Combinatorial Pattern Matching
|
|
- Richard Poole
- 5 years ago
- Views:
Transcription
1 Combinatorial Pattern Matching
2 Outline Exact Pattern Matching Keyword Trees Suffix Trees Approximate String Matching
3 Local alignment is to slow Quadratic local alignment is too slow while looking for similarities between long strings (e.g. the entire GenBank database) = ), ( ), ( ), ( 0 max 1 1, 1, 1,, i i i i i i w v s w s v s s δ δ δ
4 Local alignment is to slow Quadratic local alignment is too slow while looking for similarities between long strings (e.g. the entire GenBank database) = ), ( ), ( ), ( 0 max 1 1, 1, 1,, i i i i i i w v s w s v s s δ δ δ
5 Local alignment is to slow Quadratic local alignment is too slow while looking for similarities between long strings (e.g. the entire GenBank database) Guaranteed to find the optimal local alignment Sets the standard for sensitivity = ), ( ), ( ), ( 0 max 1 1, 1, 1,, i i i i i i w v s w s v s s δ δ δ
6 Local alignment is to slow Quadratic local alignment is too slow while looking for similarities between long strings (e.g. the entire GenBank database) Basic Local Alignment Search Tool Altschul, S., Gish, W., Miller, W., Myers, E. & Lipman, D.J. Journal of Mol. Biol., 1990 Search sequence databases for local alignments to a query s i, = 0 si max si si 1,, 1 1, 1 + δ ( v, ) + δ (, w i ) + δ ( v, w i )
7 Pattern Matching What if we want to find all sequences in a database that contain a given pattern? This leads us to a different problem, the Pattern Matching Problem
8 Pattern Matching Problem Goal: Find all occurrences of a pattern in a text Input: Pattern p = p 1 p n and text t = t 1 t m Output: All positions 1< i < (m n + 1) such that the n-letter substring of t starting at i matches p Motivation: Searching database for a known pattern
9 Exact Pattern Matching: A Brute-Force Algorithm PatternMatching(p,t) 1 n ß length of pattern p 2 m ß length of text t 3 for i ß 1 to (m n + 1) 4 if t i t i+n-1 = p 5 output i
10 Exact Pattern Matching: An Example PatternMatching algorithm for: Pattern GCAT Text CGCATC GCAT CGCATC GCAT CGCATC GCAT CGCATC GCAT CGCATC GCAT CGCATC
11 Exact Pattern Matching: Running Time PatternMatching runtime: O(nm) Probability-wise, it s more like O(m) Rarely will there be close to n comparisons in line 4 Better solution: suffix trees Can solve problem in O(m) time Conceptually related to keyword trees
12 Keyword Trees: Example Keyword tree: Apple
13 Keyword Trees: Example (cont d) Keyword tree: Apple Apropos
14 Keyword Trees: Example (cont d) Keyword tree: Apple Apropos Banana
15 Keyword Trees: Example (cont d) Keyword tree: Apple Apropos Banana Bandana
16 Keyword Trees: Example (cont d) Keyword tree: Apple Apropos Banana Bandana Orange
17 Keyword Trees: Properties Stores a set of keywords in a rooted labeled tree Each edge labeled with a letter from an alphabet Any two edges coming out of the same vertex have distinct labels Every keyword stored can be spelled on a path from root to some leaf
18 Keyword Trees: Threading (cont d) Thread appeal appeal
19 Keyword Trees: Threading (cont d) Thread appeal appeal
20 Keyword Trees: Threading (cont d) Thread appeal appeal
21 Keyword Trees: Threading (cont d) Thread appeal appeal
22 Keyword Trees: Threading (cont d) Thread apple apple
23 Keyword Trees: Threading (cont d) Thread apple apple
24 Keyword Trees: Threading (cont d) Thread apple apple
25 Keyword Trees: Threading (cont d) Thread apple apple
26 Keyword Trees: Threading (cont d) Thread apple apple
27 Multiple Pattern Matching Problem Goal: Given a set of patterns and a text, find all occurrences of any of patterns in text Input: k patterns p 1,,p k, and text t = t 1 t m Output: Positions 1 < i < m where substring of t starting at i matches p for 1 < < k Motivation: Searching database for known multiple patterns
28 Multiple Pattern Matching: Straightforward Approach Can solve as k Pattern Matching Problems Runtime: O(kmn) using the PatternMatching algorithm k times m - length of the text n - average length of the pattern
29 Suffix Trees=Collapsed Keyword Trees Similar to keyword trees, except edges that form paths are collapsed Each edge is labeled with a substring of a text All internal edges have at least two outgoing edges Leaves labeled by the index of the pattern.
30 Suffix Tree of a Text Suffix trees of a text is constructed for all its suffixes ATCATG TCATG CATG ATG TG G Keyword Tree Suffix Tree
31 Suffix Tree of a Text Suffix trees of a text is constructed for all its suffixes ATCATG TCATG CATG ATG TG G Keyword Tree Suffix Tree How much time does it take?
32 Suffix Tree of a Text Suffix trees of a text is constructed for all its suffixes ATCATG TCATG CATG ATG TG G quadratic Keyword Tree Suffix Tree Time is linear in the total size of all suffixes, i.e., it is quadratic in the length of the text
33 Suffix Trees: Advantages Suffix trees of a text is constructed for all its suffixes Suffix trees build faster than keyword trees ATCATG TCATG CATG ATG TG G quadratic Keyword Tree linear (Weiner suffix tree algorithm) Suffix Tree
34 Use of Suffix Trees Suffix trees hold all suffixes of a text i.e., ATCGC: ATCGC, TCGC, CGC, GC, C Builds in O(m) time for text of length m To find any pattern of length n in a text: Build suffix tree for text Thread the pattern through the suffix tree Can find pattern in text in O(n) time! O(n + m) time for Pattern Matching Problem Build suffix tree and lookup pattern
35 Pattern Matching with Suffix Trees SuffixTreePatternMatching(p,t) 1 Build suffix tree for text t 2 Thread pattern p through suffix tree 3 if threading is complete 4 output positions of all p-matching leaves in the tree 5 else 6 output Pattern does not appear in text
36 Suffix Trees: Example
37 Multiple Pattern Matching: Summary Keyword and suffix trees are used to find patterns in a text Keyword trees: Build keyword tree of patterns, and thread text through it Suffix trees: Build suffix tree of text, and thread patterns through it
38 Approximate vs. Exact Pattern Matching So far all we ve seen exact pattern matching algorithms Usually, because of mutations, it makes much more biological sense to find approximate pattern matches Biologists often use fast heuristic approaches (rather than local alignment) to find approximate matches
39 Approximate Pattern Matching Problem Goal: Find all approximate occurrences of a pattern in a text Input: A pattern p = p 1 p n, text t = t 1 t m, and k, the maximum number of mismatches Output: All positions 1 < i < (m n + 1) such that t i t i+n-1 and p 1 p n have at most k mismatches (i.e., Hamming distance between t i t i+n-1 and p < k)
40 Approximate Pattern Matching: A Brute-Force Algorithm ApproximatePatternMatching(p, t, k) 1 n ß length of pattern p 2 m ß length of text t 3 for i ß 1 to m n dist ß 0 5 for ß 1 to n 6 if t i+-1!= p 7 dist ß dist if dist < k 9 output i
41 Approximate Pattern Matching: Running Time That algorithm runs in O(nm). Landau-Vishkin algorithm: O(kn) We can generalize the Approximate Pattern Matching Problem into a Query Matching Problem : We want to match substrings in a query to substrings in a text with at most k mismatches Motivation: we want to see similarities to some gene, but we may not know which parts of the gene to look for
11/5/09 Comp 590/Comp Fall
11/5/09 Comp 590/Comp 790-90 Fall 2009 1 Example of repeats: ATGGTCTAGGTCCTAGTGGTC Motivation to find them: Genomic rearrangements are often associated with repeats Trace evolutionary secrets Many tumors
More informationCombinatorial Pattern Matching. CS 466 Saurabh Sinha
Combinatorial Pattern Matching CS 466 Saurabh Sinha Genomic Repeats Example of repeats: ATGGTCTAGGTCCTAGTGGTC Motivation to find them: Genomic rearrangements are often associated with repeats Trace evolutionary
More information11/5/13 Comp 555 Fall
11/5/13 Comp 555 Fall 2013 1 Example of repeats: ATGGTCTAGGTCCTAGTGGTC Motivation to find them: Phenotypes arise from copy-number variations Genomic rearrangements are often associated with repeats Trace
More informationExample of repeats: ATGGTCTAGGTCCTAGTGGTC Motivation to find them: Genomic rearrangements are often associated with repeats Trace evolutionary
Outline Hash Tables Repeat Finding Exact Pattern Matching Keyword Trees Suffix Trees Heuristic Similarity Search Algorithms Approximate String Matching Filtration Comparing a Sequence Against a Database
More informationCombinatorial Pattern Matching
Combinatorial Pattern Matching Outline Hash Tables Repeat Finding Exact Pattern Matching Keyword Trees Suffix Trees Heuristic Similarity Search Algorithms Approximate String Matching Filtration Comparing
More informationCOMBINATORIAL PATTERN MATCHING
COMBINATORIAL PATTERN MATCHING Genomic Repets Exmple of repets: ATGGTCTAGGTCCTAGTGGTC Motivtion to find them: Genomic rerrngements re often ssocited with repets Trce evolutionry secrets Mny tumors re chrcterized
More informationCMSC423: Bioinformatic Algorithms, Databases and Tools. Exact string matching: Suffix trees Suffix arrays
CMSC423: Bioinformatic Algorithms, Databases and Tools Exact string matching: Suffix trees Suffix arrays Searching multiple strings Can we search multiple strings at the same time? Would it help if we
More informationBUNDLED SUFFIX TREES
Motivation BUNDLED SUFFIX TREES Luca Bortolussi 1 Francesco Fabris 2 Alberto Policriti 1 1 Department of Mathematics and Computer Science University of Udine 2 Department of Mathematics and Computer Science
More informationCS481: Bioinformatics Algorithms
CS481: Bioinformtics Algorithms Cn Alkn EA509 clkn@cs.ilkent.edu.tr http://www.cs.ilkent.edu.tr/~clkn/teching/cs481/ EXACT STRING MATCHING Fingerprint ide Assume: We cn compute fingerprint f(p) of P in
More informationSuffix Arrays CMSC 423
Suffix Arrays CMSC Suffix Arrays Even though Suffix Trees are O(n) space, the constant hidden by the big-oh notation is somewhat big : 0 bytes / character in good implementations. If you have a 0Gb genome,
More informationSuffix trees and applications. String Algorithms
Suffix trees and applications String Algorithms Tries a trie is a data structure for storing and retrieval of strings. Tries a trie is a data structure for storing and retrieval of strings. x 1 = a b x
More informationExact String Matching. The Knuth-Morris-Pratt Algorithm
Exact String Matching The Knuth-Morris-Pratt Algorithm Outline for Today The Exact Matching Problem A simple algorithm Motivation for better algorithms The Knuth-Morris-Pratt algorithm The Exact Matching
More informationComputational Molecular Biology
Computational Molecular Biology Erwin M. Bakker Lecture 3, mainly from material by R. Shamir [2] and H.J. Hoogeboom [4]. 1 Pairwise Sequence Alignment Biological Motivation Algorithmic Aspect Recursive
More information17 dicembre Luca Bortolussi SUFFIX TREES. From exact to approximate string matching.
17 dicembre 2003 Luca Bortolussi SUFFIX TREES From exact to approximate string matching. An introduction to string matching String matching is an important branch of algorithmica, and it has applications
More informationCOMBINATORIAL PATTERN MATCHING
COMBINATORIAL PATTERN MATCHING OUTLINE: EXACT MATCHING Tabulating patterns in long texts Short patterns (direct indexing) Longer patterns (hash tables) Finding exact patterns in a text Brute force (run
More informationCSE 417 Dynamic Programming (pt 5) Multiple Inputs
CSE 417 Dynamic Programming (pt 5) Multiple Inputs Reminders > HW5 due Wednesday Dynamic Programming Review > Apply the steps... optimal substructure: (small) set of solutions, constructed from solutions
More informationString Matching. Pedro Ribeiro 2016/2017 DCC/FCUP. Pedro Ribeiro (DCC/FCUP) String Matching 2016/ / 42
String Matching Pedro Ribeiro DCC/FCUP 2016/2017 Pedro Ribeiro (DCC/FCUP) String Matching 2016/2017 1 / 42 On this lecture The String Matching Problem Naive Algorithm Deterministic Finite Automata Knuth-Morris-Pratt
More informationLongest Common Substring
2012 Longest Common Substring CS:255 Design and Analysis of Algorithms Computer Science Department San Jose State University San Jose, CA-95192 Project Guide: Dr Sami Khuri Team Members: Avinash Anantharamu
More informationData Mining Technologies for Bioinformatics Sequences
Data Mining Technologies for Bioinformatics Sequences Deepak Garg Computer Science and Engineering Department Thapar Institute of Engineering & Tecnology, Patiala Abstract Main tool used for sequence alignment
More information6.047 / Computational Biology: Genomes, Networks, Evolution Fall 2008
MIT OpenCourseWare http://ocw.mit.edu 6.047 / 6.878 Computational Biology: Genomes, Networks, Evolution Fall 2008 For information about citing these materials or our Terms of Use, visit: http://ocw.mit.edu/terms.
More informationON HEURISTIC METHODS IN NEXT-GENERATION SEQUENCING DATA ANALYSIS
ON HEURISTIC METHODS IN NEXT-GENERATION SEQUENCING DATA ANALYSIS Ivan Vogel Doctoral Degree Programme (1), FIT BUT E-mail: xvogel01@stud.fit.vutbr.cz Supervised by: Jaroslav Zendulka E-mail: zendulka@fit.vutbr.cz
More informationOPEN MP-BASED PARALLEL AND SCALABLE GENETIC SEQUENCE ALIGNMENT
OPEN MP-BASED PARALLEL AND SCALABLE GENETIC SEQUENCE ALIGNMENT Asif Ali Khan*, Laiq Hassan*, Salim Ullah* ABSTRACT: In bioinformatics, sequence alignment is a common and insistent task. Biologists align
More informationAn Analysis of Pairwise Sequence Alignment Algorithm Complexities: Needleman-Wunsch, Smith-Waterman, FASTA, BLAST and Gapped BLAST
An Analysis of Pairwise Sequence Alignment Algorithm Complexities: Needleman-Wunsch, Smith-Waterman, FASTA, BLAST and Gapped BLAST Alexander Chan 5075504 Biochemistry 218 Final Project An Analysis of Pairwise
More informationSuffix Tree and Array
Suffix Tree and rray 1 Things To Study So far we learned how to find approximate matches the alignments. nd they are difficult. Finding exact matches are much easier. Suffix tree and array are two data
More informationEECS730: Introduction to Bioinformatics
EECS730: Introduction to Bioinformatics Lecture 04: Variations of sequence alignments http://www.pitt.edu/~mcs2/teaching/biocomp/tutorials/global.html Slides adapted from Dr. Shaojie Zhang (University
More informationSuffix Arrays Slides by Carl Kingsford
Suffix Arrays 02-714 Slides by Carl Kingsford Suffix Arrays Even though Suffix Trees are O(n) space, the constant hidden by the big-oh notation is somewhat big : 20 bytes / character in good implementations.
More informationInexact Matching, Alignment. See Gusfield, Chapter 9 Dasgupta et al. Chapter 6 (Dynamic Programming)
Inexact Matching, Alignment See Gusfield, Chapter 9 Dasgupta et al. Chapter 6 (Dynamic Programming) Outline Yet more applications of generalized suffix trees, when combined with a least common ancestor
More informationUSING AN EXTENDED SUFFIX TREE TO SPEED-UP SEQUENCE ALIGNMENT
IADIS International Conference Applied Computing 2006 USING AN EXTENDED SUFFIX TREE TO SPEED-UP SEQUENCE ALIGNMENT Divya R. Singh Software Engineer Microsoft Corporation, Redmond, WA 98052, USA Abdullah
More informationDynamic Programming Part I: Examples. Bioinfo I (Institut Pasteur de Montevideo) Dynamic Programming -class4- July 25th, / 77
Dynamic Programming Part I: Examples Bioinfo I (Institut Pasteur de Montevideo) Dynamic Programming -class4- July 25th, 2011 1 / 77 Dynamic Programming Recall: the Change Problem Other problems: Manhattan
More informationCISC 636 Computational Biology & Bioinformatics (Fall 2016)
CISC 636 Computational Biology & Bioinformatics (Fall 2016) Sequence pairwise alignment Score statistics: E-value and p-value Heuristic algorithms: BLAST and FASTA Database search: gene finding and annotations
More informationExact Matching: Hash-tables and Automata
18.417 Introduction to Computational Molecular Biology Lecture 10: October 12, 2004 Scribe: Lele Yu Lecturer: Ross Lippert Editor: Mark Halsey Exact Matching: Hash-tables and Automata While edit distances
More informationData Structures and Algorithms Dr. Naveen Garg Department of Computer Science and Engineering Indian Institute of Technology, Delhi.
Data Structures and Algorithms Dr. Naveen Garg Department of Computer Science and Engineering Indian Institute of Technology, Delhi Lecture 18 Tries Today we are going to be talking about another data
More information24 Grundlagen der Bioinformatik, SS 10, D. Huson, April 26, This lecture is based on the following papers, which are all recommended reading:
24 Grundlagen der Bioinformatik, SS 10, D. Huson, April 26, 2010 3 BLAST and FASTA This lecture is based on the following papers, which are all recommended reading: D.J. Lipman and W.R. Pearson, Rapid
More informationsplitmem: graphical pan-genome analysis with suffix skips Shoshana Marcus May 7, 2014
splitmem: graphical pan-genome analysis with suffix skips Shoshana Marcus May 7, 2014 Outline 1 Overview 2 Data Structures 3 splitmem Algorithm 4 Pan-genome Analysis Objective Input! Output! A B C D Several
More informationBLAST: Basic Local Alignment Search Tool Altschul et al. J. Mol Bio CS 466 Saurabh Sinha
BLAST: Basic Local Alignment Search Tool Altschul et al. J. Mol Bio. 1990. CS 466 Saurabh Sinha Motivation Sequence homology to a known protein suggest function of newly sequenced protein Bioinformatics
More informationThe Effect of Inverse Document Frequency Weights on Indexed Sequence Retrieval. Kevin C. O'Kane. Department of Computer Science
The Effect of Inverse Document Frequency Weights on Indexed Sequence Retrieval Kevin C. O'Kane Department of Computer Science The University of Northern Iowa Cedar Falls, Iowa okane@cs.uni.edu http://www.cs.uni.edu/~okane
More informationExact String Matching Part II. Suffix Trees See Gusfield, Chapter 5
Exact String Matching Part II Suffix Trees See Gusfield, Chapter 5 Outline for Today What are suffix trees Application to exact matching Building a suffix tree in linear time, part I: Ukkonen s algorithm
More informationReconstructing long sequences from overlapping sequence fragment. Searching databases for related sequences and subsequences
SEQUENCE ALIGNMENT ALGORITHMS 1 Why compare sequences? Reconstructing long sequences from overlapping sequence fragment Searching databases for related sequences and subsequences Storing, retrieving and
More informationJyoti Lakhani 1, Ajay Khunteta 2, Dharmesh Harwani *3 1 Poornima University, Jaipur & Maharaja Ganga Singh University, Bikaner, Rajasthan, India
International Journal of Scientific Research in Computer Science, Engineering and Information Technology 2017 IJSRCSEIT Volume 2 Issue 6 ISSN : 2456-3307 Improvisation of Global Pairwise Sequence Alignment
More informationLecture 7 February 26, 2010
6.85: Advanced Data Structures Spring Prof. Andre Schulz Lecture 7 February 6, Scribe: Mark Chen Overview In this lecture, we consider the string matching problem - finding all places in a text where some
More informationAn Efficient Algorithm for Finding Similar Short Substrings from Large Scale String Data
An Efficient Algorithm for Finding Similar Short Substrings from Large Scale String Data Takeaki Uno uno@nii.jp, National Institute of Informatics 2-1-2, Hitotsubashi, Chiyoda-ku, Tokyo 101-8430, Japan
More informationHeuristic methods for pairwise alignment:
Bi03c_1 Unit 03c: Heuristic methods for pairwise alignment: k-tuple-methods k-tuple-methods for alignment of pairs of sequences Bi03c_2 dynamic programming is too slow for large databases Use heuristic
More informationEvolutionary tree reconstruction (Chapter 10)
Evolutionary tree reconstruction (Chapter 10) Early Evolutionary Studies Anatomical features were the dominant criteria used to derive evolutionary relationships between species since Darwin till early
More informationComparative Analysis of Protein Alignment Algorithms in Parallel environment using CUDA
Comparative Analysis of Protein Alignment Algorithms in Parallel environment using BLAST versus Smith-Waterman Shadman Fahim shadmanbracu09@gmail.com Shehabul Hossain rudrozzal@gmail.com Gulshan Jubaed
More informationProject Proposal. ECE 526 Spring Modified Data Structure of Aho-Corasick. Benfano Soewito, Ed Flanigan and John Pangrazio
Project Proposal ECE 526 Spring 2006 Modified Data Structure of Aho-Corasick Benfano Soewito, Ed Flanigan and John Pangrazio 1. Introduction The internet becomes the most important tool in this decade
More informationApplied Databases. Sebastian Maneth. Lecture 14 Indexed String Search, Suffix Trees. University of Edinburgh - March 9th, 2017
Applied Databases Lecture 14 Indexed String Search, Suffix Trees Sebastian Maneth University of Edinburgh - March 9th, 2017 2 Recap: Morris-Pratt (1970) Given Pattern P, Text T, find all occurrences of
More informationChapter 7. Space and Time Tradeoffs. Copyright 2007 Pearson Addison-Wesley. All rights reserved.
Chapter 7 Space and Time Tradeoffs Copyright 2007 Pearson Addison-Wesley. All rights reserved. Space-for-time tradeoffs Two varieties of space-for-time algorithms: input enhancement preprocess the input
More informationBioinformatics explained: BLAST. March 8, 2007
Bioinformatics Explained Bioinformatics explained: BLAST March 8, 2007 CLC bio Gustav Wieds Vej 10 8000 Aarhus C Denmark Telephone: +45 70 22 55 09 Fax: +45 70 22 55 19 www.clcbio.com info@clcbio.com Bioinformatics
More informationText Algorithms (6EAP)
Text Algorithms (6EAP) Approximate Matching Jaak Vilo 2017 fall Jaak Vilo MTAT.03.190 Text Algorithms 1 Exact vs approximate search In exact search we searched for a string or set of strings in a long
More informationAcceleration of Algorithm of Smith-Waterman Using Recursive Variable Expansion.
www.ijarcet.org 54 Acceleration of Algorithm of Smith-Waterman Using Recursive Variable Expansion. Hassan Kehinde Bello and Kazeem Alagbe Gbolagade Abstract Biological sequence alignment is becoming popular
More informationIndex-assisted approximate matching
Index-assisted approximate matching Ben Langmead Department of Computer Science You are free to use these slides. If you do, please sign the guestbook (www.langmead-lab.org/teaching-materials), or email
More informationCSCI S-Q Lecture #13 String Searching 8/3/98
CSCI S-Q Lecture #13 String Searching 8/3/98 Administrivia Final Exam - Wednesday 8/12, 6:15pm, SC102B Room for class next Monday Graduate Paper due Friday Tonight Precomputation Brute force string searching
More informationAs of August 15, 2008, GenBank contained bases from reported sequences. The search procedure should be
48 Bioinformatics I, WS 09-10, S. Henz (script by D. Huson) November 26, 2009 4 BLAST and BLAT Outline of the chapter: 1. Heuristics for the pairwise local alignment of two sequences 2. BLAST: search and
More informationGiven a text file, or several text files, how do we search for a query string?
CS 840 Fall 2016 Text Search and Succinct Data Structures: Unit 4 Given a text file, or several text files, how do we search for a query string? Note the query/pattern is not of fixed length, unlike key
More informationString Matching Algorithms
String Matching Algorithms Georgy Gimel farb (with basic contributions from M. J. Dinneen, Wikipedia, and web materials by Ch. Charras and Thierry Lecroq, Russ Cox, David Eppstein, etc.) COMPSCI 369 Computational
More informationEECS 4425: Introductory Computational Bioinformatics Fall Suprakash Datta
EECS 4425: Introductory Computational Bioinformatics Fall 2018 Suprakash Datta datta [at] cse.yorku.ca Office: CSEB 3043 Phone: 416-736-2100 ext 77875 Course page: http://www.cse.yorku.ca/course/4425 Many
More information4. Suffix Trees and Arrays
4. Suffix Trees and Arrays Let T = T [0..n) be the text. For i [0..n], let T i denote the suffix T [i..n). Furthermore, for any subset C [0..n], we write T C = {T i i C}. In particular, T [0..n] is the
More informationString Matching Algorithms
String Matching Algorithms 1. Naïve String Matching The naïve approach simply test all the possible placement of Pattern P[1.. m] relative to text T[1.. n]. Specifically, we try shift s = 0, 1,..., n -
More informationHighly Scalable and Accurate Seeds for Subsequence Alignment
Highly Scalable and Accurate Seeds for Subsequence Alignment Abhijit Pol Tamer Kahveci Department of Computer and Information Science and Engineering, University of Florida, Gainesville, FL, USA, 32611
More informationCSC Design and Analysis of Algorithms. Lecture 9. Space-For-Time Tradeoffs. Space-for-time tradeoffs
CSC 8301- Design and Analysis of Algorithms Lecture 9 Space-For-Time Tradeoffs Space-for-time tradeoffs Two varieties of space-for-time algorithms: input enhancement -- preprocess input (or its part) to
More informationData structures for string pattern matching: Suffix trees
Suffix trees Data structures for string pattern matching: Suffix trees Linear algorithms for exact string matching KMP Z-value algorithm What is suffix tree? A tree-like data structure for solving problems
More informationLecture 12: Divide and Conquer Algorithms
Lecture 12: Divide and Conquer Algorithms Study Chapter 7.1 7.4 1 Divide and Conquer Algorithms Divide problem into sub-problems Conquer by solving sub-problems recursively. If the sub-problems are small
More informationKnuth-Morris-Pratt. Kranthi Kumar Mandumula Indiana State University Terre Haute IN, USA. December 16, 2011
Kranthi Kumar Mandumula Indiana State University Terre Haute IN, USA December 16, 2011 Abstract KMP is a string searching algorithm. The problem is to find the occurrence of P in S, where S is the given
More informationDivya R. Singh. Faster Sequence Alignment using Suffix Tree and Data-Mining Techniques. February A Thesis Presented by
Faster Sequence Alignment using Suffix Tree and Data-Mining Techniques A Thesis Presented by Divya R. Singh to The Faculty of the Graduate College of the University of Vermont In Partial Fulfillment of
More informationBLAST, Profile, and PSI-BLAST
BLAST, Profile, and PSI-BLAST Jianlin Cheng, PhD School of Electrical Engineering and Computer Science University of Central Florida 26 Free for academic use Copyright @ Jianlin Cheng & original sources
More informationBLAST & Genome assembly
BLAST & Genome assembly Solon P. Pissis Tomáš Flouri Heidelberg Institute for Theoretical Studies May 15, 2014 1 BLAST What is BLAST? The algorithm 2 Genome assembly De novo assembly Mapping assembly 3
More informationFast Searching in Wikipedia, P2P, and Biological Sequences. Ela Hunt, Marie Curie Fellow
Fast Searching in Wikipedia, P2P, and Biological Sequences Ela Hunt, Marie Curie Fellow Ela Hunt, Department of Computer Science, GlobIS, hunt@inf.ethz.ch Edinburgh, May 1 st 2008 My background Krakow,
More informationSuffix Trees. Martin Farach-Colton Rutgers University & Tokutek, Inc
Suffix Trees Martin Farach-Colton Rutgers University & Tokutek, Inc What s in this talk? What s a suffix tree? What can you do with them? How do you build them? A challenge problem What s in this talk?
More informationA DNA Index Structure Using Frequency and Position Information of Genetic Alphabet
A DNA Index Structure Using Frequency and Position Information of Genetic Alphabet Woo-Cheol Kim 1, Sanghyun Park 1, Jung-Im Won 1, Sang-Wook Kim 2, and Jee-Hee Yoon 3 1 Department of Computer Science,
More informationSAPLING: Suffix Array Piecewise Linear INdex for Genomics Michael Kirsche
SAPLING: Suffix Array Piecewise Linear INdex for Genomics Michael Kirsche mkirsche@jhu.edu StringBio 2018 Outline Substring Search Problem Caching and Learned Data Structures Methods Results Ongoing work
More informationChapter 4: Blast. Chaochun Wei Fall 2014
Course organization Introduction ( Week 1-2) Course introduction A brief introduction to molecular biology A brief introduction to sequence comparison Part I: Algorithms for Sequence Analysis (Week 3-11)
More informationMultiple Sequence Alignment: Multidimensional. Biological Motivation
Multiple Sequence Alignment: Multidimensional Dynamic Programming Boston University Biological Motivation Compare a new sequence with the sequences in a protein family. Proteins can be categorized into
More informationLecture 5: Suffix Trees
Longest Common Substring Problem Lecture 5: Suffix Trees Given a text T = GGAGCTTAGAACT and a string P = ATTCGCTTAGCCTA, how do we find the longest common substring between them? Here the longest common
More informationDivide & Conquer Algorithms
Divide & Conquer Algorithms Outline MergeSort Finding the middle point in the alignment matrix in linear space Linear space sequence alignment Block Alignment Four-Russians speedup Constructing LCS in
More informationDynamic Programming: Sequence alignment. CS 466 Saurabh Sinha
Dynamic Programming: Sequence alignment CS 466 Saurabh Sinha DNA Sequence Comparison: First Success Story Finding sequence similarities with genes of known function is a common approach to infer a newly
More informationIndexing and Searching
Indexing and Searching Introduction How to retrieval information? A simple alternative is to search the whole text sequentially Another option is to build data structures over the text (called indices)
More informationString Processing Workshop
String Processing Workshop String Processing Overview What is string processing? String processing refers to any algorithm that works with data stored in strings. We will cover two vital areas in string
More informationSpecial course in Computer Science: Advanced Text Algorithms
Special course in Computer Science: Advanced Text Algorithms Lecture 6: Alignments Elena Czeizler and Ion Petre Department of IT, Abo Akademi Computational Biomodelling Laboratory http://www.users.abo.fi/ipetre/textalg
More informationComputational Biology 6.095/6.895 Database Search Lecture 5 Prof. Piotr Indyk
Computational Biology 6.095/6.895 Database Searh Leture 5 Prof. Piotr Indyk Previous letures Leture -3: Global alignment in O(mn) Dynami programming Leture -2: Loal alignment, variants, in O(mn) Leture
More informationarxiv: v1 [cs.ds] 8 Mar 2013
An Efficient Dynamic Programming Algorithm for the Generalized LCS Problem with Multiple Substring Exclusion Constrains Lei Wang, Xiaodong Wang, Yingjie Wu, and Daxin Zhu August 16, 2018 arxiv:1303.1872v1
More informationS 4 : International Competition on Scalable String Similarity Search & Join. Ulf Leser, Humboldt-Universität zu Berlin
S 4 : International Competition on Scalable String Similarity Search & Join Ulf Leser, Humboldt-Universität zu Berlin S 4 Competition, not a workshop in the usual sense Idea: Try to find the best existing
More informationString Patterns and Algorithms on Strings
String Patterns and Algorithms on Strings Lecture delivered by: Venkatanatha Sarma Y Assistant Professor MSRSAS-Bangalore 11 Objectives To introduce the pattern matching problem and the important of algorithms
More informationGenome 373: Genome Assembly. Doug Fowler
Genome 373: Genome Assembly Doug Fowler What are some of the things we ve seen we can do with HTS data? We ve seen that HTS can enable a wide variety of analyses ranging from ID ing variants to genome-
More informationLowest Common Ancestor (LCA) Queries
Lowest Common Ancestor (LCA) Queries A technique with application to approximate matching Chris Lewis Approximate Matching Match pattern to text Insertion/Deletion/Substitution Applications Bioinformatics,
More informationFINDING APPROXIMATE REPEATS WITH MULTIPLE SPACED SEEDS
FINDING APPROXIMATE REPEATS WITH MULTIPLE SPACED SEEDS FINDING APPROXIMATE REPEATS IN DNA SEQUENCES USING MULTIPLE SPACED SEEDS By SARAH BANYASSADY, B.S. A Thesis Submitted to the School of Graduate Studies
More informationDNA Sequencing. Overview
BINF 3350, Genomics and Bioinformatics DNA Sequencing Young-Rae Cho Associate Professor Department of Computer Science Baylor University Overview Backgrounds Eulerian Cycles Problem Hamiltonian Cycles
More informationCorrelogram-based method for comparing biological sequences
Correlogram-based method for comparing biological sequences Debasis Mitra*, Gandhali Samant* and Kuntal Sengupta + Department of Computer Sciences Florida Institute of Technology Melbourne, Florida, USA
More informationSORTING. Practical applications in computing require things to be in order. To consider: Runtime. Memory Space. Stability. In-place algorithms???
SORTING + STRING COMP 321 McGill University These slides are mainly compiled from the following resources. - Professor Jaehyun Park slides CS 97SI - Top-coder tutorials. - Programming Challenges book.
More informationBLAST. Basic Local Alignment Search Tool. Used to quickly compare a protein or DNA sequence to a database.
BLAST Basic Local Alignment Search Tool Used to quickly compare a protein or DNA sequence to a database. There is no such thing as a free lunch BLAST is fast and highly sensitive compared to competitors.
More informationSequence Assembly Required!
Sequence Assembly Required! 1 October 3, ISMB 20172007 1 Sequence Assembly Genome Sequenced Fragments (reads) Assembled Contigs Finished Genome 2 Greedy solution is bounded 3 Typical assembly strategy
More informationString matching algorithms
String matching algorithms Deliverables String Basics Naïve String matching Algorithm Boyer Moore Algorithm Rabin-Karp Algorithm Knuth-Morris- Pratt Algorithm Copyright @ gdeepak.com 2 String Basics A
More informationLecture 18 April 12, 2005
6.897: Advanced Data Structures Spring 5 Prof. Erik Demaine Lecture 8 April, 5 Scribe: Igor Ganichev Overview In this lecture we are starting a sequence of lectures about string data structures. Today
More informationMismatch String Kernels for SVM Protein Classification
Mismatch String Kernels for SVM Protein Classification Christina Leslie Department of Computer Science Columbia University cleslie@cs.columbia.edu Jason Weston Max-Planck Institute Tuebingen, Germany weston@tuebingen.mpg.de
More informationCS : Data Structures Michael Schatz. Nov 14, 2016 Lecture 32: BWT
CS 600.226: Data Structures Michael Schatz Nov 14, 2016 Lecture 32: BWT HW8 Assignment 8: Competitive Spelling Bee Out on: November 2, 2018 Due by: November 9, 2018 before 10:00 pm Collaboration: None
More informationAn introduction to suffix trees and indexing
An introduction to suffix trees and indexing Tomáš Flouri Solon P. Pissis Heidelberg Institute for Theoretical Studies December 3, 2012 1 Introduction Introduction 2 Basic Definitions Graph theory Alphabet
More informationCSED233: Data Structures (2017F) Lecture12: Strings and Dynamic Programming
(2017F) Lecture12: Strings and Dynamic Programming Daijin Kim CSE, POSTECH dkim@postech.ac.kr Strings A string is a sequence of characters Examples of strings: Python program HTML document DNA sequence
More information4. Suffix Trees and Arrays
4. Suffix Trees and Arrays Let T = T [0..n) be the text. For i [0..n], let T i denote the suffix T [i..n). Furthermore, for any subset C [0..n], we write T C = {T i i C}. In particular, T [0..n] is the
More informationNew Algorithms for the Spaced Seeds
New Algorithms for the Spaced Seeds Xin Gao 1, Shuai Cheng Li 1, and Yinan Lu 1,2 1 David R. Cheriton School of Computer Science University of Waterloo Waterloo, Ontario, Canada N2L 6P7 2 College of Computer
More informationLecture L16 April 19, 2012
6.851: Advanced Data Structures Spring 2012 Prof. Erik Demaine Lecture L16 April 19, 2012 1 Overview In this lecture, we consider the string matching problem - finding some or all places in a text where
More informationCOMPARATIVE ANALYSIS ON EFFICIENCY OF SINGLE STRING PATTERN MATCHING ALGORITHMS
International Journal of Latest Trends in Engineering and Technology Special Issue SACAIM 2016, pp. 221-225 e-issn:2278-621x COMPARATIVE ANALYSIS ON EFFICIENCY OF SINGLE STRING PATTERN MATCHING ALGORITHMS
More information