Programming for Scientists (02-201) Prof: Phillip Compeau TA: Tim Wall

Transcription

1 Programming for Scientists (02-201) Prof: Phillip Compeau TA: Tim Wall

2 Introduce Yourselves!

3 Who Has Programmed Before?

4 Class Goals 1. Learn the basics of programming (in Go). 2. Understand some algorithms needed for science.

5 Course Format 50%: Homework assignments (Autolab) 40%: Exams 10%: Midterm 1 10%: Midterm 2 20%: Final exam 10%: Class participation

6 Getting Help My office hours: Wed. 10:30 AM 11:30 AM (GHC 7403) or by appointment Tim s office hours: Mon., Thurs. 3:30 PM 4:30 PM (GHC 7409) Piazza: online private discussion forum

7 Academic Honesty Good: discussing homework assignments with classmates/tas/professor indicating these discussions in your code. Bad: using someone else s code (even part of it) using previous semester s answer keys/solution manuals

8 Phone/Computer Policy

9 ?

10 Brain Teasers We ll start with a few brain teasers to get you thinking computationally. First: how did I know the day of the week that your birthday is on?

11 Communicating when Locked-In

12 Bauby s Solution Courtesy: Canal Plus

13 Finding the Only Other Survivor on Earth?

14 An Elegant Solution Each person walks randomly. Every once in a while, they mark the direction that they went in. Every other day, they stop to rest. If they find the other person s mark, they follow the direction of the arrow without resting. They return to random walking if they don t find another mark (or the other person) within a few days.

15 Teaching a Robot to Play Soccer?

16 What Does This Have to Do With Science? Ge0y

17 A Prophetic One-Liner Francis Crick James Watson "It has not escaped our notice that the specific pairing we have postulated immediately suggests a possible copying mechanism for the genetic material."

18 The Copying Mechanism

19 The Copying Mechanism

20 The Copying Mechanism

21 What a Biologist Sees...

22 What a Computer Scientist Sees......ACTGATAACCCAGTATCAGACCAGTATCGAGGACGATACGTA... DNA String

23 What a Computer Scientist Sees......ACTGATAACCCAGTATCAGACCAGTATCGAGGACGATACGTA... DNA String Complicated Biological Process

24 What a Computer Scientist Sees......ACTGATAACCCAGTATCAGACCAGTATCGAGGACGATACGTA... DNA String Complicated Biological Process Copy 1...ACTGATAACCCAGTATCAGACCAGTATCGAGGACGATACGTA......ACTGATAACCCAGTATCAGACCAGTATCGAGGACGATACGTA... Copy 2

25 Origin of Replication Replication begins in a region called the replication origin (denoted ori).

26 Viral Vectors/Gene Therapy Inserted gene Origin of replication STOP and Think: How could we locate ori? Cell

27 Finding the Origin of Replication Finding ori Problem: Find ori in a genome.

28 Finding the Origin of Replication Finding ori Problem: Find ori in a genome. Let s hack out this DNA fragment. Can the genome replicate without it?

29 Finding the Origin of Replication Finding ori Problem: Find ori in a genome. Let s hack out this DNA fragment. Can the genome replicate without it? I need more information before I can hack this problem.

30 Looking for ori Verified ori of Vibrio cholerae, the bacterium that causes cholera ( 500 nucleotides): atcaatgatcaacgtaagcttctaagcatgatcaaggtgctcacacagtttatccacaac ctgagtggatgacatcaagataggtcgttgtatctccttcctctcgtactctcatgacca cggaaagatgatcaagagaggatgatttcttggccatatcgcaatgaatacttgtgactt gtgcttccaattgacatcttcagcgccatattgcgctggccaaggtgacggagcgggatt acgaaagcatgatcatggctgttgttctgtttatcttgttttgactgagacttgttagga tagacggtttttcatcactgactagccaaagccttactctgcctgacatcgaccgtaaat tgataatgaatttacatgcttccgcgacgatttacctcttgatcatcgatccgattgaag atcttcaattgttaattctcttgcctcgactcatagccatgatgagctcttgatcatgtt tccttaaccctctattttttacggaagaatgatcaagctgctgctcttgatcatcgtttc

31 Looking for ori Verified ori of Vibrio cholerae, the bacterium that causes cholera ( 500 nucleotides): atcaatgatcaacgtaagcttctaagcatgatcaaggtgctcacacagtttatccacaac ctgagtggatgacatcaagataggtcgttgtatctccttcctctcgtactctcatgacca cggaaagatgatcaagagaggatgatttcttggccatatcgcaatgaatacttgtgactt gtgcttccaattgacatcttcagcgccatattgcgctggccaaggtgacggagcgggatt acgaaagcatgatcatggctgttgttctgtttatcttgttttgactgagacttgttagga tagacggtttttcatcactgactagccaaagccttactctgcctgacatcgaccgtaaat tgataatgaatttacatgcttccgcgacgatttacctcttgatcatcgatccgattgaag atcttcaattgttaattctcttgcctcgactcatagccatgatgagctcttgatcatgtt tccttaaccctctattttttacggaagaatgatcaagctgctgctcttgatcatcgtttc There must be a hidden message telling the cell to start replication here.

32 The Hidden Message Problem Hidden Message Problem. Find a hidden message in the replication origin. Input: A string Text (representing ori). Output: A hidden message in Text.

33 The Hidden Message Problem Hidden Message Problem. Find a hidden message in the replication origin. Input: A string Text (representing ori). Output: A hidden message in Text. STOP and Think: Is the Hidden Message Problem clearly stated to the computer scientist?

34 Hidden Messages in The Gold-Bug 53++!305))6*;4826)4+.)4+) ;806*;48!8`60))85;]8*:+*8!83(88)5*!;46(;88*96*?;8) *+(;485);5*!2:*+(;4956*2( 5*4)8`8*; );)6!8)4+ +;1(+9;48081;8:8+1;48!85; 4)485!528806*81(+9;48;(88 ;4(+?34;48)4+;161;:188;+?; Edgar Allan Poe

35 Hidden Messages in The Gold-Bug 53++!305))6*;4826)4+.)4+) ;806*;48!8`60))85;]8*:+*8!83(88)5*!;46(;88*96*?;8) *+(;485);5*!2:*+(;4956*2( 5*4)8`8*; );)6!8)4+ +;1(+9;48081;8:8+1;48!85; 4)485!528806*81(+9;48;(88 ;4(+?34;48)4+;161;:188;+?; Edgar Allan Poe STOP and Think: How would you decode this message?

36 Why is ;48 so Frequent? 53++!305))6*;4826)4+.)4+) ;806*;48!8`60))85;]8*:+*8!83(88)5*!;46(;88*96*?;8) *+(;485);5*!2:*+(;4956*2( 5*4)8`8*; );)6!8)4+ +;1(+9;48081;8:8+1;48!85; 4)485!528806*81(+9;48;(88 ;4(+?34;48)4+;161;:188;+?; Edgar Allan Poe

37 THE is the Most Frequent English Word 53++!305))6*THE26)4+.)4+) ;806*THE!8`60))85;]8*:+*8!83(88)5*!;46(;88*96*?;8) *+(THE5);5*!2:*+(;4956*2( 5*4)8`8*; );)6!8)4+ +;1(+9THE081;8:8+1THE!85; 4)485!528806*81(+9THE;(88 ;4(+?34THE)4+;161;:188;+?; Edgar Allan Poe

38 Can You Finish Decoding the Message? 53++!305))6*THE26)H+.)H+) T806*THE!E`60))E5;]E*:+*E!E3(EE)5*!TH6(TEE*96*?;E) *+(THE5)T5*!2:*+(TH956*2( 5*H)E`E*TH0692E5)T)6!E)H+ +T1(+9THE0E1TE:E+1THE!E5T 4)HE5!52EE06*E1(+9THET(EE TH(+?34THE)H+T161T:1EET+?T Edgar Allan Poe

39 Hidden Message Problem Revisited Hidden Message Problem. Find a hidden message in the replication origin. Input: A string Text (representing ori). Output: A hidden message in Text. The notion of hidden message is not defined.

40 Hidden Message Problem Revisited Hidden Message Problem. Find a hidden message in the replication origin. Input: A string Text (representing ori). Output: A hidden message in Text. The notion of hidden message is not defined. Hint: For various biological processes, certain important words appear frequently in short regions of the genome.

41 Hidden Message Problem Revisited Hidden Message Problem. Find a hidden message in the replication origin. Input: A string Text (representing ori). Output: A hidden message in Text. Replication initiation is mediated by a protein called DnaA.

42 Hidden Message Problem Revisited Hidden Message Problem. Find a hidden message in the replication origin. Input: A string Text (representing ori). Output: A hidden message in Text. Replication initiation is mediated by a protein called DnaA. DnaA binds to a short segment in ori known as a DnaA box, a hidden message saying: bind here!

43 Hidden Message Problem Revisited Hidden Message Problem. Find a hidden message in the replication origin. Input: A string Text (representing ori). Output: A hidden message in Text. Replication initiation is mediated by a protein called DnaA. DnaA binds to a short segment in ori known as a DnaA box, a hidden message saying: bind here! Multiple DnaA boxes à higher chance of binding

44 The Frequent Words Problem k-mer: A string of length k.

45 The Frequent Words Problem k-mer: A string of length k. A k-mer Pattern is a most frequent k-mer in a string if no other k-mer is more frequent than Pattern.

46 The Frequent Words Problem k-mer: A string of length k. A k-mer Pattern is a most frequent k-mer in a string if no other k-mer is more frequent than Pattern. Frequent Words Problem. Find the most frequent k- mers in a string. Input: A string Text and an integer k. Output: All most frequent k-mers in Text.

47 The Frequent Words Problem k-mer: A string of length k. A k-mer Pattern is a most frequent k-mer in a string if no other k-mer is more frequent than Pattern. Frequent Words Problem. Find the most frequent k- mers in a string. Input: A string Text and an integer k. Output: All most frequent k-mers in Text. STOP and Think: Now is this problem clearly stated?

48 Computational Problems Computational Problem: A clearly defined problem along with Input: the object we need to process. Output: the result of solving the problem.

49 Algorithms Algorithm: A clearly described sequence of steps solving a given computational problem.

50 Algorithms Algorithm: A clearly described sequence of steps solving a given computational problem. Input Algorithm Output

51 Solving the Frequent Words Problem Frequent Words Problem. Find the most frequent k- mers in a string. Input: A string Text and an integer k. Output: All most frequent k-mers in Text. Exercise Break: Design an algorithm for solving the Frequent Words Problem.

52 Solving the Frequent Words Problem Frequent Words Problem. Find the most frequent k- mers in a string. Input: A string Text and an integer k. Output: All most frequent k-mers in Text. 1. Identify every k-mer appearing in Text. 2. Count the number of times each such k-mer appears in Text. 3. Take the k-mers having the maximum counts.

53 Solving the Frequent Words Problem Frequent Words Problem. Find the most frequent k- mers in a string. Input: A string Text and an integer k. Output: All most frequent k-mers in Text. 1. Identify every k-mer appearing in Text. 2. Count the number of times each such k-mer appears in Text. 3. Take the k-mers having the maximum counts.

54 Counting Pattern in Text 1. Start from the first position of Text and check whether Pattern appears in Text starting at its first position. 2. If yes, draw a dot on a piece of paper. 3. Move to the second position of Text and check whether Pattern appears in Text starting at its second position. 4. If yes, draw another dot on the same piece of paper. 5. Continue until you reach the end of Text. 6. Count the number of dots on the piece of paper. STOP and Think: Is this algorithm clear?

55 Humans vs. Computers Slow Makes mistakes Hates repetitive work Fast Accurate Loves repetitive work

56 Humans vs. Computers Slow Makes mistakes Hates repetitive work Understands human language Fast Accurate Loves repetitive work Does not understand human language

57 Humans vs. Computers Slow Makes mistakes Hates repetitive work Understands human language Fast Accurate Loves repetitive work Does not understand human language... yet

58 Many Programming Languages

59 Pseudocode Pseudocode: A way of describing algorithms by emphasizing ideas that is just right...

60 Pseudocode Pseudocode: A way of describing algorithms by emphasizing ideas that is just right... Not too vague, like human language Not too precise, like a specific programming language

61 An Example Program Distance(x1, y1, x2, y2) d ß (x2 x1) 2 + (y2 y1) 2 d ß d return d

62 An Example Program Distance(x1, y1, x2, y2) d ß (x2 x1) 2 + (y2 y1) 2 d ß d return d Distance: name of the algorithm.

63 An Example Program Distance(x1, y1, x2, y2) d ß (x2 x1) 2 + (y2 y1) 2 d ß d return d x1, y1, x2, y2: input arguments / parameters.

64 An Example Program Distance(x1, y1, x2, y2) d ß (x2 x1) 2 + (y2 y1) 2 d ß d return d d: a variable whose value changes in the program.

65 An Example Program Distance(x1, y1, x2, y2) d ß (x2 x1) 2 + (y2 y1) 2 d ß d return d ß: assign value on right to variable on left

66 An Example Program Distance(x1, y1, x2, y2) d ß (x2 x1) 2 + (y2 y1) 2 d ß d return d d ß d: a variable can be used to update itself.

67 An Example Program Distance(x1, y1, x2, y2) d ß (x2 x1) 2 + (y2 y1) 2 d ß d return d return d: output of algorithm.

68 Another Program Distance(x1, y1, x2, y2) d ß (x2 x1) 2 + (y2 y1) 2 d ß d return d f(x, y, z, w) abracadabra ß (z x) 2 + (w y) 2 abracadabra ß abracadabra return abracadabra STOP and Think: Is this algorithm different from the last one?

69 Minimum2(a, b) if a > b return b else return a If Statements

70 If Statements Minimum2(a, b) if a > b return b else return a if statement: takes following form. if statement X is true execute instructions Y else (statement X is not true) execute instructions Z

71 Minimum3(a, b, c) if a > b if b > c return c else return b If Statements

72 Minimum3(a, b, c) if a > b if b > c return c else return b else if a > c return c else return a If Statements

73 If Statements Minimum3(a, b, c) if a > b if b > c return c else return b else if a > c return c else return a STOP and Think: Where have we seen this code?

74 If Statements Minimum3(a, b, c) if a > b if b > c return c else return b else if a > c return c else return a Minimum2(b, c) Minimum2(a, c) STOP and Think: Where have we seen this code?

75 If Statements Minimum3(a, b, c) if a > b return Minimum2(b, c) else return Minimum2(a, c)

76 If Statements Minimum3(a, b, c) if a > b return Minimum2(b, c) else return Minimum2(a, c) Subroutine: a function used within another function.

77 If Statements Minimum3(a, b, c) if a > b return Minimum2(b, c) else return Minimum2(a, c) Subroutine: a function used within another function. Exercise Break: Write pseudocode for a function Minimum4(a, b, c, d) that computes the minimum of four numbers.