Dynamic Programming Part I: Examples. Bioinfo I (Institut Pasteur de Montevideo) Dynamic Programming -class4- July 25th, / 77
|
|
- Hugo Wood
- 5 years ago
- Views:
Transcription
1 Dynamic Programming Part I: Examples Bioinfo I (Institut Pasteur de Montevideo) Dynamic Programming -class4- July 25th, / 77
2 Dynamic Programming Recall: the Change Problem Other problems: Manhattan Tourist Problem, LCS Problem Finally: Sequence alignments Bioinfo I (Institut Pasteur de Montevideo) Dynamic Programming -class4- July 25th, / 77
3 Manhattan Tourist Problem (MTP) Imagine seeking a path (from source to sink) to travel (only eastward and southward) with the most number of attractions (*) in the Manhattan grid ioinfo I (Institut Pasteur de Montevideo) Dynamic Programming -class4- July 25th, / 77
4 Manhattan Tourist Problem (MTP) Imagine seeking a path (from source to sink) to travel (only eastward and southward) with the most number of attractions (*) in the Manhattan grid ioinfo I (Institut Pasteur de Montevideo) Dynamic Programming -class4- July 25th, / 77
5 Manhattan Tourist Problem: Formulation Goal: Find the longest path in a weighted grid. Input: A weighted grid G with two distinct vertices, one labeled source" and the other labeled sink" Output: A longest path in G from source" to sink" Bioinfo I (Institut Pasteur de Montevideo) Dynamic Programming -class4- July 25th, / 77
6 MTP: An example Bioinfo I (Institut Pasteur de Montevideo) Dynamic Programming -class4- July 25th, / 77
7 MTP: Greedy Algorithm Is Not Optimal Bioinfo I (Institut Pasteur de Montevideo) Dynamic Programming -class4- July 25th, / 77
8 MTP: Simple Recursive Program 1 MT(n,m) 2 if n = 0 or m = 0 3 return MT(n,m) 4 x MT(n-1,m)+ length of the edge from (n 1, m) to (n, m) 5 y MT(n,m-1)+length of the edge from (n, m 1) to (n, m) 6 return max{x,y} Bioinfo I (Institut Pasteur de Montevideo) Dynamic Programming -class4- July 25th, / 77
9 MTP: Simple Recursive Program 1 MT(n,m) 2 if n = 0 or m = 0 3 return MT(n,m) 4 x MT(n-1,m)+ length of the edge from (n 1, m) to (n, m) 5 y MT(n,m-1)+length of the edge from (n, m 1) to (n, m) 6 return max{x,y} What s wrong with this approach? Bioinfo I (Institut Pasteur de Montevideo) Dynamic Programming -class4- July 25th, / 77
10 MTP: Dynamic Programming Calculate optimal path score for each vertex in the graph Each vertex s score is the maximum of the prior vertices score plus the weight of the respective edge in between Bioinfo I (Institut Pasteur de Montevideo) Dynamic Programming -class4- July 25th, / 77
11 MTP: Dynamic Programming Bioinfo I (Institut Pasteur de Montevideo) Dynamic Programming -class4- July 25th, / 77
12 MTP: Dynamic Programming Bioinfo I (Institut Pasteur de Montevideo) Dynamic Programming -class4- July 25th, / 77
13 MTP: Dynamic Programming Bioinfo I (Institut Pasteur de Montevideo) Dynamic Programming -class4- July 25th, / 77
14 MTP: Dynamic Programming Bioinfo I (Institut Pasteur de Montevideo) Dynamic Programming -class4- July 25th, / 77
15 MTP: Dynamic Programming Bioinfo I (Institut Pasteur de Montevideo) Dynamic Programming -class4- July 25th, / 77
16 MTP: Recurrence Computing the score for a point (i, j) by the recurrence relation: { si 1,j + weight of the edge between (i 1, j)and (i, j) s i,j = max s i,j 1 + weight of the edge between (i, j 1)and (i, j) The running time is n m for a n by m grid (n = # of rows, m = # of columns) Bioinfo I (Institut Pasteur de Montevideo) Dynamic Programming -class4- July 25th, / 77
17 Manhattan is not a perfect Grid Represented as a DAG: Directed Acyclic Graph The score at point B is given by: s i,j = max { si 1,j + weight of the edge between(i 1, j)and(i, j) s i,j 1 + weight of the edge between(i, j 1)and(i, j) Bioinfo I (Institut Pasteur de Montevideo) Dynamic Programming -class4- July 25th, / 77
18 Manhattan Is Not A Perfect Grid Computing the score for point x is given by the recurrence relation: { sy + weight of vertex(y, x)where s x = max y Predecessors(x) Predecessors(x): set of vertices that have edges leading to x. The running time for a graph G(V, E) (V is the set of all vertices and E is the set of all edges) is O(E) since each edge is evaluated once. Bioinfo I (Institut Pasteur de Montevideo) Dynamic Programming -class4- July 25th, / 77
19 Longest Path in DAG Problem Goal: Find a longest path between two vertices in a weighted DAG Input: A weighted DAG G with source and sink vertices Output: A longest path in G from source to sink Bioinfo I (Institut Pasteur de Montevideo) Dynamic Programming -class4- July 25th, / 77
20 Longest Path in DAG: Dynamic Programming Suppose vertex v has indegree 3 and predecessors {u 1, u 2, u 3 } Longest path to v from source is: s u1 + weight of edge from u 1 to v s v = max s u2 + weight of edge from u 2 to v s u3 + weight of edge from u 3 to v In general: s v = max u {s u + weight of edge from u to v} Bioinfo I (Institut Pasteur de Montevideo) Dynamic Programming -class4- July 25th, / 77
21 Traveling in the Grid The only hitch is that one must decide on the order in which visit the vertices By the time the vertex x is analyzed, the values s y for all its predecessors y should be computed - otherwise we are in trouble We need to traverse the vertices in some order Try to find such order for a directed cycle??? Bioinfo I (Institut Pasteur de Montevideo) Dynamic Programming -class4- July 25th, / 77
22 Topological ordering 2 different topological orderings of the DAG Bioinfo I (Institut Pasteur de Montevideo) Dynamic Programming -class4- July 25th, / 77
23 Traversing the Manhattan Grid 3 different strategies: a) Column by column b) Row by row c) Along diagonals ioinfo I (Institut Pasteur de Montevideo) Dynamic Programming -class4- July 25th, / 77
24 Pseudo-code MTP: Dynamic Programming 1 ManhattanTourist(w, w,w i,j,n,m) 2 for i 1 to n 3 s i,0 s i 1,0 + w i,0 4 for j 1 to m 5 s 0,j s 0,j 1 + w 0,j 6 for i 1 to n 7 for j 1 to m 8 s i 1,j + w i,j s i,j = max s i,j 1 + w i,j s i 1,j 1 + w i,j 9 return s n,m Bioinfo I (Institut Pasteur de Montevideo) Dynamic Programming -class4- July 25th, / 77
25 Dynamic Programming Part II: Edit Distance & Alignments Bioinfo I (Institut Pasteur de Montevideo) Dynamic Programming -class4- July 25th, / 77
26 Aligning DNA Sequences Bioinfo I (Institut Pasteur de Montevideo) Dynamic Programming -class4- July 25th, / 77
27 LCS Alignment without mismatches LCS: Longest Common Subsequence Given two sequences v = v 1 v 2...v m and w = w 1 w 2...w n The LCS of v and w is a sequence of positions in v : 1 < i 1 < i 2 <... < i t < m and a sequence of positions in w : 1 < j 1 < j 2 <... < j t < n such that i t -th letter of v equals to j t -th letter of w and t is maximal Bioinfo I (Institut Pasteur de Montevideo) Dynamic Programming -class4- July 25th, / 77
28 LCS: Example Every common subsequence is a path in 2-D grid Bioinfo I (Institut Pasteur de Montevideo) Dynamic Programming -class4- July 25th, / 77
29 LCS Problem as Manhattan Tourist Problem Bioinfo I (Institut Pasteur de Montevideo) Dynamic Programming -class4- July 25th, / 77
30 Edit Graph for LCS Problem Bioinfo I (Institut Pasteur de Montevideo) Dynamic Programming -class4- July 25th, / 77
31 Edit Graph for LCS Problem Every path is a common subsequence. Every diagonal edge adds an extra element to common subsequence. LCS Problem: Find a path with maximum number of diagonal edges. Bioinfo I (Institut Pasteur de Montevideo) Dynamic Programming -class4- July 25th, / 77
32 Computing LCS Let v i = prefix of v of length i: v 1...v i and w j = prefix of w of length j: w 1...w j Bioinfo I (Institut Pasteur de Montevideo) Dynamic Programming -class4- July 25th, / 77
33 Every Path in the Grid Corresponds to an Alignment Bioinfo I (Institut Pasteur de Montevideo) Dynamic Programming -class4- July 25th, / 77
34 Aligning Sequences without Insertions and Deletions: Hamming Distance Given two DNA sequences v and w : The Hamming distance: d H (v, w) = 8 is large but the sequences are very similar Bioinfo I (Institut Pasteur de Montevideo) Dynamic Programming -class4- July 25th, / 77
35 Aligning Sequences with Insertions and Deletions By shifting one sequence over one position: The edit distance: d L (v, w) = 2 Hamming distance neglects insertions and deletions in DNA Bioinfo I (Institut Pasteur de Montevideo) Dynamic Programming -class4- July 25th, / 77
36 Levenshtein or edit distance Definition The Levenshtein distance or edit distance d L between two sequences X and Y is is the minimum number of edit operations of type Replacement, Insertion, or Deletion, that one needs to transform sequence X into sequence Y : d L (X, Y ) = min{r(x, Y ) + I (X, Y ) + D(X, Y )} Using M for match, an edit transcript is a string over the alphabet I, D, R, M that describes a transformation of X to Y. Bioinfo I (Institut Pasteur de Montevideo) Dynamic Programming -class4- July 25th, / 77
37 Levenshtein or edit distance X = YESTERDAY Example: Given two strings. Y = EASTERS Here is a minimum edit transcript for the above example: edit transcript= D M I M M M M R D D X= Y E S T E R D A Y Y= E A S T E R S The edit distance d L (X, Y ) of X, Y is 5. Bioinfo I (Institut Pasteur de Montevideo) Dynamic Programming -class4- July 25th, / 77
38 Edit Distance vs Hamming Distance Hamming distance always compares i th letter of v with i th letter of w Hamming distance: d(v, w) = 8 Computing Hamming distance is a trivial task. Bioinfo I (Institut Pasteur de Montevideo) Dynamic Programming -class4- July 25th, / 77
39 Edit Distance vs Hamming Distance Hamming distance always compares i th letter of v with i th letter of w Edit distance may compare i th letter of v with j th letter of w Hamming distance: d(v, w) = 8 Computing Hamming distance is a trivial task. Edit distance: d(v, w) = 2 Computing edit distance is a non-trivial task. Bioinfo I (Institut Pasteur de Montevideo) Dynamic Programming -class4- July 25th, / 77
40 Edit Distance: Example ioinfo I (Institut Pasteur de Montevideo) Dynamic Programming -class4- July 25th, / 77
41 Edit Distance: Example What is the edit distance? 5? Bioinfo I (Institut Pasteur de Montevideo) Dynamic Programming -class4- July 25th, / 77
42 Edit Distance: Example ioinfo I (Institut Pasteur de Montevideo) Dynamic Programming -class4- July 25th, / 77
43 Edit Distance: Example Can it be done in 3 steps? Bioinfo I (Institut Pasteur de Montevideo) Dynamic Programming -class4- July 25th, / 77
44 The Alignment Grid Every alignment path is from source to sink ioinfo I (Institut Pasteur de Montevideo) Dynamic Programming -class4- July 25th, / 77
45 Alignment as a path in the Edit Graph ioinfo I (Institut Pasteur de Montevideo) Dynamic Programming -class4- July 25th, / 77
46 Alignments in Edit Graph ioinfo I (Institut Pasteur de Montevideo) Dynamic Programming -class4- July 25th, / 77
47 Alignments in Edit Graph Every path in the edit graph corresponds to alignment: ioinfo I (Institut Pasteur de Montevideo) Dynamic Programming -class4- July 25th, / 77
48 Alignments in Edit Graph ioinfo I (Institut Pasteur de Montevideo) Dynamic Programming -class4- July 25th, / 77
49 Alignments in Edit Graph ioinfo I (Institut Pasteur de Montevideo) Dynamic Programming -class4- July 25th, / 77
50 Alignment: Dynamic Programming s i 1,j s i,j = max s i 1,j s i,j 1 if v i = w j Bioinfo I (Institut Pasteur de Montevideo) Dynamic Programming -class4- July 25th, / 77
51 Dynamic Programming Example Initialize 1st row and 1st column to be all zeroes Or, to be more precise, initialize 0 th row and 0 th column to be all zeroes ioinfo I (Institut Pasteur de Montevideo) Dynamic Programming -class4- July 25th, / 77
52 Dynamic Programming Example s i 1,j 1 : value from NW +1 if v s i,j = max i = w j s i 1,j : value from N s i,j 1 : value from W ioinfo I (Institut Pasteur de Montevideo) Dynamic Programming -class4- July 25th, / 77
53 Alignment: Backtracking Arrows indicate where the score originated from: Bioinfo I (Institut Pasteur de Montevideo) Dynamic Programming -class4- July 25th, / 77
54 Backtracking Example Find a match in row and column 2 i=2, j=2, 5 is a match (T). j=2, i=4, 5, 7 is a match (T). Since v i = w j, s i,j = s i 1,j s 2,2 = [s 1,1 = 1] + 1 s 2,5 = [s 1,4 = 1] + 1 s 4,2 = [s 3,1 = 1] + 1 s 5,2 = [s 4,1 = 1] + 1 s 7,2 = [s 6,1 = 1] + 1 ioinfo I (Institut Pasteur de Montevideo) Dynamic Programming -class4- July 25th, / 77
55 Dynamic Programming Example Continuing with the dynamic programming algorithm gives this result. ioinfo I (Institut Pasteur de Montevideo) Dynamic Programming -class4- July 25th, / 77
56 Alignment: Dynamic Programming s i 1,j s i,j = max s i 1,j s i,j 1 if v i = w j Bioinfo I (Institut Pasteur de Montevideo) Dynamic Programming -class4- July 25th, / 77
57 Alignment: Dynamic Programming s i 1,j s i,j = max s i 1,j s i,j 1 if v i = w j This recurrence corresponds to the Manhattan Tourist problem (three incoming edges into a vertex) with all horizontal and vertical edges weighted by zero. Bioinfo I (Institut Pasteur de Montevideo) Dynamic Programming -class4- July 25th, / 77
58 LCS Algorithm 1 LCS(v,w) 2 for i 1 to n 3 s i,0 0 4 for j 1 to m 5 s 0,j 0 6 for i 1 to n 7 for j 1 to m return s i 1,j s i,j = max s i 1,j s i,j 1 b i,j = if v i = w j if s i,j = s i 1,j if s i,j = s i,j 1 if s i,j = s i 1,j 1 Bioinfo I (Institut Pasteur de Montevideo) Dynamic Programming -class4- July 25th, / 77
59 Now What? LCS(v,w) created the alignment grid Now we need a way to read the best alignment of v and w Follow the arrows backwards from sink ioinfo I (Institut Pasteur de Montevideo) Dynamic Programming -class4- July 25th, / 77
60 Printing LCS: Backtracking 1 PrintLCS(b,v,i,j) 2 if i = 0 or j = 0 3 return 4 if b i,j = 5 PrintLCS(b,v,i-1,j-1) 6 print v i 7 else 8 if b i,j = 9 PrintLCS(b,v,i-1,j) 10 else 11 PrintLCS(b,v,i,j-1) Bioinfo I (Institut Pasteur de Montevideo) Dynamic Programming -class4- July 25th, / 77
61 Now What? Bioinfo I (Institut Pasteur de Montevideo) Dynamic Programming -class4- July 25th, / 77
62 Now What? Alignment: A T C G - T A C - A T - G T T A - T ioinfo I (Institut Pasteur de Montevideo) Dynamic Programming -class4- July 25th, / 77
63 LCS Runtime It takes O(nm) time to fill in the n m dynamic programming matrix. Why O(nm)? The pseudocode consists of a nested for" loop inside of another for" loop to set up a n m matrix. Bioinfo I (Institut Pasteur de Montevideo) Dynamic Programming -class4- July 25th, / 77
64 Dynamic Programming Part II: Sequence Alignment Bioinfo I (Institut Pasteur de Montevideo) Dynamic Programming -class4- July 25th, / 77
65 Outline Dot plots Global Alignment Scoring Matrices Local Alignment Alignment with Affine Gap Penalties Bioinfo I (Institut Pasteur de Montevideo) Dynamic Programming -class4- July 25th, / 77
66 Types of sequence alignments Dot plots Number of sequences pairwise: compares two sequences multiple: compares several sequences Portion of aligned sequence global: aligns the sequences over all their length local: finds subsequences with the best similarity scores Algorithms Optimal methods: Needleman-Wunsch, Smith-Waterman Heuristics: FASTA, BLAST Bioinfo I (Institut Pasteur de Montevideo) Dynamic Programming -class4- July 25th, / 77
67 Dot plot the simplest way to visualize the similarity between two protein/dna sequences is to use a similarity matrix Identification of insertions/deletions Identification of direct repeats or inversions Steps to create a dot plot Bioinfo I (Institut Pasteur de Montevideo) Dynamic Programming -class4- July 25th, / 77
68 Dot plot the simplest way to visualize the similarity between two protein/dna sequences is to use a similarity matrix Identification of insertions/deletions Identification of direct repeats or inversions Steps to create a dot plot 2D matrix One sequence on the top One sequence on the left For each matrix cell, compare the symbols and draw a point if there is a coincidence Bioinfo I (Institut Pasteur de Montevideo) Dynamic Programming -class4- July 25th, / 77
69 Dot matrix sequence comparison A dot matrix analysis is primarily a method for comparing two sequences. An (n m) matrix relating two sequences of length n and m respectively is produced by placing a dot at each cell for which the corresponding symbols match. Here is an example for the two sequences: IMISSMISSISSIPPI and MYMISSISAHIPPIE: ioinfo I (Institut Pasteur de Montevideo) Dynamic Programming -class4- July 25th, / 77
70 Dot matrix sequence comparison Definition Let S = s 1 s 2... s n and T = t 1... t m be two strings of length n and m respectively. Let M be an n m matrix. Then M is a (simple) dot plot if for i, j, 1 i n, 1 j m : M[i, j] = { 1 for si = t j 0 else. Note: The longest common substring within the two strings S and T is then the longest matrix subdiagonal containing only 1s. However, rather than drawing the letter 1 we draw a dot. Bioinfo I (Institut Pasteur de Montevideo) Dynamic Programming -class4- July 25th, / 77
71 Dot matrix sequence comparison Some of the properties of a dot plot are the visualization is easy to understand it is easy to find common substrings, they appear as contiguous dots along a diagonal it is easy to find reversed substrings it is easy to discover displacements it is easy to find repeats Bioinfo I (Institut Pasteur de Montevideo) Dynamic Programming -class4- July 25th, / 77
72 Dot plots Sequence length: n and m O(nm) DNA Protein Bioinfo I (Institut Pasteur de Montevideo) Dynamic Programming -class4- July 25th, / 77
73 Noise in Dot plot LDL human receptor compared to himself The low density lipoprotein (LDL) receptor is a cell surface protein that plays a central role in the metabolism of cholesterol in humans and animals. Mutations affecting its structure and function give rise to one of the most prevalent human genetic diseases, familial hypercholesterolemia. ioinfo I (Institut Pasteur de Montevideo) Dynamic Programming -class4- July 25th, / 77
74 Reducing the noise To reduce the noise, a window size w and a stringency s are used and a dot is only drawn at point (x, y) if in the next w positions at least s characters are equal. Example: Phage P22 w = 1, s = 1 w = 11, s = 7 w = 23, s = 15 Bioinfo I (Institut Pasteur de Montevideo) Dynamic Programming -class4- July 25th, / 77
75 Random similarity in Dot plots When comparing DNA, there is a 1 4 probability of random matches When comparing protein sequences there is a 1 20 probability of random matches Hence, if coding DNA regions are analized: translate first, then align! You can always go back to DNA after alignment Bioinfo I (Institut Pasteur de Montevideo) Dynamic Programming -class4- July 25th, / 77
76 w=1 Bioinfo I (Institut Pasteur de Montevideo) Dynamic Programming -class4- July 25th, / 77
77 w=3 Bioinfo I (Institut Pasteur de Montevideo) Dynamic Programming -class4- July 25th, / 77
78 w=3, stringency 2 Bioinfo I (Institut Pasteur de Montevideo) Dynamic Programming -class4- July 25th, / 77
79 DNA sequence Simple dot plot, w = 1 w = 23, stringency = 16 Bioinfo I (Institut Pasteur de Montevideo) Dynamic Programming -class4- July 25th, / 77
80 Protein sequence Simple dot plot, w = 1 w = 23, stringency = 6 Bioinfo I (Institut Pasteur de Montevideo) Dynamic Programming -class4- July 25th, / 77
81 Insertion Deletion & Inversion Bioinfo I (Institut Pasteur de Montevideo) Dynamic Programming -class4- July 25th, / 77
82 Repeats ABCDEFGEFGHIJKLMNO Tandem duplication Compared to non duplicated Tandem duplication Compared to itself Bioinfo I (Institut Pasteur de Montevideo) Dynamic Programming -class4- July 25th, / 77
83 Palindromic repeat (intra chain) 5 GGCGG 3 Bioinfo I (Institut Pasteur de Montevideo) Dynamic Programming -class4- July 25th, / 77
84 Limitations of dot plots No score to quantify identical or similar strings Runtime is quadratic; more efficient algorithms to identify identical substrings exist (eg. based on suffix trees) Bioinfo I (Institut Pasteur de Montevideo) Dynamic Programming -class4- July 25th, / 77
EECS 4425: Introductory Computational Bioinformatics Fall Suprakash Datta
EECS 4425: Introductory Computational Bioinformatics Fall 2018 Suprakash Datta datta [at] cse.yorku.ca Office: CSEB 3043 Phone: 416-736-2100 ext 77875 Course page: http://www.cse.yorku.ca/course/4425 Many
More informationDynamic Programming: Sequence alignment. CS 466 Saurabh Sinha
Dynamic Programming: Sequence alignment CS 466 Saurabh Sinha DNA Sequence Comparison: First Success Story Finding sequence similarities with genes of known function is a common approach to infer a newly
More informationFinding sequence similarities with genes of known function is a common approach to infer a newly sequenced gene s function
Outline DNA Sequence Comparison: First Success Stories Change Problem Manhattan Tourist Problem Longest Paths in Graphs Sequence Alignment Edit Distance Longest Common Subsequence Problem Dot Matrices
More information1. Basic idea: Use smaller instances of the problem to find the solution of larger instances
Chapter 8. Dynamic Programming CmSc Intro to Algorithms. Basic idea: Use smaller instances of the problem to find the solution of larger instances Example : Fibonacci numbers F = F = F n = F n- + F n-
More informationDynamic Programming Comp 122, Fall 2004
Dynamic Programming Comp 122, Fall 2004 Review: the previous lecture Principles of dynamic programming: optimization problems, optimal substructure property, overlapping subproblems, trade space for time,
More information9/29/09 Comp /Comp Fall
9/29/9 Comp 9-9/Comp 79-9 Fall 29 1 So far we ve tried: A greedy algorithm that does not work for all inputs (it is incorrect) An exhaustive search algorithm that is correct, but can take a long time A
More informationDynamic Programming: Edit Distance
Dynamic Programming: Edit Distance Outline. DNA Sequence Comparison and CF. Change Problem. Manhattan Tourist Problem. Longest Paths in Graphs. Sequence Alignment 6. Edit Distance Section : DNA Sequence
More informationPairwise Sequence alignment Basic Algorithms
Pairwise Sequence alignment Basic Algorithms Agenda - Previous Lesson: Minhala - + Biological Story on Biomolecular Sequences - + General Overview of Problems in Computational Biology - Reminder: Dynamic
More informationDNA Alignment With Affine Gap Penalties
DNA Alignment With Affine Gap Penalties Laurel Schuster Why Use Affine Gap Penalties? When aligning two DNA sequences, one goal may be to infer the mutations that made them different. Though it s impossible
More informationEECS730: Introduction to Bioinformatics
EECS730: Introduction to Bioinformatics Lecture 04: Variations of sequence alignments http://www.pitt.edu/~mcs2/teaching/biocomp/tutorials/global.html Slides adapted from Dr. Shaojie Zhang (University
More informationLecture 2 Pairwise sequence alignment. Principles Computational Biology Teresa Przytycka, PhD
Lecture 2 Pairwise sequence alignment. Principles Computational Biology Teresa Przytycka, PhD Assumptions: Biological sequences evolved by evolution. Micro scale changes: For short sequences (e.g. one
More information3/5/2018 Lecture15. Comparing Sequences. By Miguel Andrade at English Wikipedia.
3/5/2018 Lecture15 Comparing Sequences By Miguel Andrade at English Wikipedia 1 http://localhost:8888/notebooks/comp555s18/lecture15.ipynb# 1/1 Sequence Similarity A common problem in Biology Insulin Protein
More informationComputational Molecular Biology
Computational Molecular Biology Erwin M. Bakker Lecture 2 Materials used from R. Shamir [2] and H.J. Hoogeboom [4]. 1 Molecular Biology Sequences DNA A, T, C, G RNA A, U, C, G Protein A, R, D, N, C E,
More informationSequence Alignment. part 2
Sequence Alignment part 2 Dynamic programming with more realistic scoring scheme Using the same initial sequences, we ll look at a dynamic programming example with a scoring scheme that selects for matches
More informationDynamicProgramming. September 17, 2018
DynamicProgramming September 17, 2018 1 Lecture 11: Dynamic Programming CBIO (CSCI) 4835/6835: Introduction to Computational Biology 1.1 Overview and Objectives We ve so far discussed sequence alignment
More informationLectures by Volker Heun, Daniel Huson and Knut Reinert, in particular last years lectures
4 FastA and the chaining problem We will discuss: Heuristics used by the FastA program for sequence alignment Chaining problem 4.1 Sources for this lecture Lectures by Volker Heun, Daniel Huson and Knut
More informationNotes on Dynamic-Programming Sequence Alignment
Notes on Dynamic-Programming Sequence Alignment Introduction. Following its introduction by Needleman and Wunsch (1970), dynamic programming has become the method of choice for rigorous alignment of DNA
More informationBiology 644: Bioinformatics
Find the best alignment between 2 sequences with lengths n and m, respectively Best alignment is very dependent upon the substitution matrix and gap penalties The Global Alignment Problem tries to find
More informationLecture 10. Sequence alignments
Lecture 10 Sequence alignments Alignment algorithms: Overview Given a scoring system, we need to have an algorithm for finding an optimal alignment for a pair of sequences. We want to maximize the score
More informationMouse, Human, Chimpanzee
More Alignments 1 Mouse, Human, Chimpanzee Mouse to Human Chimpanzee to Human 2 Mouse v.s. Human Chromosome X of Mouse to Human 3 Local Alignment Given: two sequences S and T Find: substrings of S and
More informationLecture 3: February Local Alignment: The Smith-Waterman Algorithm
CSCI1820: Sequence Alignment Spring 2017 Lecture 3: February 7 Lecturer: Sorin Istrail Scribe: Pranavan Chanthrakumar Note: LaTeX template courtesy of UC Berkeley EECS dept. Notes are also adapted from
More informationFastA & the chaining problem
FastA & the chaining problem We will discuss: Heuristics used by the FastA program for sequence alignment Chaining problem 1 Sources for this lecture: Lectures by Volker Heun, Daniel Huson and Knut Reinert,
More informationFastA and the chaining problem, Gunnar Klau, December 1, 2005, 10:
FastA and the chaining problem, Gunnar Klau, December 1, 2005, 10:56 4001 4 FastA and the chaining problem We will discuss: Heuristics used by the FastA program for sequence alignment Chaining problem
More informationCMSC423: Bioinformatic Algorithms, Databases and Tools Lecture 8. Note
MS: Bioinformatic lgorithms, Databases and ools Lecture 8 Sequence alignment: inexact alignment dynamic programming, gapped alignment Note Lecture 7 suffix trees and suffix arrays will be rescheduled Exact
More informationEECS730: Introduction to Bioinformatics
EECS730: Introduction to Bioinformatics Lecture 06: Multiple Sequence Alignment https://upload.wikimedia.org/wikipedia/commons/thumb/7/79/rplp0_90_clustalw_aln.gif/575px-rplp0_90_clustalw_aln.gif Slides
More informationSequence alignment is an essential concept for bioinformatics, as most of our data analysis and interpretation techniques make use of it.
Sequence Alignments Overview Sequence alignment is an essential concept for bioinformatics, as most of our data analysis and interpretation techniques make use of it. Sequence alignment means arranging
More informationDynamic Programming User Manual v1.0 Anton E. Weisstein, Truman State University Aug. 19, 2014
Dynamic Programming User Manual v1.0 Anton E. Weisstein, Truman State University Aug. 19, 2014 Dynamic programming is a group of mathematical methods used to sequentially split a complicated problem into
More informationLecture 10: Local Alignments
Lecture 10: Local Alignments Study Chapter 6.8-6.10 1 Outline Edit Distances Longest Common Subsequence Global Sequence Alignment Scoring Matrices Local Sequence Alignment Alignment with Affine Gap Penalties
More informationDivide and Conquer Algorithms. Problem Set #3 is graded Problem Set #4 due on Thursday
Divide and Conquer Algorithms Problem Set #3 is graded Problem Set #4 due on Thursday 1 The Essence of Divide and Conquer Divide problem into sub-problems Conquer by solving sub-problems recursively. If
More informationLocal Alignment & Gap Penalties CMSC 423
Local Alignment & ap Penalties CMSC 423 lobal, Semi-global, Local Alignments Last time, we saw a dynamic programming algorithm for global alignment: both strings s and t must be completely matched: s t
More informationSpecial course in Computer Science: Advanced Text Algorithms
Special course in Computer Science: Advanced Text Algorithms Lecture 6: Alignments Elena Czeizler and Ion Petre Department of IT, Abo Akademi Computational Biomodelling Laboratory http://www.users.abo.fi/ipetre/textalg
More informationDivide and Conquer. Bioinformatics: Issues and Algorithms. CSE Fall 2007 Lecture 12
Divide and Conquer Bioinformatics: Issues and Algorithms CSE 308-408 Fall 007 Lecture 1 Lopresti Fall 007 Lecture 1-1 - Outline MergeSort Finding mid-point in alignment matrix in linear space Linear space
More informationLecture 12: Divide and Conquer Algorithms
Lecture 12: Divide and Conquer Algorithms Study Chapter 7.1 7.4 1 Divide and Conquer Algorithms Divide problem into sub-problems Conquer by solving sub-problems recursively. If the sub-problems are small
More informationAlgorithmic Approaches for Biological Data, Lecture #20
Algorithmic Approaches for Biological Data, Lecture #20 Katherine St. John City University of New York American Museum of Natural History 20 April 2016 Outline Aligning with Gaps and Substitution Matrices
More informationDivide & Conquer Algorithms
Divide & Conquer Algorithms Outline 1. MergeSort 2. Finding the middle vertex 3. Linear space sequence alignment 4. Block alignment 5. Four-Russians speedup 6. LCS in sub-quadratic time Section 1: MergeSort
More informationDivide & Conquer Algorithms
Divide & Conquer Algorithms Outline MergeSort Finding the middle point in the alignment matrix in linear space Linear space sequence alignment Block Alignment Four-Russians speedup Constructing LCS in
More informationPresentation for use with the textbook, Algorithm Design and Applications, by M. T. Goodrich and R. Tamassia, Wiley, Dynamic Programming
Presentation for use with the textbook, Algorithm Design and Applications, by M. T. Goodrich and R. Tamassia, Wiley, 25 Dynamic Programming Terrible Fibonacci Computation Fibonacci sequence: f = f(n) 2
More informationA Design of a Hybrid System for DNA Sequence Alignment
IMECS 2008, 9-2 March, 2008, Hong Kong A Design of a Hybrid System for DNA Sequence Alignment Heba Khaled, Hossam M. Faheem, Tayseer Hasan, Saeed Ghoneimy Abstract This paper describes a parallel algorithm
More informationOPEN MP-BASED PARALLEL AND SCALABLE GENETIC SEQUENCE ALIGNMENT
OPEN MP-BASED PARALLEL AND SCALABLE GENETIC SEQUENCE ALIGNMENT Asif Ali Khan*, Laiq Hassan*, Salim Ullah* ABSTRACT: In bioinformatics, sequence alignment is a common and insistent task. Biologists align
More informationTCCAGGTG-GAT TGCAAGTGCG-T. Local Sequence Alignment & Heuristic Local Aligners. Review: Probabilistic Interpretation. Chance or true homology?
Local Sequence Alignment & Heuristic Local Aligners Lectures 18 Nov 28, 2011 CSE 527 Computational Biology, Fall 2011 Instructor: Su-In Lee TA: Christopher Miles Monday & Wednesday 12:00-1:20 Johnson Hall
More informationDynamic Programming & Smith-Waterman algorithm
m m Seminar: Classical Papers in Bioinformatics May 3rd, 2010 m m 1 2 3 m m Introduction m Definition is a method of solving problems by breaking them down into simpler steps problem need to contain overlapping
More informationGlobal Alignment Scoring Matrices Local Alignment Alignment with Affine Gap Penalties
Global Alignment Scoring Matrices Local Alignment Alignment with Affine Gap Penalties From LCS to Alignment: Change the Scoring The Longest Common Subsequence (LCS) problem the simplest form of sequence
More informationOutline. Sequence Alignment. Types of Sequence Alignment. Genomics & Computational Biology. Section 2. How Computers Store Information
enomics & omputational Biology Section Lan Zhang Sep. th, Outline How omputers Store Information Sequence lignment Dot Matrix nalysis Dynamic programming lobal: NeedlemanWunsch lgorithm Local: SmithWaterman
More informationReconstructing long sequences from overlapping sequence fragment. Searching databases for related sequences and subsequences
SEQUENCE ALIGNMENT ALGORITHMS 1 Why compare sequences? Reconstructing long sequences from overlapping sequence fragment Searching databases for related sequences and subsequences Storing, retrieving and
More informationSequence analysis Pairwise sequence alignment
UMF11 Introduction to bioinformatics, 25 Sequence analysis Pairwise sequence alignment 1. Sequence alignment Lecturer: Marina lexandersson 12 September, 25 here are two types of sequence alignments, global
More informationSequence alignment algorithms
Sequence alignment algorithms Bas E. Dutilh Systems Biology: Bioinformatic Data Analysis Utrecht University, February 23 rd 27 After this lecture, you can decide when to use local and global sequence alignments
More informationShortest Path Algorithm
Shortest Path Algorithm C Works just fine on this graph. C Length of shortest path = Copyright 2005 DIMACS BioMath Connect Institute Robert Hochberg Dynamic Programming SP #1 Same Questions, Different
More informationAlignment of Long Sequences
Alignment of Long Sequences BMI/CS 776 www.biostat.wisc.edu/bmi776/ Spring 2009 Mark Craven craven@biostat.wisc.edu Pairwise Whole Genome Alignment: Task Definition Given a pair of genomes (or other large-scale
More informationAn Analysis of Pairwise Sequence Alignment Algorithm Complexities: Needleman-Wunsch, Smith-Waterman, FASTA, BLAST and Gapped BLAST
An Analysis of Pairwise Sequence Alignment Algorithm Complexities: Needleman-Wunsch, Smith-Waterman, FASTA, BLAST and Gapped BLAST Alexander Chan 5075504 Biochemistry 218 Final Project An Analysis of Pairwise
More informationCombinatorial Pattern Matching. CS 466 Saurabh Sinha
Combinatorial Pattern Matching CS 466 Saurabh Sinha Genomic Repeats Example of repeats: ATGGTCTAGGTCCTAGTGGTC Motivation to find them: Genomic rearrangements are often associated with repeats Trace evolutionary
More informationComputational Genomics and Molecular Biology, Fall
Computational Genomics and Molecular Biology, Fall 2015 1 Sequence Alignment Dannie Durand Pairwise Sequence Alignment The goal of pairwise sequence alignment is to establish a correspondence between the
More informationCSE 417 Dynamic Programming (pt 5) Multiple Inputs
CSE 417 Dynamic Programming (pt 5) Multiple Inputs Reminders > HW5 due Wednesday Dynamic Programming Review > Apply the steps... optimal substructure: (small) set of solutions, constructed from solutions
More informationComputational Molecular Biology
Computational Molecular Biology Erwin M. Bakker Lecture 3, mainly from material by R. Shamir [2] and H.J. Hoogeboom [4]. 1 Pairwise Sequence Alignment Biological Motivation Algorithmic Aspect Recursive
More information6.1 The Power of DNA Sequence Comparison
6 Dynamic Programming Algorithms We introduced dynamic programming in chapter 2 with the Rocks problem. While the Rocks problem does not appear to be related to bioinformatics, the algorithm that we described
More informationDynamic Programming. Lecture Overview Introduction
Lecture 12 Dynamic Programming 12.1 Overview Dynamic Programming is a powerful technique that allows one to solve many different types of problems in time O(n 2 ) or O(n 3 ) for which a naive approach
More informationFrom Smith-Waterman to BLAST
From Smith-Waterman to BLAST Jeremy Buhler July 23, 2015 Smith-Waterman is the fundamental tool that we use to decide how similar two sequences are. Isn t that all that BLAST does? In principle, it is
More informationFINDING APPROXIMATE REPEATS WITH MULTIPLE SPACED SEEDS
FINDING APPROXIMATE REPEATS WITH MULTIPLE SPACED SEEDS FINDING APPROXIMATE REPEATS IN DNA SEQUENCES USING MULTIPLE SPACED SEEDS By SARAH BANYASSADY, B.S. A Thesis Submitted to the School of Graduate Studies
More informationLongest Common Subsequence
.. CSC 448 Bioinformatics Algorithms Alexander Dekhtyar.. Dynamic Programming for Bioinformatics... Longest Common Subsequence Subsequence. Given a string S = s 1 s 2... s n, a subsequence of S is any
More information5.1 The String reconstruction problem
CS125 Lecture 5 Fall 2014 5.1 The String reconstruction problem The greedy approach doesn t always work, as we have seen. It lacks flexibility; if at some point, it makes a wrong choice, it becomes stuck.
More informationAlignment of Pairs of Sequences
Bi03a_1 Unit 03a: Alignment of Pairs of Sequences Partners for alignment Bi03a_2 Protein 1 Protein 2 =amino-acid sequences (20 letter alphabeth + gap) LGPSSKQTGKGS-SRIWDN LN-ITKSAGKGAIMRLGDA -------TGKG--------
More informationBioinformatics explained: Smith-Waterman
Bioinformatics Explained Bioinformatics explained: Smith-Waterman May 1, 2007 CLC bio Gustav Wieds Vej 10 8000 Aarhus C Denmark Telephone: +45 70 22 55 09 Fax: +45 70 22 55 19 www.clcbio.com info@clcbio.com
More informationPairwise Sequence Alignment: Dynamic Programming Algorithms. COMP Spring 2015 Luay Nakhleh, Rice University
Pairwise Sequence Alignment: Dynamic Programming Algorithms COMP 571 - Spring 2015 Luay Nakhleh, Rice University DP Algorithms for Pairwise Alignment The number of all possible pairwise alignments (if
More informationSequence Alignment 1
Sequence Alignment 1 Nucleotide and Base Pairs Purine: A and G Pyrimidine: T and C 2 DNA 3 For this course DNA is double-helical, with two complementary strands. Complementary bases: Adenine (A) - Thymine
More informationPairwise Sequence Alignment: Dynamic Programming Algorithms COMP 571 Luay Nakhleh, Rice University
1 Pairwise Sequence Alignment: Dynamic Programming Algorithms COMP 571 Luay Nakhleh, Rice University DP Algorithms for Pairwise Alignment 2 The number of all possible pairwise alignments (if gaps are allowed)
More informationBioinformatics for Biologists
Bioinformatics for Biologists Sequence Analysis: Part I. Pairwise alignment and database searching Fran Lewitter, Ph.D. Director Bioinformatics & Research Computing Whitehead Institute Topics to Cover
More informationCMPS 102 Solutions to Homework 7
CMPS 102 Solutions to Homework 7 Kuzmin, Cormen, Brown, lbrown@soe.ucsc.edu November 17, 2005 Problem 1. 15.4-1 p.355 LCS Determine an LCS of x = (1, 0, 0, 1, 0, 1, 0, 1) and y = (0, 1, 0, 1, 1, 0, 1,
More informationBGGN 213 Foundations of Bioinformatics Barry Grant
BGGN 213 Foundations of Bioinformatics Barry Grant http://thegrantlab.org/bggn213 Recap From Last Time: 25 Responses: https://tinyurl.com/bggn213-02-f17 Why ALIGNMENT FOUNDATIONS Why compare biological
More informationFASTA. Besides that, FASTA package provides SSEARCH, an implementation of the optimal Smith- Waterman algorithm.
FASTA INTRODUCTION Definition (by David J. Lipman and William R. Pearson in 1985) - Compares a sequence of protein to another sequence or database of a protein, or a sequence of DNA to another sequence
More informationSequence Comparison: Dynamic Programming. Genome 373 Genomic Informatics Elhanan Borenstein
Sequence omparison: Dynamic Programming Genome 373 Genomic Informatics Elhanan Borenstein quick review: hallenges Find the best global alignment of two sequences Find the best global alignment of multiple
More informationBIOL591: Introduction to Bioinformatics Alignment of pairs of sequences
BIOL591: Introduction to Bioinformatics Alignment of pairs of sequences Reading in text (Mount Bioinformatics): I must confess that the treatment in Mount of sequence alignment does not seem to me a model
More informationSequence Alignment (chapter 6) p The biological problem p Global alignment p Local alignment p Multiple alignment
Sequence lignment (chapter 6) p The biological problem p lobal alignment p Local alignment p Multiple alignment Local alignment: rationale p Otherwise dissimilar proteins may have local regions of similarity
More informationBLAST & Genome assembly
BLAST & Genome assembly Solon P. Pissis Tomáš Flouri Heidelberg Institute for Theoretical Studies May 15, 2014 1 BLAST What is BLAST? The algorithm 2 Genome assembly De novo assembly Mapping assembly 3
More informationDivide & Conquer Algorithms
Divide & Conquer Algorithms Outline MergeSort Finding the middle point in the alignment matrix in linear space Linear space sequence alignment Block Alignment Four-Russians speedup Constructing LCS in
More informationDivya R. Singh. Faster Sequence Alignment using Suffix Tree and Data-Mining Techniques. February A Thesis Presented by
Faster Sequence Alignment using Suffix Tree and Data-Mining Techniques A Thesis Presented by Divya R. Singh to The Faculty of the Graduate College of the University of Vermont In Partial Fulfillment of
More informationDynamic Programming II
June 9, 214 DP: Longest common subsequence biologists often need to find out how similar are 2 DNA sequences DNA sequences are strings of bases: A, C, T and G how to define similarity? DP: Longest common
More informationSept. 9, An Introduction to Bioinformatics. Special Topics BSC5936:
Special Topics BSC5936: An Introduction to Bioinformatics. Florida State University The Department of Biological Science www.bio.fsu.edu Sept. 9, 2003 The Dot Matrix Method Steven M. Thompson Florida State
More informationLecture 9: Core String Edits and Alignments
Biosequence Algorithms, Spring 2005 Lecture 9: Core String Edits and Alignments Pekka Kilpeläinen University of Kuopio Department of Computer Science BSA Lecture 9: String Edits and Alignments p.1/30 III:
More informationGene regulation. DNA is merely the blueprint Shared spatially (among all tissues) and temporally But cells manage to differentiate
Gene regulation DNA is merely the blueprint Shared spatially (among all tissues) and temporally But cells manage to differentiate Especially but not only during developmental stage And cells respond to
More informationMemoization/Dynamic Programming. The String reconstruction problem. CS124 Lecture 11 Spring 2018
CS124 Lecture 11 Spring 2018 Memoization/Dynamic Programming Today s lecture discusses memoization, which is a method for speeding up algorithms based on recursion, by using additional memory to remember
More informationIn this section we describe how to extend the match refinement to the multiple case and then use T-Coffee to heuristically compute a multiple trace.
5 Multiple Match Refinement and T-Coffee In this section we describe how to extend the match refinement to the multiple case and then use T-Coffee to heuristically compute a multiple trace. This exposition
More informationThe Dot Matrix Method
Special Topics BS5936: An Introduction to Bioinformatics. Florida State niversity The Department of Biological Science www.bio.fsu.edu Sept. 9, 2003 The Dot Matrix Method Steven M. Thompson Florida State
More informationDatabase Searching Using BLAST
Mahidol University Objectives SCMI512 Molecular Sequence Analysis Database Searching Using BLAST Lecture 2B After class, students should be able to: explain the FASTA algorithm for database searching explain
More informationPairwise alignment II
Pairwise alignment II Agenda - Previous Lesson: Minhala + Introduction - Review Dynamic Programming - Pariwise Alignment Biological Motivation Today: - Quick Review: Sequence Alignment (Global, Local,
More informationReminder: sequence alignment in sub-quadratic time
Reminder: sequence alignment in sub-quadratic time Last week: Sequence alignment in sub-quadratic time for unrestricted Scoring Schemes. ) utilize LZ78 parsing 2) utilize Total Monotonicity property of
More informationAdvanced Algorithms Class Notes for Monday, November 10, 2014
Advanced Algorithms Class Notes for Monday, November 10, 2014 Bernard Moret Divide-and-Conquer: Matrix Multiplication Divide-and-conquer is especially useful in computational geometry, but also in numerical
More informationCOMP 251 Winter 2017 Online quizzes with answers
COMP 251 Winter 2017 Online quizzes with answers Open Addressing (2) Which of the following assertions are true about open address tables? A. You cannot store more records than the total number of slots
More informationAlgorithm Design and Analysis
Algorithm Design and Analysis LECTURE 16 Dynamic Programming Least Common Subsequence Saving space Adam Smith Least Common Subsequence A.k.a. sequence alignment edit distance Longest Common Subsequence
More informationRegular Expression Constrained Sequence Alignment
Regular Expression Constrained Sequence Alignment By Abdullah N. Arslan Department of Computer science University of Vermont Presented by Tomer Heber & Raz Nissim otivation When comparing two proteins,
More informationLectures 12 and 13 Dynamic programming: weighted interval scheduling
Lectures 12 and 13 Dynamic programming: weighted interval scheduling COMP 523: Advanced Algorithmic Techniques Lecturer: Dariusz Kowalski Lectures 12-13: Dynamic Programming 1 Overview Last week: Graph
More informationLeast Squares; Sequence Alignment
Least Squares; Sequence Alignment 1 Segmented Least Squares multi-way choices applying dynamic programming 2 Sequence Alignment matching similar words applying dynamic programming analysis of the algorithm
More informationWrite an algorithm to find the maximum value that can be obtained by an appropriate placement of parentheses in the expression
Chapter 5 Dynamic Programming Exercise 5.1 Write an algorithm to find the maximum value that can be obtained by an appropriate placement of parentheses in the expression x 1 /x /x 3 /... x n 1 /x n, where
More informationCSED233: Data Structures (2017F) Lecture12: Strings and Dynamic Programming
(2017F) Lecture12: Strings and Dynamic Programming Daijin Kim CSE, POSTECH dkim@postech.ac.kr Strings A string is a sequence of characters Examples of strings: Python program HTML document DNA sequence
More informationLecture 9 Graph Traversal
Lecture 9 Graph Traversal Euiseong Seo (euiseong@skku.edu) SWE00: Principles in Programming Spring 0 Euiseong Seo (euiseong@skku.edu) Need for Graphs One of unifying themes of computer science Closely
More informationCompares a sequence of protein to another sequence or database of a protein, or a sequence of DNA to another sequence or library of DNA.
Compares a sequence of protein to another sequence or database of a protein, or a sequence of DNA to another sequence or library of DNA. Fasta is used to compare a protein or DNA sequence to all of the
More informationRochester Institute of Technology. Making personalized education scalable using Sequence Alignment Algorithm
Rochester Institute of Technology Making personalized education scalable using Sequence Alignment Algorithm Submitted by: Lakhan Bhojwani Advisor: Dr. Carlos Rivero 1 1. Abstract There are many ways proposed
More informationAcceleration of the Smith-Waterman algorithm for DNA sequence alignment using an FPGA platform
Acceleration of the Smith-Waterman algorithm for DNA sequence alignment using an FPGA platform Barry Strengholt Matthijs Brobbel Delft University of Technology Faculty of Electrical Engineering, Mathematics
More information1 Dynamic Programming
Recitation 13 Dynamic Programming Parallel and Sequential Data Structures and Algorithms, 15-210 (Fall 2013) November 20, 2013 1 Dynamic Programming Dynamic programming is a technique to avoid needless
More informationPairwise Sequence Alignment. Zhongming Zhao, PhD
Pairwise Sequence Alignment Zhongming Zhao, PhD Email: zhongming.zhao@vanderbilt.edu http://bioinfo.mc.vanderbilt.edu/ Sequence Similarity match mismatch A T T A C G C G T A C C A T A T T A T G C G A T
More informationA Study On Pair-Wise Local Alignment Of Protein Sequence For Identifying The Structural Similarity
A Study On Pair-Wise Local Alignment Of Protein Sequence For Identifying The Structural Similarity G. Pratyusha, Department of Computer Science & Engineering, V.R.Siddhartha Engineering College(Autonomous)
More informationCHAPTER-6 WEB USAGE MINING USING CLUSTERING
CHAPTER-6 WEB USAGE MINING USING CLUSTERING 6.1 Related work in Clustering Technique 6.2 Quantifiable Analysis of Distance Measurement Techniques 6.3 Approaches to Formation of Clusters 6.4 Conclusion
More information