P. A. et.al. PNAS 2001;98: Building Repeat Graph Problem: Construct the repeat graph from a collection of reads.? Solution: Break the reads into smaller pieces. 11

12 Building Repeat Graph Reads are constructed from an original sequence in lengths that allow biologists a high level of certainty. They are then broken again into k-mers Repeat Graph Vertices correspond to ( k 1 ) mers in each read Edges correspond to k mers in each read Example: S = ATGGCGTGCA Reads = {ATGGC, GGCGTG, GTGCA} 3-mers = { ATG, TGG, TGC, GTG, GGC, GCA, GCG, CGT } GT CG Two Eulerian paths: (visit every EDGE once) AT TG GC CA ATGCGTGGCA ATGGCGTGCA GG 12

13 Repeat Graph Vertices correspond to ( k 1 ) mers in each read Edges correspond to k mers in each read Example: S = ATGGCGTGCA Reads = {ATGGC, GGCGTG, GTGCA} 3-mers = { ATG, TGG, TGC, GTG, GGC, GCA, GCG, CGT } GT CG AT TG GC CA GG Reads in Repeat Graph S = {ATG, TGG, TGC, GTG, GGC, GCA, GCG, CGT } Two different paths give different sequence reconstructions: GT CG AT TG GC CA GG ATGGCGTGCA 13

14 Reads in Repeat Graph Example: S = ATGGCGTGCA Reads = {ATGGC, GGCGTG, GTGCA} 3-mers = { ATG, TGG, TGC, GTG, GGC, GCA, GCG, CGT } GT CG AT TG GC GG ATGCGTGGCA CA Not all Eulerian paths preserve reads! Eulerian Superpath Example: S = ATGGCGTGCA Reads = {ATGGC, GGCGTG, GTGCA} 3-mers = { ATG, TGG, TGC, GTG, GGC, GCA, GCG, CGT } Eulerian superpath: an Eulerian path that contains set of paths (reads) as subpaths. GT CG AT TG GC CA ATGCGTGGCA ATGGCGTGCA GG 14

15 EULER Fragment Assembly Approach Input: Reads s 1,, s N Further subdivide reads into k-mers (k = 20) Build repeat graph on resulting k-mers Each read is path in resulting graph. Solve Eulerian Superpath Problem. Given an Eulerian graph and a collection of paths in this graph, find an Eulerian path in this graph that contains all these paths as subpaths. Simplifying the Repeat Graph Collapse paths Concat(1,2,3,4) Collapse tree-like structures with unique path Unzip edges A B C D A B C C D 15

16 Additional challenges in EULER Approach 1. Errors in reads 2. Reverse-complement of DNA string 3. Using mate-pair information to simplify the repeat graph. 4. Multiplicities of edges generally unknown (Copy number problem). Sequencing Errors If an error exists in one of the reads, the error will be perpetuated among all of the k-mers broken from that read. 16

17 Error Correction from k-mers Consensus first approach to error correction. Let G k = {k-mers in genome G} Let T = {all k-tuples appearing in > M reads} G k T. Error Correction from k-mers A string s is called a T-string if all its l-tuples belong to T. Spectral Alignment Problem. Given a string s and a spectrum T, find the minimum number of mutations in s that transform s into a T-string. Solving Spectral Alignment Problem attempts to eliminate most point mutation errors before reconstructing the original sequence. Not perfect! 17

18 Forward and Reverse Complements 5 3 DNA is copied in 5 3 direction. 3 5 We obtain reads from both strands of DNA. Do not know strand of origin. s = CAGT s = ACTG (reverse complement) Forward and Reverse Complements 5 3 DNA is copied in 5 3 direction. 3 5 We want assembly of either strand, but NOT a mix of both. 18

19 5 Forward and Reverse Complements 3 In Euler assembler, include reverse complement of each read. 3 5 assume that S contains a complement of every read and that the de Bruijn graph can be partitioned into two subgraphs (the canonical one and its reverse complement) Alternative approaches use bidirected graphs. Sources Serafim Batzoglou CS262_2006/ (Sequencing slides) (Euler slides) Euler assembler. Pevzner, Tang, and Waterman (PNAS 2001): on website 19

10/15/2009 Comp 590/Comp Fall

10/15/2009 Comp 590/Comp Fall Lecture 13: Graph Algorithms Study Chapter 8.1 8.8 10/15/2009 Comp 590/Comp 790-90 Fall 2009 1 The Bridge Obsession Problem Find a tour crossing every bridge just once Leonhard Euler, 1735 Bridges of Königsberg

More information

DNA Sequencing The Shortest Superstring & Traveling Salesman Problems Sequencing by Hybridization

DNA Sequencing The Shortest Superstring & Traveling Salesman Problems Sequencing by Hybridization Eulerian & Hamiltonian Cycle Problems DNA Sequencing The Shortest Superstring & Traveling Salesman Problems Sequencing by Hybridization The Bridge Obsession Problem Find a tour crossing every bridge just

More information

10/8/13 Comp 555 Fall

10/8/13 Comp 555 Fall 10/8/13 Comp 555 Fall 2013 1 Find a tour crossing every bridge just once Leonhard Euler, 1735 Bridges of Königsberg 10/8/13 Comp 555 Fall 2013 2 Find a cycle that visits every edge exactly once Linear

More information

Sequence Assembly Required!

Sequence Assembly Required! Sequence Assembly Required! 1 October 3, ISMB 20172007 1 Sequence Assembly Genome Sequenced Fragments (reads) Assembled Contigs Finished Genome 2 Greedy solution is bounded 3 Typical assembly strategy

More information

Graph Algorithms in Bioinformatics

Graph Algorithms in Bioinformatics Graph Algorithms in Bioinformatics Computational Biology IST Ana Teresa Freitas 2015/2016 Sequencing Clone-by-clone shotgun sequencing Human Genome Project Whole-genome shotgun sequencing Celera Genomics

More information

Sequencing. Computational Biology IST Ana Teresa Freitas 2011/2012. (BACs) Whole-genome shotgun sequencing Celera Genomics

Sequencing. Computational Biology IST Ana Teresa Freitas 2011/2012. (BACs) Whole-genome shotgun sequencing Celera Genomics Computational Biology IST Ana Teresa Freitas 2011/2012 Sequencing Clone-by-clone shotgun sequencing Human Genome Project Whole-genome shotgun sequencing Celera Genomics (BACs) 1 Must take the fragments

More information

Algorithms for Bioinformatics

Algorithms for Bioinformatics Adapted from slides by Alexandru Tomescu, Leena Salmela and Veli Mäkinen, which are partly from http://bix.ucsd.edu/bioalgorithms/slides.php 58670 Algorithms for Bioinformatics Lecture 5: Graph Algorithms

More information

Algorithms for Bioinformatics

Algorithms for Bioinformatics Adapted from slides by Alexandru Tomescu, Leena Salmela and Veli Mäkinen, which are partly from http://bix.ucsd.edu/bioalgorithms/slides.php 582670 Algorithms for Bioinformatics Lecture 3: Graph Algorithms

More information

DNA Fragment Assembly

DNA Fragment Assembly Algorithms in Bioinformatics Sami Khuri Department of Computer Science San José State University San José, California, USA khuri@cs.sjsu.edu www.cs.sjsu.edu/faculty/khuri DNA Fragment Assembly Overlap

More information

Graph Algorithms in Bioinformatics

Graph Algorithms in Bioinformatics Graph Algorithms in Bioinformatics Bioinformatics: Issues and Algorithms CSE 308-408 Fall 2007 Lecture 13 Lopresti Fall 2007 Lecture 13-1 - Outline Introduction to graph theory Eulerian & Hamiltonian Cycle

More information

Genome 373: Genome Assembly. Doug Fowler

Genome 373: Genome Assembly. Doug Fowler Genome 373: Genome Assembly Doug Fowler What are some of the things we ve seen we can do with HTS data? We ve seen that HTS can enable a wide variety of analyses ranging from ID ing variants to genome-

More information

DNA Sequencing. Overview

DNA Sequencing. Overview BINF 3350, Genomics and Bioinformatics DNA Sequencing Young-Rae Cho Associate Professor Department of Computer Science Baylor University Overview Backgrounds Eulerian Cycles Problem Hamiltonian Cycles

More information

Genome Reconstruction: A Puzzle with a Billion Pieces Phillip E. C. Compeau and Pavel A. Pevzner

Genome Reconstruction: A Puzzle with a Billion Pieces Phillip E. C. Compeau and Pavel A. Pevzner Genome Reconstruction: A Puzzle with a Billion Pieces Phillip E. C. Compeau and Pavel A. Pevzner Outline I. Problem II. Two Historical Detours III.Example IV.The Mathematics of DNA Sequencing V.Complications

More information

Sequence Assembly. BMI/CS 576 Mark Craven Some sequencing successes

Sequence Assembly. BMI/CS 576  Mark Craven Some sequencing successes Sequence Assembly BMI/CS 576 www.biostat.wisc.edu/bmi576/ Mark Craven craven@biostat.wisc.edu Some sequencing successes Yersinia pestis Cannabis sativa The sequencing problem We want to determine the identity

More information

DNA Fragment Assembly

DNA Fragment Assembly SIGCSE 009 Algorithms in Bioinformatics Sami Khuri Department of Computer Science San José State University San José, California, USA khuri@cs.sjsu.edu www.cs.sjsu.edu/faculty/khuri DNA Fragment Assembly

More information

Eulerian tours. Russell Impagliazzo and Miles Jones Thanks to Janine Tiefenbruck. April 20, 2016

Eulerian tours. Russell Impagliazzo and Miles Jones Thanks to Janine Tiefenbruck.  April 20, 2016 Eulerian tours Russell Impagliazzo and Miles Jones Thanks to Janine Tiefenbruck http://cseweb.ucsd.edu/classes/sp16/cse21-bd/ April 20, 2016 Seven Bridges of Konigsberg Is there a path that crosses each

More information

Eulerian Tours and Fleury s Algorithm

Eulerian Tours and Fleury s Algorithm Eulerian Tours and Fleury s Algorithm CSE21 Winter 2017, Day 12 (B00), Day 8 (A00) February 8, 2017 http://vlsicad.ucsd.edu/courses/cse21-w17 Vocabulary Path (or walk): describes a route from one vertex

More information

Purpose of sequence assembly

Purpose of sequence assembly Sequence Assembly Purpose of sequence assembly Reconstruct long DNA/RNA sequences from short sequence reads Genome sequencing RNA sequencing for gene discovery Amplicon sequencing But not for transcript

More information

Genome Reconstruction: A Puzzle with a Billion Pieces. Phillip Compeau Carnegie Mellon University Computational Biology Department

Genome Reconstruction: A Puzzle with a Billion Pieces. Phillip Compeau Carnegie Mellon University Computational Biology Department http://cbd.cmu.edu Genome Reconstruction: A Puzzle with a Billion Pieces Phillip Compeau Carnegie Mellon University Computational Biology Department Eternity II: The Highest-Stakes Puzzle in History Courtesy:

More information

Graphs and Puzzles. Eulerian and Hamiltonian Tours.

Graphs and Puzzles. Eulerian and Hamiltonian Tours. Graphs and Puzzles. Eulerian and Hamiltonian Tours. CSE21 Winter 2017, Day 11 (B00), Day 7 (A00) February 3, 2017 http://vlsicad.ucsd.edu/courses/cse21-w17 Exam Announcements Seating Chart on Website Good

More information

RESEARCH TOPIC IN BIOINFORMANTIC

RESEARCH TOPIC IN BIOINFORMANTIC RESEARCH TOPIC IN BIOINFORMANTIC GENOME ASSEMBLY Instructor: Dr. Yufeng Wu Noted by: February 25, 2012 Genome Assembly is a kind of string sequencing problems. As we all know, the human genome is very

More information

Genome Sequencing Algorithms

Genome Sequencing Algorithms Genome Sequencing Algorithms Phillip Compaeu and Pavel Pevzner Bioinformatics Algorithms: an Active Learning Approach Leonhard Euler (1707 1783) William Hamilton (1805 1865) Nicolaas Govert de Bruijn (1918

More information

by the Genevestigator program (www.genevestigator.com). Darker blue color indicates higher gene expression.

by the Genevestigator program (www.genevestigator.com). Darker blue color indicates higher gene expression. Figure S1. Tissue-specific expression profile of the genes that were screened through the RHEPatmatch and root-specific microarray filters. The gene expression profile (heat map) was drawn by the Genevestigator

More information

02-711/ Computational Genomics and Molecular Biology Fall 2016

02-711/ Computational Genomics and Molecular Biology Fall 2016 Literature assignment 2 Due: Nov. 3 rd, 2016 at 4:00pm Your name: Article: Phillip E C Compeau, Pavel A. Pevzner, Glenn Tesler. How to apply de Bruijn graphs to genome assembly. Nature Biotechnology 29,

More information

Pyramidal and Chiral Groupings of Gold Nanocrystals Assembled Using DNA Scaffolds

Pyramidal and Chiral Groupings of Gold Nanocrystals Assembled Using DNA Scaffolds Pyramidal and Chiral Groupings of Gold Nanocrystals Assembled Using DNA Scaffolds February 27, 2009 Alexander Mastroianni, Shelley Claridge, A. Paul Alivisatos Department of Chemistry, University of California,

More information

I519 Introduction to Bioinformatics, Genome assembly. Yuzhen Ye School of Informatics & Computing, IUB

I519 Introduction to Bioinformatics, Genome assembly. Yuzhen Ye School of Informatics & Computing, IUB I519 Introduction to Bioinformatics, 2014 Genome assembly Yuzhen Ye (yye@indiana.edu) School of Informatics & Computing, IUB Contents Genome assembly problem Approaches Comparative assembly The string

More information

Bioinformatics: Fragment Assembly. Walter Kosters, Universiteit Leiden. IPA Algorithms&Complexity,

Bioinformatics: Fragment Assembly. Walter Kosters, Universiteit Leiden. IPA Algorithms&Complexity, Bioinformatics: Fragment Assembly Walter Kosters, Universiteit Leiden IPA Algorithms&Complexity, 29.6.2007 www.liacs.nl/home/kosters/ 1 Fragment assembly Problem We study the following problem from bioinformatics:

More information

Read Mapping. de Novo Assembly. Genomics: Lecture #2 WS 2014/2015

Read Mapping. de Novo Assembly. Genomics: Lecture #2 WS 2014/2015 Mapping de Novo Assembly Institut für Medizinische Genetik und Humangenetik Charité Universitätsmedizin Berlin Genomics: Lecture #2 WS 2014/2015 Today Genome assembly: the basics Hamiltonian and Eulerian

More information

de novo assembly Simon Rasmussen 36626: Next Generation Sequencing analysis DTU Bioinformatics Next Generation Sequencing Analysis

de novo assembly Simon Rasmussen 36626: Next Generation Sequencing analysis DTU Bioinformatics Next Generation Sequencing Analysis de novo assembly Simon Rasmussen 36626: Next Generation Sequencing analysis DTU Bioinformatics 27626 - Next Generation Sequencing Analysis Generalized NGS analysis Data size Application Assembly: Compare

More information

DNA Fragment Assembly Algorithms: Toward a Solution for Long Repeats

DNA Fragment Assembly Algorithms: Toward a Solution for Long Repeats San Jose State University SJSU ScholarWorks Master's Projects Master's Theses and Graduate Research 2008 DNA Fragment Assembly Algorithms: Toward a Solution for Long Repeats Ching Li San Jose State University

More information

BMI/CS 576 Fall 2015 Midterm Exam

BMI/CS 576 Fall 2015 Midterm Exam BMI/CS 576 Fall 2015 Midterm Exam Prof. Colin Dewey Tuesday, October 27th, 2015 11:00am-12:15pm Name: KEY Write your answers on these pages and show your work. You may use the back sides of pages as necessary.

More information

CSCI 1820 Notes. Scribes: tl40. February 26 - March 02, Estimating size of graphs used to build the assembly.

CSCI 1820 Notes. Scribes: tl40. February 26 - March 02, Estimating size of graphs used to build the assembly. CSCI 1820 Notes Scribes: tl40 February 26 - March 02, 2018 Chapter 2. Genome Assembly Algorithms 2.1. Statistical Theory 2.2. Algorithmic Theory Idury-Waterman Algorithm Estimating size of graphs used

More information

Supplementary Table 1. Data collection and refinement statistics

Supplementary Table 1. Data collection and refinement statistics Supplementary Table 1. Data collection and refinement statistics APY-EphA4 APY-βAla8.am-EphA4 Crystal Space group P2 1 P2 1 Cell dimensions a, b, c (Å) 36.27, 127.7, 84.57 37.22, 127.2, 84.6 α, β, γ (

More information

TCGR: A Novel DNA/RNA Visualization Technique

TCGR: A Novel DNA/RNA Visualization Technique TCGR: A Novel DNA/RNA Visualization Technique Donya Quick and Margaret H. Dunham Department of Computer Science and Engineering Southern Methodist University Dallas, Texas 75275 dquick@mail.smu.edu, mhd@engr.smu.edu

More information

DNA arrays. and their various applications. Algorithmen der Bioinformatik II - SoSe Christoph Dieterich

DNA arrays. and their various applications. Algorithmen der Bioinformatik II - SoSe Christoph Dieterich DNA arrays and their various applications Algorithmen der Bioinformatik II - SoSe 2007 Christoph Dieterich 1 Introduction Motivation DNA microarray is a parallel approach to gene screening and target identification.

More information

(for more info see:

(for more info see: Genome assembly (for more info see: http://www.cbcb.umd.edu/research/assembly_primer.shtml) Introduction Sequencing technologies can only "read" short fragments from a genome. Reconstructing the entire

More information

Appendix A. Example code output. Chapter 1. Chapter 3

Appendix A. Example code output. Chapter 1. Chapter 3 Appendix A Example code output This is a compilation of output from selected examples. Some of these examples requires exernal input from e.g. STDIN, for such examples the interaction with the program

More information

6 Anhang. 6.1 Transgene Su(var)3-9-Linien. P{GS.ry + hs(su(var)3-9)egfp} 1 I,II,III,IV 3 2I 3 3 I,II,III 3 4 I,II,III 2 5 I,II,III,IV 3

6 Anhang. 6.1 Transgene Su(var)3-9-Linien. P{GS.ry + hs(su(var)3-9)egfp} 1 I,II,III,IV 3 2I 3 3 I,II,III 3 4 I,II,III 2 5 I,II,III,IV 3 6.1 Transgene Su(var)3-9-n P{GS.ry + hs(su(var)3-9)egfp} 1 I,II,III,IV 3 2I 3 3 I,II,III 3 4 I,II,II 5 I,II,III,IV 3 6 7 I,II,II 8 I,II,II 10 I,II 3 P{GS.ry + UAS(Su(var)3-9)EGFP} A AII 3 B P{GS.ry + (10.5kbSu(var)3-9EGFP)}

More information

SUPPLEMENTARY INFORMATION. Systematic evaluation of CRISPR-Cas systems reveals design principles for genome editing in human cells

SUPPLEMENTARY INFORMATION. Systematic evaluation of CRISPR-Cas systems reveals design principles for genome editing in human cells SUPPLEMENTARY INFORMATION Systematic evaluation of CRISPR-Cas systems reveals design principles for genome editing in human cells Yuanming Wang 1,2,7, Kaiwen Ivy Liu 2,7, Norfala-Aliah Binte Sutrisnoh

More information

Combinatorial Pattern Matching. CS 466 Saurabh Sinha

Combinatorial Pattern Matching. CS 466 Saurabh Sinha Combinatorial Pattern Matching CS 466 Saurabh Sinha Genomic Repeats Example of repeats: ATGGTCTAGGTCCTAGTGGTC Motivation to find them: Genomic rearrangements are often associated with repeats Trace evolutionary

More information

Reducing Genome Assembly Complexity with Optical Maps

Reducing Genome Assembly Complexity with Optical Maps Reducing Genome Assembly Complexity with Optical Maps Lee Mendelowitz LMendelo@math.umd.edu Advisor: Dr. Mihai Pop Computer Science Department Center for Bioinformatics and Computational Biology mpop@umiacs.umd.edu

More information

HP22.1 Roth Random Primer Kit A für die RAPD-PCR

HP22.1 Roth Random Primer Kit A für die RAPD-PCR HP22.1 Roth Random Kit A für die RAPD-PCR Kit besteht aus 20 Einzelprimern, jeweils aufgeteilt auf 2 Reaktionsgefäße zu je 1,0 OD Achtung: Angaben beziehen sich jeweils auf ein Reaktionsgefäß! Sequenz

More information

Solutions Exercise Set 3 Author: Charmi Panchal

Solutions Exercise Set 3 Author: Charmi Panchal Solutions Exercise Set 3 Author: Charmi Panchal Problem 1: Suppose we have following fragments: f1 = ATCCTTAACCCC f2 = TTAACTCA f3 = TTAATACTCCC f4 = ATCTTTC f5 = CACTCCCACACA f6 = CACAATCCTTAACCC f7 =

More information

Introduction to Genome Assembly. Tandy Warnow

Introduction to Genome Assembly. Tandy Warnow Introduction to Genome Assembly Tandy Warnow 2 Shotgun DNA Sequencing DNA target sample SHEAR & SIZE End Reads / Mate Pairs 550bp 10,000bp Not all sequencing technologies produce mate-pairs. Different

More information

DNA Sequence Assembly and Multiple Sequence Alignment by an Eulerian Path Approach

DNA Sequence Assembly and Multiple Sequence Alignment by an Eulerian Path Approach DNA Sequence Assembly and Multiple Sequence Alignment by an Eulerian Path Approach Yu Zhang Department of Mathematics University of Southern California Los Angeles, CA 90089-1113 Phone: 213-821-2231 yuzhang@usc.edu

More information

A THEORETICAL ANALYSIS OF SCALABILITY OF THE PARALLEL GENOME ASSEMBLY ALGORITHMS

A THEORETICAL ANALYSIS OF SCALABILITY OF THE PARALLEL GENOME ASSEMBLY ALGORITHMS A THEORETICAL ANALYSIS OF SCALABILITY OF THE PARALLEL GENOME ASSEMBLY ALGORITHMS Munib Ahmed, Ishfaq Ahmad Department of Computer Science and Engineering, University of Texas At Arlington, Arlington, Texas

More information

Assembly in the Clouds

Assembly in the Clouds Assembly in the Clouds Michael Schatz October 13, 2010 Beyond the Genome Shredded Book Reconstruction Dickens accidentally shreds the first printing of A Tale of Two Cities Text printed on 5 long spools

More information

CS681: Advanced Topics in Computational Biology

CS681: Advanced Topics in Computational Biology CS681: Advanced Topics in Computational Biology Can Alkan EA224 calkan@cs.bilkent.edu.tr Week 7 Lectures 2-3 http://www.cs.bilkent.edu.tr/~calkan/teaching/cs681/ Genome Assembly Test genome Random shearing

More information

IDBA - A Practical Iterative de Bruijn Graph De Novo Assembler

IDBA - A Practical Iterative de Bruijn Graph De Novo Assembler IDBA - A Practical Iterative de Bruijn Graph De Novo Assembler Yu Peng, Henry Leung, S.M. Yiu, Francis Y.L. Chin Department of Computer Science, The University of Hong Kong Pokfulam Road, Hong Kong {ypeng,

More information

BLAST & Genome assembly

BLAST & Genome assembly BLAST & Genome assembly Solon P. Pissis Tomáš Flouri Heidelberg Institute for Theoretical Studies May 15, 2014 1 BLAST What is BLAST? The algorithm 2 Genome assembly De novo assembly Mapping assembly 3

More information

Reducing Genome Assembly Complexity with Optical Maps Mid-year Progress Report

Reducing Genome Assembly Complexity with Optical Maps Mid-year Progress Report Reducing Genome Assembly Complexity with Optical Maps Mid-year Progress Report Lee Mendelowitz LMendelo@math.umd.edu Advisor: Dr. Mihai Pop Computer Science Department Center for Bioinformatics and Computational

More information

A Genome Assembly Algorithm Designed for Single-Cell Sequencing

A Genome Assembly Algorithm Designed for Single-Cell Sequencing SPAdes A Genome Assembly Algorithm Designed for Single-Cell Sequencing Bankevich A, Nurk S, Antipov D, et al. SPAdes: a new genome assembly algorithm and its applications to single-cell sequencing. J Comput

More information

IDBA A Practical Iterative de Bruijn Graph De Novo Assembler

IDBA A Practical Iterative de Bruijn Graph De Novo Assembler IDBA A Practical Iterative de Bruijn Graph De Novo Assembler Yu Peng, Henry C.M. Leung, S.M. Yiu, and Francis Y.L. Chin Department of Computer Science, The University of Hong Kong Pokfulam Road, Hong Kong

More information

Bioinformatics-themed projects in Discrete Mathematics

Bioinformatics-themed projects in Discrete Mathematics Bioinformatics-themed projects in Discrete Mathematics Art Duval University of Texas at El Paso Joint Mathematics Meeting MAA Contributed Paper Session on Discrete Mathematics in the Undergraduate Curriculum

More information

warm-up exercise Representing Data Digitally goals for today proteins example from nature

warm-up exercise Representing Data Digitally goals for today proteins example from nature Representing Data Digitally Anne Condon September 6, 007 warm-up exercise pick two examples of in your everyday life* in what media are the is represented? is the converted from one representation to another,

More information

8.2 Paths and Cycles

8.2 Paths and Cycles 8.2 Paths and Cycles Degree a b c d e f Definition The degree of a vertex is the number of edges incident to it. A loop contributes 2 to the degree of the vertex. (G) is the maximum degree of G. δ(g) is

More information

Path Finding in Graphs. Problem Set #2 will be posted by tonight

Path Finding in Graphs. Problem Set #2 will be posted by tonight Path Finding in Graphs Problem Set #2 will be posted by tonight 1 From Last Time Two graphs representing 5-mers from the sequence "GACGGCGGCGCACGGCGCAA" Hamiltonian Path: Eulerian Path: Each k-mer is a

More information

Discrete Mathematics for CS Spring 2008 David Wagner Note 13. An Introduction to Graphs

Discrete Mathematics for CS Spring 2008 David Wagner Note 13. An Introduction to Graphs CS 70 Discrete Mathematics for CS Spring 2008 David Wagner Note 13 An Introduction to Graphs Formulating a simple, precise specification of a computational problem is often a prerequisite to writing a

More information

Discrete Mathematics and Probability Theory Fall 2013 Vazirani Note 7

Discrete Mathematics and Probability Theory Fall 2013 Vazirani Note 7 CS 70 Discrete Mathematics and Probability Theory Fall 2013 Vazirani Note 7 An Introduction to Graphs A few centuries ago, residents of the city of Königsberg, Prussia were interested in a certain problem.

More information

11/5/09 Comp 590/Comp Fall

11/5/09 Comp 590/Comp Fall 11/5/09 Comp 590/Comp 790-90 Fall 2009 1 Example of repeats: ATGGTCTAGGTCCTAGTGGTC Motivation to find them: Genomic rearrangements are often associated with repeats Trace evolutionary secrets Many tumors

More information

Degenerate Coding and Sequence Compacting

Degenerate Coding and Sequence Compacting ESI The Erwin Schrödinger International Boltzmanngasse 9 Institute for Mathematical Physics A-1090 Wien, Austria Degenerate Coding and Sequence Compacting Maya Gorel Kirzhner V.M. Vienna, Preprint ESI

More information

Discrete Mathematics and Probability Theory Fall 2009 Satish Rao,David Tse Note 8

Discrete Mathematics and Probability Theory Fall 2009 Satish Rao,David Tse Note 8 CS 70 Discrete Mathematics and Probability Theory Fall 2009 Satish Rao,David Tse Note 8 An Introduction to Graphs Formulating a simple, precise specification of a computational problem is often a prerequisite

More information

Problem statement. CS267 Assignment 3: Parallelize Graph Algorithms for de Novo Genome Assembly. Spring Example.

Problem statement. CS267 Assignment 3: Parallelize Graph Algorithms for de Novo Genome Assembly. Spring Example. CS267 Assignment 3: Problem statement 2 Parallelize Graph Algorithms for de Novo Genome Assembly k-mers are sequences of length k (alphabet is A/C/G/T). An extension is a simple symbol (A/C/G/T/F). The

More information

Efficient Selection of Unique and Popular Oligos for Large EST Databases. Stefano Lonardi. University of California, Riverside

Efficient Selection of Unique and Popular Oligos for Large EST Databases. Stefano Lonardi. University of California, Riverside Efficient Selection of Unique and Popular Oligos for Large EST Databases Stefano Lonardi University of California, Riverside joint work with Jie Zheng, Timothy Close, Tao Jiang University of California,

More information

Description of a genome assembler: CABOG

Description of a genome assembler: CABOG Theo Zimmermann Description of a genome assembler: CABOG CABOG (Celera Assembler with the Best Overlap Graph) is an assembler built upon the Celera Assembler, which, at first, was designed for Sanger sequencing,

More information

Sequence Design Problems in Discovery of Regulatory Elements

Sequence Design Problems in Discovery of Regulatory Elements Sequence Design Problems in Discovery of Regulatory Elements Yaron Orenstein, Bonnie Berger and Ron Shamir Regulatory Genomics workshop Simons Institute March 10th, 2016, Berkeley, CA Differentially methylated

More information

Omega: an Overlap-graph de novo Assembler for Metagenomics

Omega: an Overlap-graph de novo Assembler for Metagenomics Omega: an Overlap-graph de novo Assembler for Metagenomics B a h l e l H a i d e r, Ta e - H y u k A h n, B r i a n B u s h n e l l, J u a n j u a n C h a i, A l e x C o p e l a n d, C h o n g l e Pa n

More information

de Bruijn graphs for sequencing data

de Bruijn graphs for sequencing data de Bruijn graphs for sequencing data Rayan Chikhi CNRS Bonsai team, CRIStAL/INRIA, Univ. Lille 1 SMPGD 2016 1 MOTIVATION - de Bruijn graphs are instrumental for reference-free sequencing data analysis:

More information

CS 173, Lecture B Introduction to Genome Assembly (using Eulerian Graphs) Tandy Warnow

CS 173, Lecture B Introduction to Genome Assembly (using Eulerian Graphs) Tandy Warnow CS 173, Lecture B Introduction to Genome Assembly (using Eulerian Graphs) Tandy Warnow 2 Shotgun DNA Sequencing DNA target sample SHEAR & SIZE End Reads / Mate Pairs 550bp 10,000bp Not all sequencing technologies

More information

Digging into acceptor splice site prediction: an iterative feature selection approach

Digging into acceptor splice site prediction: an iterative feature selection approach Digging into acceptor splice site prediction: an iterative feature selection approach Yvan Saeys, Sven Degroeve, and Yves Van de Peer Department of Plant Systems Biology, Ghent University, Flanders Interuniversity

More information

7.36/7.91 recitation. DG Lectures 5 & 6 2/26/14

7.36/7.91 recitation. DG Lectures 5 & 6 2/26/14 7.36/7.91 recitation DG Lectures 5 & 6 2/26/14 1 Announcements project specific aims due in a little more than a week (March 7) Pset #2 due March 13, start early! Today: library complexity BWT and read

More information

SOLiD GFF File Format

SOLiD GFF File Format SOLiD GFF File Format 1 Introduction The GFF file is a text based repository and contains data and analysis results; colorspace calls, quality values (QV) and variant annotations. The inputs to the GFF

More information

Sequencing error correction

Sequencing error correction Sequencing error correction Ben Langmead Department of Computer Science You are free to use these slides. If you do, please sign the guestbook (www.langmead-lab.org/teaching-materials), or email me (ben.langmead@gmail.com)

More information

Genome Sequencing & Assembly. Slides by Carl Kingsford

Genome Sequencing & Assembly. Slides by Carl Kingsford Genome Sequencing & Assembly Slides by Carl Kingsford Genome Sequencing ACCGTCCAATTGG...! TGGCAGGTTAACC... E.g. human: 3 billion bases split into 23 chromosomes Main tool of traditional sequencing: DNA

More information

Reducing Genome Assembly Complexity with Optical Maps

Reducing Genome Assembly Complexity with Optical Maps Reducing Genome Assembly Complexity with Optical Maps AMSC 663 Mid-Year Progress Report 12/13/2011 Lee Mendelowitz Lmendelo@math.umd.edu Advisor: Mihai Pop mpop@umiacs.umd.edu Computer Science Department

More information

Constrained traversal of repeats with paired sequences

Constrained traversal of repeats with paired sequences RECOMB 2011 Satellite Workshop on Massively Parallel Sequencing (RECOMB-seq) 26-27 March 2011, Vancouver, BC, Canada; Short talk: 2011-03-27 12:10-12:30 (presentation: 15 minutes, questions: 5 minutes)

More information

Parallel de novo Assembly of Complex (Meta) Genomes via HipMer

Parallel de novo Assembly of Complex (Meta) Genomes via HipMer Parallel de novo Assembly of Complex (Meta) Genomes via HipMer Aydın Buluç Computational Research Division, LBNL May 23, 2016 Invited Talk at HiCOMB 2016 Outline and Acknowledgments Joint work (alphabetical)

More information

Lecture 4: Walks, Trails, Paths and Connectivity

Lecture 4: Walks, Trails, Paths and Connectivity Lecture 4: Walks, Trails, Paths and Connectivity Rosa Orellana Math 38 April 6, 2015 Graph Decompositions Def: A decomposition of a graph is a list of subgraphs such that each edge appears in exactly one

More information

Computational Molecular Biology

Computational Molecular Biology Computational Molecular Biology Erwin M. Bakker Lecture 2 Materials used from R. Shamir [2] and H.J. Hoogeboom [4]. 1 Molecular Biology Sequences DNA A, T, C, G RNA A, U, C, G Protein A, R, D, N, C E,

More information

CS261: A Second Course in Algorithms Lecture #16: The Traveling Salesman Problem

CS261: A Second Course in Algorithms Lecture #16: The Traveling Salesman Problem CS61: A Second Course in Algorithms Lecture #16: The Traveling Salesman Problem Tim Roughgarden February 5, 016 1 The Traveling Salesman Problem (TSP) In this lecture we study a famous computational problem,

More information

COUNTING AND PROBABILITY

COUNTING AND PROBABILITY CHAPTER 9 COUNTING AND PROBABILITY Copyright Cengage Learning. All rights reserved. SECTION 9.6 r-combinations with Repetition Allowed Copyright Cengage Learning. All rights reserved. r-combinations with

More information

Scalable Solutions for DNA Sequence Analysis

Scalable Solutions for DNA Sequence Analysis Scalable Solutions for DNA Sequence Analysis Michael Schatz Dec 4, 2009 JHU/UMD Joint Sequencing Meeting The Evolution of DNA Sequencing Year Genome Technology Cost 2001 Venter et al. Sanger (ABI) $300,000,000

More information

Machine Learning Classifiers

Machine Learning Classifiers Machine Learning Classifiers Outline Different types of learning problems Different types of learning algorithms Supervised learning Decision trees Naïve Bayes Perceptrons, Multi-layer Neural Networks

More information

Institute of Operating Systems and Computer Networks Algorithms Group. Network Algorithms. Tutorial 4: Matching and other stuff

Institute of Operating Systems and Computer Networks Algorithms Group. Network Algorithms. Tutorial 4: Matching and other stuff Institute of Operating Systems and Computer Networks Algorithms Group Network Algorithms Tutorial 4: Matching and other stuff Christian Rieck Matching 2 Matching A matching M in a graph is a set of pairwise

More information

CS 68: BIOINFORMATICS. Prof. Sara Mathieson Swarthmore College Spring 2018

CS 68: BIOINFORMATICS. Prof. Sara Mathieson Swarthmore College Spring 2018 CS 68: BIOINFORMATICS Prof. Sara Mathieson Swarthmore College Spring 2018 Outline: Jan 31 DBG assembly in practice Velvet assembler Evaluation of assemblies (if time) Start: string alignment Candidate

More information

Fundamental Properties of Graphs

Fundamental Properties of Graphs Chapter three In many real-life situations we need to know how robust a graph that represents a certain network is, how edges or vertices can be removed without completely destroying the overall connectivity,

More information

Introduction III. Graphs. Motivations I. Introduction IV

Introduction III. Graphs. Motivations I. Introduction IV Introduction I Graphs Computer Science & Engineering 235: Discrete Mathematics Christopher M. Bourke cbourke@cse.unl.edu Graph theory was introduced in the 18th century by Leonhard Euler via the Königsberg

More information

Crick s Hypothesis Revisited: The Existence of a Universal Coding Frame

Crick s Hypothesis Revisited: The Existence of a Universal Coding Frame Crick s Hypothesis Revisited: The Existence of a Universal Coding Frame Jean-Louis Lassez*, Ryan A. Rossi Computer Science Department, Coastal Carolina University jlassez@coastal.edu, raross@coastal.edu

More information

Parametric and Inverse Parametric Sequence Alignment

Parametric and Inverse Parametric Sequence Alignment Parametric and Inverse Parametric Sequence Alignment Nan Lu, nlu@math.gatech.edu School of Mathematics, Georgia Institute of Technology School of Mathematics, Georgia Institute of Technology 22:36, April

More information

2 41L Tag- AA GAA AAA ATA AAA GCA TTA RYA GAA ATT TGT RMW GAR C K65 Tag- A AAT CCA TAC AAT ACT CCA GTA TTT GCY ATA AAG AA

2 41L Tag- AA GAA AAA ATA AAA GCA TTA RYA GAA ATT TGT RMW GAR C K65 Tag- A AAT CCA TAC AAT ACT CCA GTA TTT GCY ATA AAG AA 176 SUPPLEMENTAL TABLES 177 Table S1. ASPE Primers for HIV-1 group M subtype B Primer no Type a Sequence (5'-3') Tag ID b Position c 1 M41 Tag- AA GAA AAA ATA AAA GCA TTA RYA GAA ATT TGT RMW GAR A d 45

More information

Adjacent: Two distinct vertices u, v are adjacent if there is an edge with ends u, v. In this case we let uv denote such an edge.

Adjacent: Two distinct vertices u, v are adjacent if there is an edge with ends u, v. In this case we let uv denote such an edge. 1 Graph Basics What is a graph? Graph: a graph G consists of a set of vertices, denoted V (G), a set of edges, denoted E(G), and a relation called incidence so that each edge is incident with either one

More information

EECS730: Introduction to Bioinformatics

EECS730: Introduction to Bioinformatics EECS730: Introduction to Bioinformatics Lecture 04: Variations of sequence alignments http://www.pitt.edu/~mcs2/teaching/biocomp/tutorials/global.html Slides adapted from Dr. Shaojie Zhang (University

More information

Mapping Reads to Reference Genome

Mapping Reads to Reference Genome Mapping Reads to Reference Genome DNA carries genetic information DNA is a double helix of two complementary strands formed by four nucleotides (bases): Adenine, Cytosine, Guanine and Thymine 2 of 31 Gene

More information

IDBA - A practical Iterative de Bruijn Graph De Novo Assembler

IDBA - A practical Iterative de Bruijn Graph De Novo Assembler IDBA - A practical Iterative de Bruijn Graph De Novo Assembler Speaker: Gabriele Capannini May 21, 2010 Introduction De Novo Assembly assembling reads together so that they form a new, previously unknown

More information

Lecture 3: Graphs and flows

Lecture 3: Graphs and flows Chapter 3 Lecture 3: Graphs and flows Graphs: a useful combinatorial structure. Definitions: graph, directed and undirected graph, edge as ordered pair, path, cycle, connected graph, strongly connected

More information

More NP-complete Problems. CS255 Chris Pollett May 3, 2006.

More NP-complete Problems. CS255 Chris Pollett May 3, 2006. More NP-complete Problems CS255 Chris Pollett May 3, 2006. Outline More NP-Complete Problems Hamiltonian Cycle Recall a hamiltonian cycle is a permutation of the vertices v i_1,, v i_n of a graph G so

More information

GPU based Eulerian Assembly of Genomes

GPU based Eulerian Assembly of Genomes GPU based Eulerian Assembly of Genomes A thesis submitted in partial fulfillment of the requirements for the degree of Master of Science at George Mason University By Syed Faraz Mahmood Bachelor of Science

More information

6.00 Introduction to Computer Science and Programming Fall 2008

6.00 Introduction to Computer Science and Programming Fall 2008 MIT OpenCourseWare http://ocw.mit.edu 6.00 Introduction to Computer Science and Programming Fall 2008 For information about citing these materials or our Terms of Use, visit: http://ocw.mit.edu/terms.

More information

Walking with Euler through Ostpreußen and RNA

Walking with Euler through Ostpreußen and RNA Walking with Euler through Ostpreußen and RNA Mark Muldoon February 4, 2010 Königsberg (1652) Kaliningrad (2007)? The Königsberg Bridge problem asks whether it is possible to walk around the old city in

More information

Graph Isomorphism. Algorithms and networks

Graph Isomorphism. Algorithms and networks Graph Isomorphism Algorithms and networks Today Graph isomorphism: definition Complexity: isomorphism completeness The refinement heuristic Isomorphism for trees Rooted trees Unrooted trees Graph Isomorphism

More information