Mineração de Dados Aplicada
|
|
- Matilda McLaughlin
- 5 years ago
- Views:
Transcription
1 sed September, 10 th 2018 DCC ICEx UFMG
2 Outline for the next sessions Today sed; 12/09 awk s basics; 17/09 awk s array; 19/09 A few words about efficiency; 24/09 Oral presentation of your data. 2 / 17
3 Outline for the next sessions Today sed; 12/09 awk s basics; 17/09 awk s array; 19/09 A few words about efficiency; 24/09 Oral presentation of your data. 2 / 17
4 Outline for the next sessions Today sed; 12/09 awk s basics; 17/09 awk s array; 19/09 A few words about efficiency; 24/09 Oral presentation of your data. Date for the exam on the POSIX text-processing commands? 2 / 17
5 Outline for this session 1 Correction of last week exercises 2 Non-interactive editing 3 / 17
6 Correction of last week exercises Outline 1 Correction of last week exercises 2 Non-interactive editing 4 / 17
7 Correction of last week exercises Repeated user names Repeated user names tr -s < retweets.txt cut -d -f 5 sort -u sort -f uniq -id 5 / 17
8 Correction of last week exercises Repeated user names Repeated user names (all versions) tr -s < retweets.txt cut -d -f 5 sort -u sort -f uniq -id --all-repeated=separate 5 / 17
9 Correction of last week exercises Repeated user names Repeated user names tr -s < retweets.txt cut -d -f 5 sort -u sort -f uniq -id Without cut (whole lines are output) sort -uk 4 retweets.txt sort -fk 4 uniq -idf 3 5 / 17
10 Correction of last week exercises Count keywords With a Shell loop tr -s [:space:][:punct:] \n < text > words while read keyword do grep -ixc $keyword words done < keywords paste -d keywords - 6 / 17
11 Correction of last week exercises Count keywords With a Shell loop tr -s [:space:][:punct:] \n < text > words while read keyword do grep -ixc $keyword words done < keywords paste -d keywords - Without a Shell loop tr -s [:space:][:punct:] \n < text grep -ixf keywords sort -f uniq -ci 6 / 17
12 Correction of last week exercises Count keywords With a Shell loop tr -s [:space:][:punct:] \n < text > words while read keyword do grep -ixc $keyword words done < keywords paste -d keywords - Without a Shell loop tr -s [:space:][:punct:] \n < text grep -ixf keywords sort -f uniq -ci To only list the keywords occuring in the text tr -s [:space:][:punct:] \n < text grep -ixf keywords sort -uf 6 / 17
13 Outline 1 Correction of last week exercises 2 Non-interactive editing 7 / 17
14 Adding transformational capabilities grep only selects lines based on a regexp. sed additionally allows to transform those lines. 8 / 17
15 Adding transformational capabilities grep only selects lines based on a regexp. sed additionally allows to transform those lines. sed is Turing-complete. A complex sed script is quite hard to read (unless you are a computer). 8 / 17
16 Learning sed 1 The following slides; 2 Tutorials on the Web; 3 info sed. 9 / 17
17 Learning sed 1 The following slides; 2 Tutorials on the Web; 3 info sed. And cheat sheets on the Web... 9 / 17
18 A few options Generalizing grep, the -e option introduces a new script and -f a script file. By default, every line that is read is output (edited or not). The -n option avoids that. sed edits in place with the -i option. 10 / 17
19 sed s program structure In its simple form, a sed script is a condition (to select lines) followed by an action (on these lines). 11 / 17
20 sed s program structure In its simple form, a sed script is a condition (to select lines) followed by an action (on these lines). The most useful conditions are: a line number or $ for the last line, e. g., 8; 11 / 17
21 sed s program structure In its simple form, a sed script is a condition (to select lines) followed by an action (on these lines). The most useful conditions are: a line number or $ for the last line, e. g., 8; a regexp, e. g., /b.*a/; 11 / 17
22 sed s program structure In its simple form, a sed script is a condition (to select lines) followed by an action (on these lines). The most useful conditions are: a line number or $ for the last line, e. g., 8; a regexp, e. g., /b.*a/; ranges of lines whose boundaries are specified through line numbers or regexps, e. g., 8,$ or 1,/banana/; 11 / 17
23 sed s program structure In its simple form, a sed script is a condition (to select lines) followed by an action (on these lines). The most useful conditions are: a line number or $ for the last line, e. g., 8; a regexp, e. g., /b.*a/; ranges of lines whose boundaries are specified through line numbers or regexps, e. g., 8,$ or 1,/banana/; the negation of a condition by appending!, e. g., 6,/[xyz]/!. 11 / 17
24 sed s program structure In its simple form, a sed script is a condition (to select lines) followed by an action (on these lines). The most useful conditions are: a line number or $ for the last line, e. g., 8; a regexp, e. g., /b.*a/; ranges of lines whose boundaries are specified through line numbers or regexps, e. g., 8,$ or 1,/banana/; the negation of a condition by appending!, e. g., 6,/[xyz]/!. If no condition is given, every line is selected. 11 / 17
25 sed s commands sed s commands are one letter long: p prints the current line; 12 / 17
26 sed s commands sed s commands are one letter long: p prints the current line; d deletes the current line; 12 / 17
27 sed s commands sed s commands are one letter long: p prints the current line; d deletes the current line; i inserts a line (before the current line); 12 / 17
28 sed s commands sed s commands are one letter long: p prints the current line; d deletes the current line; i inserts a line (before the current line); a appends a line (after the current line); 12 / 17
29 sed s commands sed s commands are one letter long: p prints the current line; d deletes the current line; i inserts a line (before the current line); a appends a line (after the current line); / 17
30 sed s commands sed s commands are one letter long: p prints the current line; d deletes the current line; i inserts a line (before the current line); a appends a line (after the current line);... s substitutes part(s) of the current line. 12 / 17
31 Substituting with sed s s command The usual syntax is s/regexp/replacement text/{flags} but any character can replace the / delimiter. 13 / 17
32 Substituting with sed s s command The usual syntax is s/regexp/replacement text/{flags} but any character can replace the / delimiter. Like grep, sed matches the largest string satisfying the regexp. In the replacement text, & stands for the whole match and \n for the string matching the part of the regexp between the n th \( \). 13 / 17
33 Substituting with sed s s command The usual syntax is s/regexp/replacement text/{flags} but any character can replace the / delimiter. Like grep, sed matches the largest string satisfying the regexp. In the replacement text, & stands for the whole match and \n for the string matching the part of the regexp between the n th \( \). The most useful flags are a number N to transform the N th match per line (the first by default), g to transform all matches and p, in conjunction with the -n option, to only print the transformed lines. 13 / 17
34 Getting the data $ wget dcc.ufmg.br/~lcerf/data.tar.xz -O - tar -xj 14 / 17
35 Exercises Exercises 1 In teams.txt, replace Atlético with Atl.. 2 In teams.txt, place an exclamation mark at the beginning of the lines containing Atlético. 3 Execute the script teams.sed on retweets.txt. 4 If s:200:atlético-mg: would be the first line of teams.sed, this script would undesirably edit some retweet numbers and some user names that include the sequence of digits 200. Explain how the actual script avoids those issues. 5 How to obtain teams.sed from teams.txt? Notice that underscores replace the spaces in the team names. 15 / 17
36 Turning teams.txt into teams.sed From: 213 Gr^emio Prudente To: s:\([0-9] \)213 :\1Gr^emio Prudente : 16 / 17
37 Turning teams.txt into teams.sed From: 213 Gr^emio Prudente To: s:\([0-9] \)213 :\1Gr^emio Prudente : With one barely readable substitution tr < teams.txt sed s/\(.*\) \(.*\)/s:\\([0-9] \\)\1 :\\1\2 :/ > teams.sed 16 / 17
38 Turning teams.txt into teams.sed From: 213 Gr^emio Prudente To: s:\([0-9] \)213 :\1Gr^emio Prudente : With one barely readable substitution tr < teams.txt sed s/\(.*\) \(.*\)/s:\\([0-9] \\)\1 :\\1\2 :/ > teams.sed With three substitutions tr < teams.txt sed -e s/^/s:\\([0-9] \\)/ -e s/ / :\\1/ -e s/$/ :/ > teams.sed 16 / 17
39 License c These slides are licensed under the Creative Commons Attribution-ShareAlike 4.0 International License. 17 / 17
Mineração de Dados Aplicada
Simple but Powerful Text-Processing Commands August, 29 th 2018 DCC ICEx UFMG Unix philosophy Unix philosophy Doug McIlroy (inventor of Unix pipes). In A Quarter-Century of Unix (1994): Write programs
More informationLecture 5. Essential skills for bioinformatics: Unix/Linux
Lecture 5 Essential skills for bioinformatics: Unix/Linux UNIX DATA TOOLS Text processing with awk We have illustrated two ways awk can come in handy: Filtering data using rules that can combine regular
More informationComputer Systems and Architecture
Computer Systems and Architecture Stephen Pauwels Regular Expressions Academic Year 2018-2019 Outline What is a Regular Expression? Tools Anchors, Character sets and Modifiers Advanced Regular Expressions
More informationComputer Systems and Architecture
Computer Systems and Architecture Regular Expressions Bart Meyers University of Antwerp August 29, 2012 Outline What? Tools Anchors, character sets and modifiers Advanced Regular expressions Exercises
More informationIntroduction to UNIX command-line II
Introduction to UNIX command-line II Boyce Thompson Institute 2017 Prashant Hosmani Class Content Terminal file system navigation Wildcards, shortcuts and special characters File permissions Compression
More informationIntroduction to UNIX command-line
Introduction to UNIX command-line Boyce Thompson Institute March 17, 2015 Lukas Mueller & Noe Fernandez Class Content Terminal file system navigation Wildcards, shortcuts and special characters File permissions
More informationUnix as a Platform Exercises. Course Code: OS-01-UNXPLAT
Unix as a Platform Exercises Course Code: OS-01-UNXPLAT Working with Unix 1. Use the on-line manual page to determine the option for cat, which causes nonprintable characters to be displayed. Run the command
More informationOn successful completion of the course, the students will be able to attain CO: Experiment linked. 2 to 4. 5 to 8. 9 to 12.
CIE- 25 Marks Government of Karnataka Department of Technical Education Bengaluru Course Title: Linux Lab Scheme (L:T:P) : 0:2:4 Total Contact Hours: 78 Type of Course: Tutorial, Practical s & Student
More informationShell Programming Overview
Overview Shell programming is a way of taking several command line instructions that you would use in a Unix command prompt and incorporating them into one program. There are many versions of Unix. Some
More informationShells & Shell Programming (Part B)
Shells & Shell Programming (Part B) Software Tools EECS2031 Winter 2018 Manos Papagelis Thanks to Karen Reid and Alan J Rosenthal for material in these slides CONTROL STATEMENTS 2 Control Statements Conditional
More informationTable of contents. Our goal. Notes. Notes. Notes. Summer June 29, Our goal is to see how we can use Unix as a tool for developing programs
Summer 2010 Department of Computer Science and Engineering York University Toronto June 29, 2010 1 / 36 Table of contents 1 2 3 4 2 / 36 Our goal Our goal is to see how we can use Unix as a tool for developing
More informationEssentials for Scientific Computing: Stream editing with sed and awk
Essentials for Scientific Computing: Stream editing with sed and awk Ershaad Ahamed TUE-CMS, JNCASR May 2012 1 Stream Editing sed and awk are stream processing commands. What this means is that they are
More informationUseful Unix Commands Cheat Sheet
Useful Unix Commands Cheat Sheet The Chinese University of Hong Kong SIGSC Training (Fall 2016) FILE AND DIRECTORY pwd Return path to current directory. ls List directories and files here. ls dir List
More informationUser Commands sed ( 1 )
NAME sed stream editor SYNOPSIS /usr/bin/sed [-n] script [file...] /usr/bin/sed [-n] [-e script]... [-f script_file]... [file...] /usr/xpg4/bin/sed [-n] script [file...] /usr/xpg4/bin/sed [-n] [-e script]...
More informationIntroduction to Scripting using bash
Introduction to Scripting using bash Scripting versus Programming (from COMP10120) You may be wondering what the difference is between a script and a program, or between the idea of scripting languages
More informationCOL100 Lab 2. I semester Week 2, Open the web-browser and visit the page and visit the COL100 course page.
COL100 Lab 2 I semester 2017-18 Week 2, 2017 Objective More familiarisation with Linux and its standard commands Part 1 1. Login to your system and open a terminal window. 2. Open the web-browser and visit
More informationCS Unix Tools & Scripting Lecture 7 Working with Stream
CS2043 - Unix Tools & Scripting Lecture 7 Working with Streams Spring 2015 1 February 4, 2015 1 based on slides by Hussam Abu-Libdeh, Bruno Abrahao and David Slater over the years Announcements Course
More information5/8/2012. Exploring Utilities Chapter 5
Exploring Utilities Chapter 5 Examining the contents of files. Working with the cut and paste feature. Formatting output with the column utility. Searching for lines containing a target string with grep.
More informationCSE 374 Programming Concepts & Tools. Laura Campbell (thanks to Hal Perkins) Winter 2014 Lecture 6 sed, command-line tools wrapup
CSE 374 Programming Concepts & Tools Laura Campbell (thanks to Hal Perkins) Winter 2014 Lecture 6 sed, command-line tools wrapup Where we are Learned how to use the shell to run, combine, and write programs
More informationUNIX, GNU/Linux and simple tools for data manipulation
UNIX, GNU/Linux and simple tools for data manipulation Dr Jean-Baka DOMELEVO ENTFELLNER BecA-ILRI Hub Basic Bioinformatics Training Workshop @ILRI Addis Ababa Wednesday December 13 th 2017 Dr Jean-Baka
More informationCS 460 Linux Tutorial
CS 460 Linux Tutorial http://ryanstutorials.net/linuxtutorial/cheatsheet.php # Change directory to your home directory. # Remember, ~ means your home directory cd ~ # Check to see your current working
More informationIB047. Unix Text Tools. Pavel Rychlý Mar 3.
Unix Text Tools pary@fi.muni.cz 2014 Mar 3 Unix Text Tools Tradition Unix has tools for text processing from the very beginning (1970s) Small, simple tools, each tool doing only one operation Pipe (pipeline):
More informationBASH SHELL SCRIPT 1- Introduction to Shell
BASH SHELL SCRIPT 1- Introduction to Shell What is shell Installation of shell Shell features Bash Keywords Built-in Commands Linux Commands Specialized Navigation and History Commands Shell Aliases Bash
More informationRegular Expressions. Regular expressions match input within a line Regular expressions are very different than shell meta-characters.
ULI101 Week 09 Week Overview Regular expressions basics Literal matching.wildcard Delimiters Character classes * repetition symbol Grouping Anchoring Search Search and replace in vi Regular Expressions
More informationAdvanced training. Linux components Command shell. LiLux a.s.b.l.
Advanced training Linux components Command shell LiLux a.s.b.l. alexw@linux.lu Kernel Interface between devices and hardware Monolithic kernel Micro kernel Supports dynamics loading of modules Support
More informationShells and Shell Programming
Shells and Shell Programming 1 Shells A shell is a command line interpreter that is the interface between the user and the OS. The shell: analyzes each command determines what actions are to be performed
More informationPest Control. Tristan Allwood. June 13, Tristan Allwood () Pest Control June 13, / 22
Pest Control Tristan Allwood June 13, 2013 Tristan Allwood () Pest Control June 13, 2013 1 / 22 A black screen... Tiling up windows awesome XMonad ion3 ratpoison And plenty of others... http://en.wikipedia.org/wiki/tiling_window_manager
More informationRegex, Sed, Awk. Arindam Fadikar. December 12, 2017
Regex, Sed, Awk Arindam Fadikar December 12, 2017 Why Regex Lots of text data. twitter data (social network data) government records web scrapping many more... Regex Regular Expressions or regex or regexp
More informationShells and Shell Programming
Shells and Shell Programming Shells A shell is a command line interpreter that is the interface between the user and the OS. The shell: analyzes each command determines what actions are to be performed
More informationUnleashing the Shell Hands-On UNIX System Administration DeCal Week 6 28 February 2011
Unleashing the Shell Hands-On UNIX System Administration DeCal Week 6 28 February 2011 Last time Compiling software and the three-step procedure (./configure && make && make install). Dependency hell and
More informationBasic Shell Scripting Practice. HPC User Services LSU HPC & LON March 2018
Basic Shell Scripting Practice HPC User Services LSU HPC & LON sys-help@loni.org March 2018 Quotation Exercise 1. Print out your $LOGNAME 2. Print date 3. Print `who am i` 4. Print your current directory
More informationIf you re using a Mac, follow these commands to prepare your computer to run these demos (and any other analysis you conduct with the Audio BNC
If you re using a Mac, follow these commands to prepare your computer to run these demos (and any other analysis you conduct with the Audio BNC sample). All examples use your Workshop directory (e.g. /Users/peggy/workshop)
More informationPart III. Shell Config. Tobias Neckel: Scripting with Bash and Python Compact Max-Planck, February 16-26,
Part III Shell Config Compact Course @ Max-Planck, February 16-26, 2015 33 Special Directories. current directory.. parent directory ~ own home directory ~user home directory of user ~- previous directory
More informationDigital Humanities. Tutorial Regular Expressions. March 10, 2014
Digital Humanities Tutorial Regular Expressions March 10, 2014 1 Introduction In this tutorial we will look at a powerful technique, called regular expressions, to search for specific patterns in corpora.
More informationLab - 8 Awk Programming
Lab - 8 Awk Programming AWK is another interpreted programming language which has powerful text processing capabilities. It can solve complex text processing tasks with a few lines of code. Listed below
More informationBachelor/Master Exam Version V3B
Prof. aadr. Jürgen Giesl Carsten Otto Bachelor/Master Exam Version V3B First Name: Last Name: Course of Studies (please mark exactly one): Informatik Bachelor TK Master Mathematik Master Other: Maximal
More informationIntroduction p. 1 Who Should Read This Book? p. 1 What You Need to Know Before Reading This Book p. 2 How This Book Is Organized p.
Introduction p. 1 Who Should Read This Book? p. 1 What You Need to Know Before Reading This Book p. 2 How This Book Is Organized p. 2 Conventions Used in This Book p. 2 Introduction to UNIX p. 5 An Overview
More informationhttp://xkcd.com/208/ 1. Review of pipes 2. Regular expressions 3. sed 4. awk 5. Editing Files 6. Shell loops 7. Shell scripts cat seqs.fa >0! TGCAGGTATATCTATTAGCAGGTTTAATTTTGCCTGCACTTGGTTGGGTACATTATTTTAAGTGTATTTGACAAG!
More informationCS Unix Tools. Fall 2010 Lecture 5. Hussam Abu-Libdeh based on slides by David Slater. September 17, 2010
Fall 2010 Lecture 5 Hussam Abu-Libdeh based on slides by David Slater September 17, 2010 Reasons to use Unix Reason #42 to use Unix: Wizardry Mastery of Unix makes you a wizard need proof? here is the
More informationScripting Languages Course 1. Diana Trandabăț
Scripting Languages Course 1 Diana Trandabăț Master in Computational Linguistics - 1 st year 2017-2018 Today s lecture Introduction to scripting languages What is a script? What is a scripting language
More informationComputer Systems and Architecture
Computer Systems and Architecture Introduction to UNIX Stephen Pauwels University of Antwerp October 2, 2015 Outline What is Unix? Getting started Streams Exercises UNIX Operating system Servers, desktops,
More informationPractical 02. Bash & shell scripting
Practical 02 Bash & shell scripting 1 imac lab login: maclab password: 10khem 1.use the Finder to visually browse the file system (single click opens) 2.find the /Applications folder 3.open the Utilities
More informationSTP, Unix, SAC tutorial, Ge167 Winter 2014
STP, Unix, SAC tutorial, Ge167 Winter 2014 Asaf Inbal 1 Downloading waveforms In this tutorial we ll learn how to download waveforms using a tool called STP (Seismic Transfer Program) and manipulate them
More informationUNIX shell scripting
UNIX shell scripting EECS 2031 Summer 2014 Przemyslaw Pawluk June 17, 2014 What we will discuss today Introduction Control Structures User Input Homework Table of Contents Introduction Control Structures
More informationLecture 3 Tonight we dine in shell. Hands-On Unix System Administration DeCal
Lecture 3 Tonight we dine in shell Hands-On Unix System Administration DeCal 2012-09-17 Review $1, $2,...; $@, $*, $#, $0, $? environment variables env, export $HOME, $PATH $PS1=n\[\e[0;31m\]\u\[\e[m\]@\[\e[1;34m\]\w
More informationUnix/Linux Primer. Taras V. Pogorelov and Mike Hallock School of Chemical Sciences, University of Illinois
Unix/Linux Primer Taras V. Pogorelov and Mike Hallock School of Chemical Sciences, University of Illinois August 25, 2017 This primer is designed to introduce basic UNIX/Linux concepts and commands. No
More informationProgramming Concepts. Perl. Adapted from Practical Unix and Programming Hunter College
Programming Concepts Perl Adapted from Practical Unix and Programming Hunter College Copyright 2006 2009 Stewart Weiss About Perl Perl was written by Larry Wall, and stands for either Practical Extraction
More informationPart I. UNIX Workshop Series: Quick-Start
Part I UNIX Workshop Series: Quick-Start Objectives Overview Connecting with ssh Command Window Anatomy Command Structure Command Examples Getting Help Files and Directories Wildcards, Redirection and
More informationSTATS Data Analysis using Python. Lecture 15: Advanced Command Line
STATS 700-002 Data Analysis using Python Lecture 15: Advanced Command Line Why UNIX/Linux? As a data scientist, you will spend most of your time dealing with data Data sets never arrive ready to analyze
More informationPractical Linux examples: Exercises
Practical Linux examples: Exercises 1. Login (ssh) to the machine that you are assigned for this workshop (assigned machines: https://cbsu.tc.cornell.edu/ww/machines.aspx?i=87 ). Prepare working directory,
More informationBasic Linux Commands Manual Pdf Examples And Syntax
Basic Linux Commands Manual Pdf Examples And Syntax each command. More information and free.pdf available at linux-training.be. GNU Free Documentation License, Version 1.3 or any later version. This is
More informationAdvanced Linux: Exercises In these instructions the first character $ in the command examples should not be typed, but it denotes the command prompt.
Advanced Linux: Exercises 1/6 Advanced Linux: Exercises In these instructions the first character $ in the command examples should not be typed, but it denotes the command prompt. Some command lines are
More informationComputer Systems and Architecture
Computer Systems and Architecture Stephen Pauwels Computer Systems Academic Year 2018-2019 Overview of the Semester UNIX Introductie Regular Expressions Scripting Data Representation Integers, Fixed point,
More informationCourse Outline. TERM EFFECTIVE: Fall 2016 CURRICULUM APPROVAL DATE: 11/23/2015
5055 Santa Teresa Blvd Gilroy, CA 95023 Course Outline COURSE: CSIS 49 DIVISION: 50 ALSO LISTED AS: TERM EFFECTIVE: Fall 2016 CURRICULUM APPROVAL DATE: 11/23/2015 SHORT TITLE: UNIX SHELL PROGRAM LONG TITLE:
More informationOverview. Unix/Regex Lab. 1. Setup & Unix review. 2. Count words in a text. 3. Sort a list of words in various ways. 4.
Overview Unix/Regex Lab CS 341: Natural Language Processing Heather Pon-Barry 1. Setup & Unix review 2. Count words in a text 3. Sort a list of words in various ways 4. Search with grep Based on Unix For
More informationIntroduc)on to Linux Session 2 Files/Filesystems/Data. Pete Ruprecht Research Compu)ng Group University of Colorado Boulder
Introduc)on to Linux Session 2 Files/Filesystems/Data Pete Ruprecht Research Compu)ng Group University of Colorado Boulder www.rc.colorado.edu Outline LeHover from last week redirec)on Filesystem layout
More informationToday s Lecture. The Unix Shell. Unix Architecture (simplified) Lecture 3: Unix Shell, Pattern Matching, Regular Expressions
Lecture 3: Unix Shell, Pattern Matching, Regular Expressions Today s Lecture Review Lab 0 s info on the shell Discuss pattern matching Discuss regular expressions Kenneth M. Anderson Software Methods and
More information(Refer Slide Time: 01:12)
Internet Technology Prof. Indranil Sengupta Department of Computer Science and Engineering Indian Institute of Technology, Kharagpur Lecture No #22 PERL Part II We continue with our discussion on the Perl
More informationShell Programming Systems Skills in C and Unix
Shell Programming 15-123 Systems Skills in C and Unix The Shell A command line interpreter that provides the interface to Unix OS. What Shell are we on? echo $SHELL Most unix systems have Bourne shell
More informationIntroduction to Linux
Introduction to Linux University of Bristol - Advance Computing Research Centre 1 / 47 Operating Systems Program running all the time Interfaces between other programs and hardware Provides abstractions
More informationLinux Text Utilities 101 for S/390 Wizards SHARE Session 9220/5522
Linux Text Utilities 101 for S/390 Wizards SHARE Session 9220/5522 Scott D. Courtney Senior Engineer, Sine Nomine Associates March 7, 2002 http://www.sinenomine.net/ Table of Contents Concepts of the Linux
More informationUnix Essentials. BaRC Hot Topics Bioinformatics and Research Computing Whitehead Institute October 12 th
Unix Essentials BaRC Hot Topics Bioinformatics and Research Computing Whitehead Institute October 12 th 2016 http://barc.wi.mit.edu/hot_topics/ 1 Outline Unix overview Logging in to tak Directory structure
More informationUnix as a Platform Exercises + Solutions. Course Code: OS 01 UNXPLAT
Unix as a Platform Exercises + Solutions Course Code: OS 01 UNXPLAT Working with Unix Most if not all of these will require some investigation in the man pages. That's the idea, to get them used to looking
More informationMineração de Dados Aplicada
Data Exploration August, 9 th 2017 DCC ICEx UFMG Summary of the last session Data mining Data mining is an empiricism; It can be seen as a generalization of querying; It lacks a unified theory; It implies
More informationWeek 5 Lesson 5 02/28/18
Week 5 Lesson 5 02/28/18 Important Announcements Extra Credits If you haven t done so, send your pictures to risimms@cabrillo.edu for 3 points EXTRA CREDIT. Join LinkedIn for 3 points Perkins/VTEA Survey
More informationCS Unix Tools & Scripting
Cornell University, Spring 2014 1 February 24, 2014 1 Slides evolved from previous versions by Hussam Abu-Libdeh and David Slater A note on awk for (item in array) The order in which items are returned
More informationSoftware and Programming 1
Software and Programming 1 Lab 1: Introduction, HelloWorld Program and use of the Debugger 17 January 2019 SP1-Lab1-2018-19.pptx Tobi Brodie (tobi@dcs.bbk.ac.uk) 1 Module Information Lectures: Afternoon
More informationRegular expressions: Text editing and Advanced manipulation. HORT Lecture 4 Instructor: Kranthi Varala
Regular expressions: Text editing and Advanced manipulation HORT 59000 Lecture 4 Instructor: Kranthi Varala Simple manipulations Tabular data files can be manipulated at a columnlevel. cut: Divide file
More informationUNIX II:grep, awk, sed. October 30, 2017
UNIX II:grep, awk, sed October 30, 2017 File searching and manipulation In many cases, you might have a file in which you need to find specific entries (want to find each case of NaN in your datafile for
More informationPerl and R Scripting for Biologists
Perl and R Scripting for Biologists Lukas Mueller PLBR 4092 Course overview Linux basics (today) Linux advanced (Aure, next week) Why Linux? Free open source operating system based on UNIX specifications
More informationCS214-AdvancedUNIX. Lecture 2 Basic commands and regular expressions. Ymir Vigfusson. CS214 p.1
CS214-AdvancedUNIX Lecture 2 Basic commands and regular expressions Ymir Vigfusson CS214 p.1 Shellexpansions Let us first consider regular expressions that arise when using the shell (shell expansions).
More informationThe input can also be taken from a file and similarly the output can be redirected to another file.
Filter A filter is defined as a special program, which takes input from standard input device and sends output to standard output device. The input can also be taken from a file and similarly the output
More informationRegular Expressions. using REs to find patterns. implementing REs using finite state automata. Sunday, 4 December 11
Regular Expressions using REs to find patterns implementing REs using finite state automata REs and FSAs Regular expressions can be viewed as a textual way of specifying the structure of finite-state automata
More information"Bash vs Python Throwdown" -or- "How you can accomplish common tasks using each of these tools" Bash Examples. Copying a file: $ cp file1 file2
"Bash vs Python Throwdown" -or- "How you can accomplish common tasks using each of these tools" Bash Examples Copying a file: $ cp file1 file2 Wrangling "csv" files: Consider a file named 20140209.csv
More informationWhen talking about how to launch commands and other things that is to be typed into the terminal, the following syntax is used:
Linux Tutorial How to read the examples When talking about how to launch commands and other things that is to be typed into the terminal, the following syntax is used: $ application file.txt
More informationCS160A EXERCISES-FILTERS2 Boyd
Exercises-Filters2 In this exercise we will practice with the Unix filters cut, and tr. We will also practice using paste, even though, strictly speaking, it is not a filter. In addition, we will expand
More informationCENG 334 Computer Networks. Laboratory I Linux Tutorial
CENG 334 Computer Networks Laboratory I Linux Tutorial Contents 1. Logging In and Starting Session 2. Using Commands 1. Basic Commands 2. Working With Files and Directories 3. Permission Bits 3. Introduction
More informationMEMO: Using UNIX shell commands to recode long identifiers, with application to STATA
MEMO: Using UNIX shell commands to recode long identifiers, with application to STATA Andrew Noymer 7 September 2004 1 The Problem Many datasets contain unique identifiers (UIDs) that are very large integers
More informationLAB 8 (Aug 4/5) Unix Utilities
Aug 4/5 Due: Aug 11 in class Name: CSE number: LAB 8 (Aug 4/5) Unix Utilities The purpose of this lab exercise is for you to get some hands-on experience on using some fundamental Unix utilities (commands).
More informationC Shell Tutorial. Section 1
C Shell Tutorial Goals: Section 1 Learn how to write a simple shell script and how to run it. Learn how to use local and global variables. About CSH The Barkley Unix C shell was originally written with
More informationCSE 390a Lecture 7. Regular expressions, egrep, and sed
CSE 390a Lecture 7 Regular expressions, egrep, and sed slides created by Marty Stepp, modified by Jessica Miller and Ruth Anderson http://www.cs.washington.edu/390a/ 1 2 Lecture summary regular expression
More informationPathologically Eclectic Rubbish Lister
Pathologically Eclectic Rubbish Lister 1 Perl Design Philosophy Author: Reuben Francis Cornel perl is an acronym for Practical Extraction and Report Language. But I guess the title is a rough translation
More informationA Brief Introduction to the Linux Shell for Data Science
A Brief Introduction to the Linux Shell for Data Science Aris Anagnostopoulos 1 Introduction Here we will see a brief introduction of the Linux command line or shell as it is called. Linux is a Unix-like
More information- c list The list specifies character positions.
CUT(1) BSD General Commands Manual CUT(1)... 1 PASTE(1) BSD General Commands Manual PASTE(1)... 3 UNIQ(1) BSD General Commands Manual UNIQ(1)... 5 HEAD(1) BSD General Commands Manual HEAD(1)... 7 TAIL(1)
More informationThe Linux Command Line: A Complete Introduction, 1 st ed., by William E. Shotts, Jr., No Starch Press, 2012.
Department of Mathematics and Computer Science Adelphi University Fall 2018 0145-275-001 Operating Systems Practicum Dr. R. M. Siegfried 407 Science (516)877-4482 http://home.adelphi.edu/~siegfried/cs271
More informationIntroduction to the shell Part II
Introduction to the shell Part II Graham Markall http://www.doc.ic.ac.uk/~grm08 grm08@doc.ic.ac.uk Civil Engineering Tech Talks 16 th November, 1pm Last week Covered applications and Windows compatibility
More information538 Text processing basics
538 Text processing basics Jianguo Lu, University of Windsor September 12, 2018 Lu September 12, 2018 1 / 26 Table of contents 1 Unix commands grep command join command Lu September 12, 2018 2 / 26 View
More informationUtilities. September 8, 2015
Utilities September 8, 2015 Useful ideas Listing files and display text and binary files Copy, move, and remove files Search, sort, print, compare files Using pipes Compression and archiving Your fellow
More informationPerl Tutorial. Diana Inkpen. School of Information Technology and Engineering University of Ottawa. CSI 5180, Fall 2004
Perl Tutorial Diana Inkpen School of Information Technology and Engineering University of Ottawa CSI 5180, Fall 2004 1 What is Perl Practical Extraction and Report Language. Created, implemented, maintained
More informationIntroduction to Linux (and the terminal)
Introduction to Linux (and the terminal) 27/11/2018 Pierpaolo Maisano Delser mail: maisanop@tcd.ie ; pm604@cam.ac.uk Outline: What is Linux and the terminal? Why do we use the terminal? Pros and cons Basic
More informationIntroduction to UNIX. Introduction. Processes. ps command. The File System. Directory Structure. UNIX is an operating system (OS).
Introduction Introduction to UNIX CSE 2031 Fall 2012 UNIX is an operating system (OS). Our goals: Learn how to use UNIX OS. Use UNIX tools for developing programs/ software, specifically shell programming.
More informationIntroduction to UNIX. CSE 2031 Fall November 5, 2012
Introduction to UNIX CSE 2031 Fall 2012 November 5, 2012 Introduction UNIX is an operating system (OS). Our goals: Learn how to use UNIX OS. Use UNIX tools for developing programs/ software, specifically
More informationModule 8 Pipes, Redirection and REGEX
Module 8 Pipes, Redirection and REGEX Exam Objective 3.2 Searching and Extracting Data from Files Objective Summary Piping and redirection Partial POSIX Command Line and Redirection Command Line Pipes
More informationhttp://xkcd.com/208/ cat seqs.fa >0 TGCAGGTATATCTATTAGCAGGTTTAATTTTGCCTGCACTTGGTTGGGTACATTATTTTAAGTGTATTTGACAAG >1 TGCAGGTTGTTGTTACTCAGGTCCAGTTCTCTGAGACTGGAGGACTGGGAGCTGAGAACTGAGGACAGAGCTTCA >2 TGCAGGGCCGGTCCAAGGCTGCATGAGGCCTGGGGCAGAATCTGACCTAGGGGCCCCTCTTGCTGCTAAAACCAT
More informationHandling important NGS data formats in UNIX Prac8cal training course NGS Workshop in Nove Hrady 2014
Handling important NGS data formats in UNIX Prac8cal training course NGS Workshop in Nove Hrady 2014 Vaclav Janousek, Libor Morkovsky hjp://ngs- course- nhrady.readthedocs.org (Exercises & Reference Manual)
More informationhttp://xkcd.com/208/ 1. Review of pipes 2. Regular expressions 3. sed 4. Editing Files 5. Shell loops 6. Shell scripts cat seqs.fa >0! TGCAGGTATATCTATTAGCAGGTTTAATTTTGCCTGCACTTGGTTGGGTACATTATTTTAAGTGTATTTGACAAG!
More informationCS 124/LINGUIST 180 From Languages to Information
CS 124/LINGUIST 180 From Languages to Information Unix for Poets Dan Jurafsky (original by Ken Church, modifications by Chris Manning) Stanford University Unix for Poets (based on Ken Church s presentation)
More informationbash Data Administrative Shell Scripting COMP2101 Fall 2017
bash Data Administrative Shell Scripting COMP2101 Fall 2017 Variables Every process has memory-based storage to hold named data A named data item is referred to as a variable (sometimes called a parameter),
More informationUNIX / LINUX - REGULAR EXPRESSIONS WITH SED
UNIX / LINUX - REGULAR EXPRESSIONS WITH SED http://www.tutorialspoint.com/unix/unix-regular-expressions.htm Copyright tutorialspoint.com Advertisements In this chapter, we will discuss in detail about
More informationCS Unix Tools. Fall 2010 Lecture 8. Hussam Abu-Libdeh based on slides by David Slater. September 24, 2010
Fall 2010 Lecture 8 Hussam Abu-Libdeh based on slides by David Slater September 24, 2010 Compression & Archiving zip / unzip Compress and archive (bundle) files into a single file. A new compressed.zip
More information