Tutorial: Phylogenetic Analysis on BioHealthBase Written by: Catherine A. Macken Version 1: February 2009
|
|
- Basil Norman
- 5 years ago
- Views:
Transcription
1 Tutorial: Phylogenetic Analysis on BioHealthBase Written by: Catherine A. Macken Version 1: February 2009 BioHealthBase provides multiple functions for inferring phylogenetic trees, through the Phylogenetic Tree page, which is linked from the left-hand navigation bar. This document is intended to help you to use this page. Contents: 1. Getting data into the tree page 1.1) Upload a file from your desktop 1.2) Paste a file into the text box 1.3) Generate a tree from a working set. 2) Which evolutionary model for your tree inference? 2.1) Run ModelCompare 2.2) Choose a model of evolution 3) Controlling the look of your tree 4) Other details 1
2 Fig. 1: Phylogenetic Inference page: references to sections of this document in red. (1.1, 1.2, 1.3) (1.1) (1.2, 1.3) (2.1, 2.2) (3) (2.2) 2
3 1) Getting data into the tree page 1.1) Upload a file from your desktop This file can be aligned, or unaligned or in Phylip format. You must specify which format you are using by selecting a radio button at the top of the page. If you enter unaligned data, MUSCLE will be used to align sequences before running the tree programs. You should use nucleotide sequences for flu trees, unless you are including widely divergent sequences, such as from different serotypes of flu A or different flu types for internal genes. 1.2) Paste a file into the paste box The constraints for uploading a file (1.1) apply. 1.3) Generate a tree from a working set. Use the View Tree button above the listing of your working set (see Fig. 2 below). This automatically pastes your sequences into the text box so that you can proceed as in (1.2) above. Figure 1 shows the result of choosing the View Tree button from a display of the working set below. Fig. 2: Selecting tree building as an action to carry out on your working set. (1.3) 3
4 2) Specifying the evolutionary model for your tree inference There are many theoretical approaches to inferring a phylogeny. BioHealthBase takes an approach that uses maximum likelihood to measure the quality of an inferred tree. Maximum likelihood estimation (MLE) is generally regarded as leading to a high quality tree, one that will stand up to the scrutiny of reviewers in most situations. However, MLE requires that you use a model for the evolution of the sequences that will be in your tree. There are many frequently used models of evolution available. From previous experience, you may know which one you want to use. In this case, you will want to select the radio button for Choose a model of evolution. Then go to (2.2) for further instructions. If you do not know which model to use, then select the radio button for Run ModelCompare to suggest the best model of evolution to get guidance on the choice of model for your data set. Then go to (2.1) below for further instructions. 2.1) Run ModelCompare ModelCompare first makes a quick estimate of a tree topology for your data. This will be a reasonable, but probably not optimal, estimate. It then keeps this topology fixed while it optimizes the estimates of the parameters of the models. In this way, multiple models can be compared in a modest amount of time. (Optimization of both the topology and the parameters is too time-consuming to carry out for each of the six models.) You can confidently take the outcome from ModelCompare to guide your choice of a model of evolution to do the full optimization of estimates of the topology and parameters. ModelCompare has some of the flavour of ModelTest, which requires access to PAUP* (Posada D and Crandall KA (1998): Modeltest: testing the model of DNA substitution. Bioinformatics 14 (9): ). However, ModelCompare is stand-alone, compares a smaller range of models, runs faster, focuses on maximum likelihood optimization and is web-driven. Six different models are tested on your data set. These models differ in the number of parameters used, and hence in their power for fitting to data. The more parameters used, the better the fit to data expected. The models tested are HKY, TN93 and GTR, with or without the additional option of allowing for variable rates of evolution at the different positions in the sequence. ModelCompare returns a list of log-likelihood values. Roughly speaking, the higher (less negative) the log-likelihood value, the better is the fit of the model to the data. ModeCompare only gives guidance on the choice of the best model. It does NOT fit the best model. 4
5 Fig. 3: Results from running ModelCompare In this example, the log-likelihood for TN93plus is 1.1 greater than the loglikelihood for HKYplus. This makes it look like TN93plus is a better model than HKYplus. But TN93plus uses one more parameter. Basically, you want to see that each parameter added leads to an increase of 2.0 or more in the log-likelihood value before you say that the model with more parameters is better. Therefore, there is really no difference in the fit of these two models. (See Inferring Phylogenies, by J. Felsenstein (2004) for more details on interpreting loglikelihood values.) GTRplus is the best model for these data, since it has the largest log-likelihood value. However, after adjusting for the number of parameters used, it is not much better than HKYplus. HKYplus is substantially better than HKY. HKY will run faster than any of the other models. HKYplus will run much faster than GTRplus. If you are building a tree for a large data set, you may wish to use HKYplus, as a compromise between accuracy and speed. If you have a small data set, then you might choose GTRplus. Once you have used ModelCompare to suggest a model of evolution, you should go back to the phylogenetic tree page and run the option: Choose a model of evolution. Alternatively (see Fig. 3), you can select a radio button for your preferred model and click on the Select button to automatically set up the next steps for you. 2.2) Choose a model of evolution When you choose this option, you will get a fully optimized phylogeny for your data. You are given the option of implementing any one of 12 different models of evolution. Six of these are the same as those tested in ModelCompare. The plus gamma option allows for sites in the sequence to evolve at different rates. (See Inferring Phylogenies, by J. Felsenstein (2004) for more details on models of evolution.) Depending on which model you choose, additional text boxes may open for input of parameter estimates. You may know estimates from a previous analysis, in which case you can enter them here and your tree will come back much more quickly. If you do not know values, then leave the text box blank and the parameter will be estimated. It is NOT a good idea to enter parameter estimates from ModelCompare. These were obtained without optimizing the tree topology and hence will not be optimized. 5
6 If you use the plus gamma option, you MUST enter a value for number of categories. Basically, you are being asked: if you classify the rates of evolution at the different sites, how many classes might be reasonable? For example, you might choose 3 rates: slow, medium and fast. Three is generally not a good number of categories, because the fast rates tend, in fact, to be fast, very fast, and extremely fast. Specifying five categories tends to work well. 6
7 3) Controlling the look of your tree It is often helpful to designate a particular virus as a reference point in your tree. This reference point is called an outgroup. You can tell the tree builder what record in your data set should act as the outgroup. Follow the instructions above the text box for correct specification. 4) Other details Because phylogenetic inference can be time-consuming, ModelCompare and BuildTree jobs are run on a ticket system. Once you start your job running, you will be presented with the number of your ticket. If you are patient, or have a very small tree (20 sequences runs in about 2 minutes to Build Tree), you can sit and watch the screen until your results are returned. If you would rather do something more interesting while the server is working, you can retrieve your results at a later time, by clicking on the links Retrieve ModelCompare or Retrieve Tree in the left-hand navigation bar. You can view your tree in an ATV applet (which will automatically download onto your desktop), or download the tree in a visual format (pdf file) or as a text file of the Newick representation of your tree. The last format is a standard form for importing a tree into other display applications. 7
( ylogenetics/bayesian_workshop/bayesian%20mini conference.htm#_toc )
(http://www.nematodes.org/teaching/tutorials/ph ylogenetics/bayesian_workshop/bayesian%20mini conference.htm#_toc145477467) Model selection criteria Review Posada D & Buckley TR (2004) Model selection
More informationTutorial using BEAST v2.4.1 Troubleshooting David A. Rasmussen
Tutorial using BEAST v2.4.1 Troubleshooting David A. Rasmussen 1 Background The primary goal of most phylogenetic analyses in BEAST is to infer the posterior distribution of trees and associated model
More informationLab 07: Maximum Likelihood Model Selection and RAxML Using CIPRES
Integrative Biology 200, Spring 2014 Principles of Phylogenetics: Systematics University of California, Berkeley Updated by Traci L. Grzymala Lab 07: Maximum Likelihood Model Selection and RAxML Using
More informationin interleaved format. The same data set in sequential format:
PHYML user's guide Introduction PHYML is a software implementing a new method for building phylogenies from sequences using maximum likelihood. The executables can be downloaded at: http://www.lirmm.fr/~guindon/phyml.html.
More informationCLC Phylogeny Module User manual
CLC Phylogeny Module User manual User manual for Phylogeny Module 1.0 Windows, Mac OS X and Linux September 13, 2013 This software is for research purposes only. CLC bio Silkeborgvej 2 Prismet DK-8000
More informationPHYLIP. Joe Felsenstein. Depts. of Genome Sciences and of Biology, University of Washington. PHYLIP p.1/13
PHYLIP p.1/13 PHYLIP Joe Felsenstein Depts. of Genome Sciences and of Biology, University of Washington PHYLIP p.2/13 Software for this lab This lab is intended to introduce the PHYLIP package and a number
More informationCodon models. In reality we use codon model Amino acid substitution rates meet nucleotide models Codon(nucleotide triplet)
Phylogeny Codon models Last lecture: poor man s way of calculating dn/ds (Ka/Ks) Tabulate synonymous/non- synonymous substitutions Normalize by the possibilities Transform to genetic distance K JC or K
More informationPhylogenetics on CUDA (Parallel) Architectures Bradly Alicea
Descent w/modification Descent w/modification Descent w/modification Descent w/modification CPU Descent w/modification Descent w/modification Phylogenetics on CUDA (Parallel) Architectures Bradly Alicea
More informationTutorial using BEAST v2.4.7 MASCOT Tutorial Nicola F. Müller
Tutorial using BEAST v2.4.7 MASCOT Tutorial Nicola F. Müller Parameter and State inference using the approximate structured coalescent 1 Background Phylogeographic methods can help reveal the movement
More informationHeterotachy models in BayesPhylogenies
Heterotachy models in is a general software package for inferring phylogenetic trees using Bayesian Markov Chain Monte Carlo (MCMC) methods. The program allows a range of models of gene sequence evolution,
More informationSequence alignment algorithms
Sequence alignment algorithms Bas E. Dutilh Systems Biology: Bioinformatic Data Analysis Utrecht University, February 23 rd 27 After this lecture, you can decide when to use local and global sequence alignments
More informationPage 1.1 Guidelines 2 Requirements JCoDA package Input file formats License. 1.2 Java Installation 3-4 Not required in all cases
JCoDA and PGI Tutorial Version 1.0 Date 03/16/2010 Page 1.1 Guidelines 2 Requirements JCoDA package Input file formats License 1.2 Java Installation 3-4 Not required in all cases 2.1 dn/ds calculation
More informationCISC 636 Computational Biology & Bioinformatics (Fall 2016) Phylogenetic Trees (I)
CISC 636 Computational iology & ioinformatics (Fall 2016) Phylogenetic Trees (I) Maximum Parsimony CISC636, F16, Lec13, Liao 1 Evolution Mutation, selection, Only the Fittest Survive. Speciation. t one
More informationB Y P A S S R D E G R Version 1.0.2
B Y P A S S R D E G R Version 1.0.2 March, 2008 Contents Overview.................................. 2 Installation notes.............................. 2 Quick Start................................. 3 Examples
More informationDistance Methods. "PRINCIPLES OF PHYLOGENETICS" Spring 2006
Integrative Biology 200A University of California, Berkeley "PRINCIPLES OF PHYLOGENETICS" Spring 2006 Distance Methods Due at the end of class: - Distance matrices and trees for two different distance
More informationSimulation of Molecular Evolution with Bioinformatics Analysis
Simulation of Molecular Evolution with Bioinformatics Analysis Barbara N. Beck, Rochester Community and Technical College, Rochester, MN Project created by: Barbara N. Beck, Ph.D., Rochester Community
More informationBasics of Multiple Sequence Alignment
Basics of Multiple Sequence Alignment Tandy Warnow February 10, 2018 Basics of Multiple Sequence Alignment Tandy Warnow Basic issues What is a multiple sequence alignment? Evolutionary processes operating
More informationSistemática Teórica. Hernán Dopazo. Biomedical Genomics and Evolution Lab. Lesson 03 Statistical Model Selection
Sistemática Teórica Hernán Dopazo Biomedical Genomics and Evolution Lab Lesson 03 Statistical Model Selection Facultad de Ciencias Exactas y Naturales Universidad de Buenos Aires Argentina 2013 Statistical
More informationAccounting for Uncertainty in the Tree Topology Has Little Effect on the Decision-Theoretic Approach to Model Selection in Phylogeny Estimation
Accounting for Uncertainty in the Tree Topology Has Little Effect on the Decision-Theoretic Approach to Model Selection in Phylogeny Estimation Zaid Abdo,* à Vladimir N. Minin, Paul Joyce,* à and Jack
More informationParsimony-Based Approaches to Inferring Phylogenetic Trees
Parsimony-Based Approaches to Inferring Phylogenetic Trees BMI/CS 576 www.biostat.wisc.edu/bmi576.html Mark Craven craven@biostat.wisc.edu Fall 0 Phylogenetic tree approaches! three general types! distance:
More informationCS 581. Tandy Warnow
CS 581 Tandy Warnow This week Maximum parsimony: solving it on small datasets Maximum Likelihood optimization problem Felsenstein s pruning algorithm Bayesian MCMC methods Research opportunities Maximum
More informationProtein phylogenetics
Protein phylogenetics Robert Hirt PAUP4.0* can be used for an impressive range of analytical methods involving DNA alignments. This, unfortunately is not the case for estimating protein phylogenies. Only
More informationLesson 13 Molecular Evolution
Sequence Analysis Spring 2000 Dr. Richard Friedman (212)305-6901 (76901) friedman@cuccfa.ccc.columbia.edu 130BB Lesson 13 Molecular Evolution In this class we learn how to draw molecular evolutionary trees
More informationML phylogenetic inference and GARLI. Derrick Zwickl. University of Arizona (and University of Kansas) Workshop on Molecular Evolution 2015
ML phylogenetic inference and GARLI Derrick Zwickl University of Arizona (and University of Kansas) Workshop on Molecular Evolution 2015 Outline Heuristics and tree searches ML phylogeny inference and
More informationProspects for inferring very large phylogenies by using the neighbor-joining method. Methods
Prospects for inferring very large phylogenies by using the neighbor-joining method Koichiro Tamura*, Masatoshi Nei, and Sudhir Kumar* *Center for Evolutionary Functional Genomics, The Biodesign Institute,
More informationMolecular Evolution & Phylogenetics Complexity of the search space, distance matrix methods, maximum parsimony
Molecular Evolution & Phylogenetics Complexity of the search space, distance matrix methods, maximum parsimony Basic Bioinformatics Workshop, ILRI Addis Ababa, 12 December 2017 Learning Objectives understand
More informationA Statistical Test for Clades in Phylogenies
A STATISTICAL TEST FOR CLADES A Statistical Test for Clades in Phylogenies Thurston H. Y. Dang 1, and Elchanan Mossel 2 1 Department of Electrical Engineering and Computer Sciences, University of California,
More informationDynamic Programming User Manual v1.0 Anton E. Weisstein, Truman State University Aug. 19, 2014
Dynamic Programming User Manual v1.0 Anton E. Weisstein, Truman State University Aug. 19, 2014 Dynamic programming is a group of mathematical methods used to sequentially split a complicated problem into
More informationPHASE: a Software Package for Phylogenetics And S equence Evolution
PHASE: a Software Package for Phylogenetics And S equence Evolution Version 1.1, April 24, 2003 Copyright 2002, 2003 by the University of Manchester. PHASE is distributed under the terms of the GNU General
More informationTutorial. OTU Clustering Step by Step. Sample to Insight. March 2, 2017
OTU Clustering Step by Step March 2, 2017 Sample to Insight QIAGEN Aarhus Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 www.qiagenbioinformatics.com AdvancedGenomicsSupport@qiagen.com
More informationDPRml: Distributed Phylogeny Reconstruction by Maximum Likelihood
DPRml: Distributed Phylogeny Reconstruction by Maximum Likelihood Keane T.M. 1, Naughton T.J. 1, Travers S.A.A 2, McInerney J.O. 2, McCormack, G.P. 2 1 Department of Computer Science, National University
More informationOlivier Gascuel Arbres formels et Arbre de la Vie Conférence ENS Cachan, septembre Arbres formels et Arbre de la Vie.
Arbres formels et Arbre de la Vie Olivier Gascuel Centre National de la Recherche Scientifique LIRMM, Montpellier, France www.lirmm.fr/gascuel 10 permanent researchers 2 technical staff 3 postdocs, 10
More informationIntroduction to Bioinformatics Online Course: IBT
Introduction to Bioinformatics Online Course: IBT Multiple Sequence Alignment Building Multiple Sequence Alignment Lec2 Choosing the Right Sequences Choosing the Right Sequences Before you build your alignment,
More informationEnabling Phylogenetic Research via the CIPRES Science Gateway!
Enabling Phylogenetic Research via the CIPRES Science Gateway Wayne Pfeiffer SDSC/UCSD August 5, 2013 In collaboration with Mark A. Miller, Terri Schwartz, & Bryan Lunt SDSC/UCSD Supported by NSF Phylogenetics
More informationGenetics/MBT 541 Spring, 2002 Lecture 1 Joe Felsenstein Department of Genome Sciences Phylogeny methods, part 1 (Parsimony and such)
Genetics/MBT 541 Spring, 2002 Lecture 1 Joe Felsenstein Department of Genome Sciences joe@gs Phylogeny methods, part 1 (Parsimony and such) Methods of reconstructing phylogenies (evolutionary trees) Parsimony
More informationWhich is more useful?
Which is more useful? Reality Detailed map Detailed public transporta:on Simplified metro Models don t need to reflect reality A model is an inten:onal simplifica:on of a complex situa:on designed to eliminate
More informationWorkshop Practical on concatenation and model testing
Workshop Practical on concatenation and model testing Jacob L. Steenwyk & Antonis Rokas Programs that you will use: Bash, Python, Perl, Phyutility, PartitionFinder, awk To infer a putative species phylogeny
More informationMEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 forbiggerdatasets
MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 forbiggerdatasets Sudhir Kumar, 1,2,3 Glen Stecher 1 and Koichiro Tamura*,4,5 1 Institute for Genomics and Evolutionary Medicine, Temple University
More informationDocRead for SharePoint 2013 & Publisher s Guide. Version 3.5
DocRead for SharePoint 2013 & 2016 Publisher s Guide Version 3.5 Contents 1 Intended Audience 2 2 Prerequisites 2 3 Introduction 2 4 Adding Documents to a DocRead Enabled Library 3 5 DocRead Settings 6
More informationEvolutionary Trees. Fredrik Ronquist. August 29, 2005
Evolutionary Trees Fredrik Ronquist August 29, 2005 1 Evolutionary Trees Tree is an important concept in Graph Theory, Computer Science, Evolutionary Biology, and many other areas. In evolutionary biology,
More informationTreeTime User Manual
TreeTime User Manual Lin Himmelmann www.linhi.de Dirk Metzler www.zi.biologie.uni-muenchen.de/evol/statgen.html March 2009 TreeTime is controlled via an input file in Nexus file format (view Maddison 1997).
More informationOn the Optimality of the Neighbor Joining Algorithm
On the Optimality of the Neighbor Joining Algorithm Ruriko Yoshida Dept. of Statistics University of Kentucky Joint work with K. Eickmeyer, P. Huggins, and L. Pachter www.ms.uky.edu/ ruriko Louisville
More informationA Randomized Algorithm for Comparing Sets of Phylogenetic Trees
A Randomized Algorithm for Comparing Sets of Phylogenetic Trees Seung-Jin Sul and Tiffani L. Williams Department of Computer Science Texas A&M University E-mail: {sulsj,tlw}@cs.tamu.edu Technical Report
More informationA RANDOMIZED ALGORITHM FOR COMPARING SETS OF PHYLOGENETIC TREES
A RANDOMIZED ALGORITHM FOR COMPARING SETS OF PHYLOGENETIC TREES SEUNG-JIN SUL AND TIFFANI L. WILLIAMS Department of Computer Science Texas A&M University College Station, TX 77843-3112 USA E-mail: {sulsj,tlw}@cs.tamu.edu
More informationCAOS Documentation and Worked Examples. Neil Sarkar, Paul Planet and Rob DeSalle
CAOS Documentation and Worked Examples Neil Sarkar, Paul Planet and Rob DeSalle Table of Contents 1. Downloading and Installing p-gnome and p-elf 2. Preparing your matrix for p-gnome 3. Running p-gnome
More informationHybrid Parallelization of the MrBayes & RAxML Phylogenetics Codes
Hybrid Parallelization of the MrBayes & RAxML Phylogenetics Codes Wayne Pfeiffer (SDSC/UCSD) & Alexandros Stamatakis (TUM) February 25, 2010 What was done? Why is it important? Who cares? Hybrid MPI/OpenMP
More informationTutorial. OTU Clustering Step by Step. Sample to Insight. June 28, 2018
OTU Clustering Step by Step June 28, 2018 Sample to Insight QIAGEN Aarhus Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 www.qiagenbioinformatics.com ts-bioinformatics@qiagen.com
More informationNew algorithms and methods to estimate maximum-likelihood phylogenies: assessing the performance of PhyML 3.0
Zurich Open Repository and Archive University of Zurich Main Library Strickhofstrasse 39 CH-8057 Zurich www.zora.uzh.ch Year: 2010 New algorithms and methods to estimate maximum-likelihood phylogenies:
More informationAMPHORA2 User Manual. An Automated Phylogenomic Inference Pipeline for Bacterial and Archaeal Sequences. COPYRIGHT 2011 by Martin Wu
AMPHORA2 User Manual An Automated Phylogenomic Inference Pipeline for Bacterial and Archaeal Sequences. COPYRIGHT 2011 by Martin Wu AMPHORA2 is free software: you may redistribute it and/or modify its
More informationPRINCIPLES OF PHYLOGENETICS Spring 2008 Updated by Nick Matzke. Lab 11: MrBayes Lab
Integrative Biology 200A University of California, Berkeley PRINCIPLES OF PHYLOGENETICS Spring 2008 Updated by Nick Matzke Lab 11: MrBayes Lab Note: try downloading and installing MrBayes on your own laptop,
More informationEstimating rates and dates from time-stamped sequences A hands-on practical
Estimating rates and dates from time-stamped sequences A hands-on practical This chapter provides a step-by-step tutorial for analyzing a set of virus sequences which have been isolated at different points
More informationTutorial using BEAST v2.4.2 Introduction to BEAST2 Jūlija Pečerska and Veronika Bošková
Tutorial using BEAST v2.4.2 Introduction to BEAST2 Jūlija Pečerska and Veronika Bošková This is a simple introductory tutorial to help you get started with using BEAST2 and its accomplices. 1 Background
More informationDesigning parallel algorithms for constructing large phylogenetic trees on Blue Waters
Designing parallel algorithms for constructing large phylogenetic trees on Blue Waters Erin Molloy University of Illinois at Urbana Champaign General Allocation (PI: Tandy Warnow) Exploratory Allocation
More informationLab 8: Using POY from your desktop and through CIPRES
Integrative Biology 200A University of California, Berkeley PRINCIPLES OF PHYLOGENETICS Spring 2012 Updated by Michael Landis Lab 8: Using POY from your desktop and through CIPRES In this lab we re going
More informationSTEM-hy Tutorial Workshop on Molecular Evolution 2013
STEM-hy Tutorial Workshop on Molecular Evolution 2013 Getting started: To run the examples in this tutorial, you should copy the file STEMhy tutorial 2013.zip from the /class/shared/ directory and unzip
More informationIntroduction to Phylogenetics Week 2. Databases and Sequence Formats
Introduction to Phylogenetics Week 2 Databases and Sequence Formats I. Databases Crucial to bioinformatics The bigger the database, the more comparative research data Requires scientists to upload data
More informationClamXav a free antivirus application for the Mac
ClamXav a free antivirus application for the Mac Background Why anti-virus software for Mac OS X, which has been virus-free for years? -Viruses for OS X will eventually appear. -You presumably don't want
More informationA STEP-BY-STEP TUTORIAL FOR DISCRETE STATE PHYLOGEOGRAPHY INFERENCE
BEAST: Bayesian Evolutionary Analysis by Sampling Trees A STEP-BY-STEP TUTORIAL FOR DISCRETE STATE PHYLOGEOGRAPHY INFERENCE This step-by-step tutorial guides you through a discrete phylogeography analysis
More informationTracy Heath Workshop on Molecular Evolution, Woods Hole USA
INTRODUCTION TO BAYESIAN PHYLOGENETIC SOFTWARE Tracy Heath Integrative Biology, University of California, Berkeley Ecology & Evolutionary Biology, University of Kansas 2013 Workshop on Molecular Evolution,
More informationPartitionFinder2. Manual Rob Lanfear, December 2016
PartitionFinder2 = new methods for selecting partitioned models of evolution for phylogenetic analyses. 1 PartitionFinder2 Manual Rob Lanfear, December 2016 Icon Ainsley Seago. Thanks Ainsley! Questions,
More informationRecent Research Results. Evolutionary Trees Distance Methods
Recent Research Results Evolutionary Trees Distance Methods Indo-European Languages After Tandy Warnow What is the purpose? Understand evolutionary history (relationship between species). Uderstand how
More informationHORIZONTAL GENE TRANSFER DETECTION
HORIZONTAL GENE TRANSFER DETECTION Sequenzanalyse und Genomik (Modul 10-202-2207) Alejandro Nabor Lozada-Chávez Before start, the user must create a new folder or directory (WORKING DIRECTORY) for all
More information"PRINCIPLES OF PHYLOGENETICS" Spring 2008
Integrative Biology 200A University of California, Berkeley "PRINCIPLES OF PHYLOGENETICS" Spring 2008 Lab 7: Introduction to PAUP* Today we will be learning about some of the basic features of PAUP* (Phylogenetic
More informationSimple Analysis with the Graphical User Interface of POY
Simple Analysis with the Graphical User Interface of POY Andrés Varón July 25, 2008 1 Introduction This tutorial concentrates in the use of the Graphical User Interface (GUI) of POY 4.0. The GUI provides
More informationUser Guide. Remote Support Tool
Remote Support Tool Remote Support Tool...1 Overview...1 Starting the Support Tool...1 Starting a Remote Support Session...2 Using the Support Tool in an Office...3 Remote Support Tool At a glance...4
More informationTutorial for Windows and Macintosh. De Novo Sequence Assembly with Velvet
Tutorial for Windows and Macintosh De Novo Sequence Assembly with Velvet 2017 Gene Codes Corporation Gene Codes Corporation 525 Avis Drive, Ann Arbor, MI 48108 USA 1.800.497.4939 (USA) +1.734.769.7249
More informationMultiple sequence alignment. November 20, 2018
Multiple sequence alignment November 20, 2018 Why do multiple alignment? Gain insight into evolutionary history Can assess time of divergence by looking at the number of mutations needed to change one
More informationTutorial. Phylogenetic Trees and Metadata. Sample to Insight. November 21, 2017
Phylogenetic Trees and Metadata November 21, 2017 Sample to Insight QIAGEN Aarhus Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 www.qiagenbioinformatics.com AdvancedGenomicsSupport@qiagen.com
More informationDynamic Programming for Phylogenetic Estimation
1 / 45 Dynamic Programming for Phylogenetic Estimation CS598AGB Pranjal Vachaspati University of Illinois at Urbana-Champaign 2 / 45 Coalescent-based Species Tree Estimation Find evolutionary tree for
More informationCSE 549: Computational Biology
CSE 549: Computational Biology Phylogenomics 1 slides marked with * by Carl Kingsford Tree of Life 2 * H5N1 Influenza Strains Salzberg, Kingsford, et al., 2007 3 * H5N1 Influenza Strains The 2007 outbreak
More informationMetaPIGA v2.1. Maximum likelihood large phylogeny estimation using the metapopulation genetic algorithm (MetaGA) and other stochastic heuristics
MetaPIGA v2.1 Maximum likelihood large phylogeny estimation using the metapopulation genetic algorithm (MetaGA) and other stochastic heuristics Manual version 2.1 (June 20, 2011) Michel C. Milinkovitch
More informationIntroduction to Computational Phylogenetics
Introduction to Computational Phylogenetics Tandy Warnow The University of Texas at Austin No Institute Given This textbook is a draft, and should not be distributed. Much of what is in this textbook appeared
More information10kTrees - Exercise #2. Viewing Trees Downloaded from 10kTrees: FigTree, R, and Mesquite
10kTrees - Exercise #2 Viewing Trees Downloaded from 10kTrees: FigTree, R, and Mesquite The goal of this worked exercise is to view trees downloaded from 10kTrees, including tree blocks. You may wish to
More informationBayesian phylogenetic inference MrBayes (Practice)
Bayesian phylogenetic inference MrBayes (Practice) The aim of this tutorial is to give a very short introduction to MrBayes. There is a website with most information about MrBayes: www.mrbayes.net (which
More informationGeneration of distancebased phylogenetic trees
primer for practical phylogenetic data gathering. Uconn EEB3899-007. Spring 2015 Session 12 Generation of distancebased phylogenetic trees Rafael Medina (rafael.medina.bry@gmail.com) Yang Liu (yang.liu@uconn.edu)
More information.. Fall 2011 CSC 570: Bioinformatics Alexander Dekhtyar..
.. Fall 2011 CSC 570: Bioinformatics Alexander Dekhtyar.. PAM and BLOSUM Matrices Prepared by: Jason Banich and Chris Hoover Background As DNA sequences change and evolve, certain amino acids are more
More information[davinci]$ export CLASSPATH=$CLASSPATH:path_to_file/DualBrothers.jar:path_to_file/colt.jar
1 Installing the software 1.1 Java compiler and necessary class libraries The DualBrothers package is distributed as a Java JAR file (DualBrothers.jar). In order to use the package, a Java virtual machine
More informationImprovement of Distance-Based Phylogenetic Methods by a Local Maximum Likelihood Approach Using Triplets
Improvement of Distance-Based Phylogenetic Methods by a Local Maximum Likelihood Approach Using Triplets Vincent Ranwez and Olivier Gascuel Département Informatique Fondamentale et Applications, LIRMM,
More informationPhylogenetics. Introduction to Bioinformatics Dortmund, Lectures: Sven Rahmann. Exercises: Udo Feldkamp, Michael Wurst
Phylogenetics Introduction to Bioinformatics Dortmund, 16.-20.07.2007 Lectures: Sven Rahmann Exercises: Udo Feldkamp, Michael Wurst 1 Phylogenetics phylum = tree phylogenetics: reconstruction of evolutionary
More informationThe RAxML-VI-HPC Version 2.0 Manual
The RAxML-VI-HPC Version 2.0 Manual Alexandros Stamatakis Institute of Computer Science, Foundation for Research and Technology Hellas stamatak@ics.forth.gr 1 About RAxML RAxML (Randomized Axelerated Maximum
More informationThe RAxML-VI-HPC Version Manual
The RAxML-VI-HPC Version 2.2.3 Manual Alexandros Stamatakis École Polytechnique Fédérale de Lausanne School of Computer & Communication Sciences Laboratory for Computational Biology and Bioinformatics
More informationGene regulation. DNA is merely the blueprint Shared spatially (among all tissues) and temporally But cells manage to differentiate
Gene regulation DNA is merely the blueprint Shared spatially (among all tissues) and temporally But cells manage to differentiate Especially but not only during developmental stage And cells respond to
More informationMachine Learning. Computational biology: Sequence alignment and profile HMMs
10-601 Machine Learning Computational biology: Sequence alignment and profile HMMs Central dogma DNA CCTGAGCCAACTATTGATGAA transcription mrna CCUGAGCCAACUAUUGAUGAA translation Protein PEPTIDE 2 Growth
More informationIntroduction to MrBayes
Introduction to MrBayes Fred(rik) Ronquist Dept. Bioinformatics and Genetics Swedish Museum of Natural History, Stockholm, Sweden Installing MrBayes! Two options:! Go to mrbayes.net, click Download and
More informationDIMACS Tutorial on Phylogenetic Trees and Rapidly Evolving Pathogens. Katherine St. John City University of New York 1
DIMACS Tutorial on Phylogenetic Trees and Rapidly Evolving Pathogens Katherine St. John City University of New York 1 Thanks to the DIMACS Staff Linda Casals Walter Morris Nicole Clark Katherine St. John
More informationPackage treedater. R topics documented: May 4, Type Package
Type Package Package treedater May 4, 2018 Title Fast Molecular Clock Dating of Phylogenetic Trees with Rate Variation Version 0.2.0 Date 2018-04-23 Author Erik Volz [aut, cre] Maintainer Erik Volz
More informationGARLI manual (version 0.95)
GARLI manual (version 0.95) Short serial algorithm description... 2 A quick guide to running the program... 3 Serial FAQ... 4 Descriptions of serial GARLI settings... 9 General settings... 9 Model specification
More informationCS313 Exercise 4 Cover Page Fall 2017
CS313 Exercise 4 Cover Page Fall 2017 Due by the start of class on Thursday, October 12, 2017. Name(s): In the TIME column, please estimate the time you spent on the parts of this exercise. Please try
More informationLab 8 Phylogenetics I: creating and analysing a data matrix
G44 Geobiology Fall 23 Name Lab 8 Phylogenetics I: creating and analysing a data matrix For this lab and the next you will need to download and install the Mesquite and PHYLIP packages: http://mesquiteproject.org/mesquite/mesquite.html
More informationParallel Phylogenetic Inference
Brigham Young University BYU ScholarsArchive All Faculty Publications 2000-11-10 Parallel Phylogenetic Inference Mark J. Clement clement@cs.byu.edu David McLaughlin See next page for additional authors
More informationUser Guide. Remote Support Tool
Remote Support Tool Remote Support Tool... 1 User Guide... 1 Overview... 1 Starting the Support Tool... 1 Starting a Remote Support Session... 2 Using TeamViewer... 3 Using the Support Tool in an Office...
More information"PRINCIPLES OF PHYLOGENETICS" Spring Lab 1: Introduction to PHYLIP
Integrative Biology 200A University of California, Berkeley "PRINCIPLES OF PHYLOGENETICS" Spring 2008 Lab 1: Introduction to PHYLIP What s due at the end of lab, or next Tuesday in class: 1. Print out
More informationhuman chimp mouse rat
Michael rudno These notes are based on earlier notes by Tomas abak Phylogenetic Trees Phylogenetic Trees demonstrate the amoun of evolution, and order of divergence for several genomes. Phylogenetic trees
More informationDrupal FAQs for administrators
Drupal FAQs for administrators Questions How do I edit content? Why can t I edit content? How do I publish content? How do I pull a piece of content back to draft after publishing? Where has the save button
More informationDISTANCE BASED METHODS IN PHYLOGENTIC TREE CONSTRUCTION
DISTANCE BASED METHODS IN PHYLOGENTIC TREE CONSTRUCTION CHUANG PENG DEPARTMENT OF MATHEMATICS MOREHOUSE COLLEGE ATLANTA, GA 30314 Abstract. One of the most fundamental aspects of bioinformatics in understanding
More informationLecture Overview. Sequence search & alignment. Searching sequence databases. Sequence Alignment & Search. Goals: Motivations:
Lecture Overview Sequence Alignment & Search Karin Verspoor, Ph.D. Faculty, Computational Bioscience Program University of Colorado School of Medicine With credit and thanks to Larry Hunter for creating
More informationSOP for Influenza autocuration
SOP for Influenza autocuration Authors: Catherine Macken (c.macken@auckland.ac.nz), Sam Zaremba (Sam.Zaremba@ngc.com), Guangyu Sun (gsun@vecna.com), Sherry He (she@virusbrc.org), Christian Suloway (csuloway@virusbrc.org),
More informationTutorial: De Novo Assembly of Paired Data
: De Novo Assembly of Paired Data September 20, 2013 CLC bio Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 Fax: +45 86 20 12 22 www.clcbio.com support@clcbio.com : De Novo Assembly
More informationExtended Bayesian Skyline Plot tutorial for BEAST 2
Extended Bayesian Skyline Plot tutorial for BEAST 2 Joseph Heled (updated for BEAST 2 by Tim Vaughan) This short practical explains how to set up an Extended Bayesian Skyline Plot (EBSP) analysis in BEAST
More informationSupplementary Online Material PASTA: ultra-large multiple sequence alignment
Supplementary Online Material PASTA: ultra-large multiple sequence alignment Siavash Mirarab, Nam Nguyen, and Tandy Warnow University of Texas at Austin - Department of Computer Science {smirarab,bayzid,tandy}@cs.utexas.edu
More information