Command-Line Data Analysis INX_S17, Day 10,

Size: px
Start display at page:

Download "Command-Line Data Analysis INX_S17, Day 10,"

Transcription

1 Command-Line Data Analysis INX_S17, Day 10, Assignment 4 (quiz). sort, head, tail Learning Outcome(s): Use `sort` to build filtering pipelines for bioinformatics data Matthew Peterson, OSU CGRB, matthew@cgrb.oregonstate.edu Please do not redistribute outside of OSU; contains copyrighted materials.

2 Command-line Set 1

3 Bonus! (ok, not really ) 2

4 Review: fasta_stats A Python script from the book Generates statistics about a FASTA file it's supplied./fasta_stats Usage: fasta_dna_stats <fasta_file> This script is for informational purposes only, and requires that the input file be a DNA (As, Ts, Cs, and Gs) FASTA-formatted file../fasta_stats pz_cdnas_sample.fasta # Only 2 sequences in this FASTA file html 3

5 PZ example PZ ACAAA 5 unit:attta 10 pentanucleotide 2: GC content of 37.8% (vs. AT) 3: 486 base pairs (bp) long 4: Most common 5-bp sequence is ACAAA 5: This 5-bp sequence ACAAA appears 5 times 6: Longest perfect repeat sequence is ATTTA 7: and is 10bp long 8: caused by the pentanucleotide ATTTA appearing twice (ATTTAATTTA) 4

6 fasta_stats continued 7 th column contains the length (as an integer) of the longest perfect repeat in characters (bases) 5

7 fasta_stats question Q: What sequence (in pz_cdnas.fasta) contains the longest perfect repeat (column 7)? A: Sort the output by column 7 * PZ TTTCT 5 unit:ctttccg 14 heptanucleotide PZ TTATT 11 unit:tat 15 trinucleotide PZ AGCAA 6 unit:gag 6 trinucleotide PZ4990_P TTATA 5 unit:attata 12 hexanucleotide PZ AAAAA 11 unit:taat 8 tetranucleotide PZ TTTTT 19 unit:taatttt 14 heptanucleotide PZ ATATT 8 unit:gtata 10 pentanucleotide PZ TTTTT 18 unit:attt 8 tetranucleotide PZ TTTAA 6 unit:gct 6 trinucleotide * Filter the (#) header of fasta_stats : grep v # or grep 'unit:' 6

8 sort <file> or sort Lots of options! No options? It sorts all columns. By default sort sorts by dictionary order. Uses whitespace as column separator. 7

9 sort by key (column) sort by columns 2-4 ("conglomerated"), in dictionary order, and in reverse. ast_lines.html 8

10 sort Break ties by Break ties by sorting 1 st column in dictionary order. 9

11 sort Break further ties by Break further ties by sorting by 5 st column in numeric order. numeric is faster than general numeric, which can handle scientific notation (1e-6) 10

12 sort -unique Optional unique flag specifies if there are still ties to only show the first row. 11

13 fasta_stats example sort./fasta_stats pz_cdnas.fasta \ grep v '#' \ sort k7,7nr \ less S Sort on longest perfect repeat in column 7 in reverse, numeric order 12

14 fasta_stats sort output Longest perfect repeat is 94 base pairs Several ties of 18 base pair sequences 13

15 fasta_stats sort unique bp Show one sequence per base pair length: sort k7,7nr u 14

16 fasta_stats sort GC content Sort by GC content sort k7,7nr k2,2g 15

17 Pipelining (chaining) sorts together Sort by highest GC content (column 2) and then Re-sort by unique repeat length (column 7)./fasta_stats pz_cdnas.fasta \ grep v '#' \ sort k7,7nr k2,2gr \ sort k7,7nr u \ less S 16

18 Sort GC content, unique repeat length -s stable guarantees our 2 nd sort will not "undo" the the GC content sorting of our 1 st sort cat x sort k2,2 x sort s -k2,2 x D 2 A 2 D 2 B 2 B 2 B 2 A 2 D 2 A 2 See also: 17

19 Extract first or last lines head n <number> <file> tail n <number> <file> or head n <number> tail n <number> 18

20 First (top) 3 lines of our sort via head./fasta_stats pz_cdnas.fasta \ grep v '#' \ sort k7,7nr k2,2gr \ sort k7,7nr u \ head n3 19

21 Offset in tail Start printing with second row on (skip our top hit)./fasta_stats pz_cdnas.fasta \ grep v '#' \ sort k7,7nr k2,2gr \ sort k7,7nr u \ tail n +2 20

22 tail f Follow Constantly watch output appended to a file When would we use this? e.g., You have a BLAST job (submitted via SGE) that you know is going to take days to complete. You know that it's writing its stdout to a file into the log directory you specified (via SGE_Batch) You can watch the file's stdout "grow" (be appended) in real-time, e.g., tail -f MYJOB.o Ctrl-c to quit 21

23 sort head tail Command / Concept Review 22

Introduction to Unix/Linux INX_S17, Day 8,

Introduction to Unix/Linux INX_S17, Day 8, Introduction to Unix/Linux INX_S17, Day 8, 2017-04-21 stdin, stdout, stderr, piping, iterative filtering, grep, cat, UUOC Learning Outcome(s): Redirect the standard output to the standard input stream

More information

Command-Line Data Analysis INX_S17, Day 15,

Command-Line Data Analysis INX_S17, Day 15, Command-Line Data Analysis INX_S17, Day 15, 2017-05-12 General tool efficiency, tr, newlines, join, column Learning Outcome(s): Discuss the theory behind Unix/Linux tool efficiency, e.g., the reasons behind

More information

Command Line and Python Introduction. Jennifer Helsby, Eric Potash Computation for Public Policy Lecture 2: January 7, 2016

Command Line and Python Introduction. Jennifer Helsby, Eric Potash Computation for Public Policy Lecture 2: January 7, 2016 Command Line and Python Introduction Jennifer Helsby, Eric Potash Computation for Public Policy Lecture 2: January 7, 2016 Today Assignment #1! Computer architecture Basic command line skills Python fundamentals

More information

Anthill User Group Meeting, 2015

Anthill User Group Meeting, 2015 Agenda Anthill User Group Meeting, 2015 1. Introduction to the machines and the networks 2. Accessing the machines 3. Command line introduction 4. Setting up your environment to see the queues 5. The different

More information

These will serve as a basic guideline for read prep. This assumes you have demultiplexed Illumina data.

These will serve as a basic guideline for read prep. This assumes you have demultiplexed Illumina data. These will serve as a basic guideline for read prep. This assumes you have demultiplexed Illumina data. We have a few different choices for running jobs on DT2 we will explore both here. We need to alter

More information

Introduction to Unix/Linux INX_S17, Day 6,

Introduction to Unix/Linux INX_S17, Day 6, Introduction to Unix/Linux INX_S17, Day 6, 2017-04-17 Installing binaries, uname, hmmer and muscle, public data (wget and sftp) Learning Outcome(s): Install and run software from your home directory. Download

More information

Week Overview. Simple filter commands: head, tail, cut, sort, tr, wc grep utility stdin, stdout, stderr Redirection and piping /dev/null file

Week Overview. Simple filter commands: head, tail, cut, sort, tr, wc grep utility stdin, stdout, stderr Redirection and piping /dev/null file ULI101 Week 05 Week Overview Simple filter commands: head, tail, cut, sort, tr, wc grep utility stdin, stdout, stderr Redirection and piping /dev/null file head and tail commands These commands display

More information

Introduction to UNIX command-line II

Introduction to UNIX command-line II Introduction to UNIX command-line II Boyce Thompson Institute 2017 Prashant Hosmani Class Content Terminal file system navigation Wildcards, shortcuts and special characters File permissions Compression

More information

ITST Searching, Extracting & Archiving Data

ITST Searching, Extracting & Archiving Data ITST 1136 - Searching, Extracting & Archiving Data Name: Step 1 Sign into a Pi UN = pi PW = raspberry Step 2 - Grep - One of the most useful and versatile commands in a Linux terminal environment is the

More information

Python Working with files. May 4, 2017

Python Working with files. May 4, 2017 Python Working with files May 4, 2017 So far, everything we have done in Python was using in-memory operations. After closing the Python interpreter or after the script was done, all our input and output

More information

Chapter 6. Files and Exceptions I

Chapter 6. Files and Exceptions I Chapter 6 Files and Exceptions I What is a file? a file is a collection of data that is stored on secondary storage like a disk or a thumb drive accessing a file means establishing a connection between

More information

Assignment 6: Motif Finding Bio5488 2/24/17. Slide Credits: Nicole Rockweiler

Assignment 6: Motif Finding Bio5488 2/24/17. Slide Credits: Nicole Rockweiler Assignment 6: Motif Finding Bio5488 2/24/17 Slide Credits: Nicole Rockweiler Assignment 6: Motif finding Input Promoter sequences PWMs of DNA-binding proteins Goal Find putative binding sites in the sequences

More information

Unit 10: Data Structures CS 101, Fall 2018

Unit 10: Data Structures CS 101, Fall 2018 Unit 10: Data Structures CS 101, Fall 2018 Learning Objectives After completing this unit, you should be able to: Define and give everyday examples of arrays, stacks, queues, and trees. Explain what a

More information

Introduction p. 1 Who Should Read This Book? p. 1 What You Need to Know Before Reading This Book p. 2 How This Book Is Organized p.

Introduction p. 1 Who Should Read This Book? p. 1 What You Need to Know Before Reading This Book p. 2 How This Book Is Organized p. Introduction p. 1 Who Should Read This Book? p. 1 What You Need to Know Before Reading This Book p. 2 How This Book Is Organized p. 2 Conventions Used in This Book p. 2 Introduction to UNIX p. 5 An Overview

More information

Module 8 Pipes, Redirection and REGEX

Module 8 Pipes, Redirection and REGEX Module 8 Pipes, Redirection and REGEX Exam Objective 3.2 Searching and Extracting Data from Files Objective Summary Piping and redirection Partial POSIX Command Line and Redirection Command Line Pipes

More information

Introduction to UNIX command-line

Introduction to UNIX command-line Introduction to UNIX command-line Boyce Thompson Institute March 17, 2015 Lukas Mueller & Noe Fernandez Class Content Terminal file system navigation Wildcards, shortcuts and special characters File permissions

More information

More text file manipulation: sorting, cutting, pasting, joining, subsetting,

More text file manipulation: sorting, cutting, pasting, joining, subsetting, More text file manipulation: sorting, cutting, pasting, joining, subsetting, Laboratory of Genomics & Bioinformatics in Parasitology Department of Parasitology, ICB, USP Inverse cat Last week we learned

More information

Short Answer Questions (40 points)

Short Answer Questions (40 points) CS 1112 Fall 2017 Test 2 Page 1 of 6 Short Answer Questions (40 points) 1. TRUE FALSE You have very legibly printed your name and email id below. Name = EMAILD = 2. TRUE FALSE On my honor, I pledge that

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature25174 Sequences of DNA primers used in this study. Primer Primer sequence code 498 GTCCAGATCTTGATTAAGAAAAATGAAGAAA F pegfp 499 GTCCAGATCTTGGTTAAGAAAAATGAAGAAA F pegfp 500 GTCCCTGCAGCCTAGAGGGTTAGG

More information

Contents. Note: pay attention to where you are. Note: Plaintext version. Note: pay attention to where you are... 1 Note: Plaintext version...

Contents. Note: pay attention to where you are. Note: Plaintext version. Note: pay attention to where you are... 1 Note: Plaintext version... Contents Note: pay attention to where you are........................................... 1 Note: Plaintext version................................................... 1 Hello World of the Bash shell 2 Accessing

More information

http://xkcd.com/208/ 1. Review of pipes 2. Regular expressions 3. sed 4. awk 5. Editing Files 6. Shell loops 7. Shell scripts cat seqs.fa >0! TGCAGGTATATCTATTAGCAGGTTTAATTTTGCCTGCACTTGGTTGGGTACATTATTTTAAGTGTATTTGACAAG!

More information

COMS 6100 Class Notes 3

COMS 6100 Class Notes 3 COMS 6100 Class Notes 3 Daniel Solus September 1, 2016 1 General Remarks The class was split into two main sections. We finished our introduction to Linux commands by reviewing Linux commands I and II

More information

Hashing. 1. Introduction. 2. Direct-address tables. CmSc 250 Introduction to Algorithms

Hashing. 1. Introduction. 2. Direct-address tables. CmSc 250 Introduction to Algorithms Hashing CmSc 250 Introduction to Algorithms 1. Introduction Hashing is a method of storing elements in a table in a way that reduces the time for search. Elements are assumed to be records with several

More information

Linux Introduction to Linux

Linux Introduction to Linux Linux Introduction to Linux Most computational biologists use either Apple Macs or Linux machines. There are a couple of reasons for this: * Much of the software is free * Many of the tools require a command

More information

CS 25200: Systems Programming. Lecture 10: Shell Scripting in Bash

CS 25200: Systems Programming. Lecture 10: Shell Scripting in Bash CS 25200: Systems Programming Lecture 10: Shell Scripting in Bash Dr. Jef Turkstra 2018 Dr. Jeffrey A. Turkstra 1 Lecture 10 Getting started with Bash Data types Reading and writing Control loops Decision

More information

http://xkcd.com/208/ 1. Review of pipes 2. Regular expressions 3. sed 4. Editing Files 5. Shell loops 6. Shell scripts cat seqs.fa >0! TGCAGGTATATCTATTAGCAGGTTTAATTTTGCCTGCACTTGGTTGGGTACATTATTTTAAGTGTATTTGACAAG!

More information

Working With Unix. Scott A. Handley* September 15, *Adapted from UNIX introduction material created by Dr. Julian Catchen

Working With Unix. Scott A. Handley* September 15, *Adapted from UNIX introduction material created by Dr. Julian Catchen Working With Unix Scott A. Handley* September 15, 2014 *Adapted from UNIX introduction material created by Dr. Julian Catchen What is UNIX? An operating system (OS) Designed to be multiuser and multitasking

More information

Overview.

Overview. Overview day one 0. getting set up 1. text output and manipulation day two 2. reading and writing files 3. lists and loops day three 4. writing functions 5. conditional statements day four today day six

More information

Cloud Computing and Unix: An Introduction. Dr. Sophie Shaw University of Aberdeen, UK

Cloud Computing and Unix: An Introduction. Dr. Sophie Shaw University of Aberdeen, UK Cloud Computing and Unix: An Introduction Dr. Sophie Shaw University of Aberdeen, UK s.shaw@abdn.ac.uk Aberdeen London Exeter What We re Going To Do Why Unix? Cloud Computing Connecting to AWS Introduction

More information

Cloud Computing and Unix: An Introduction. Dr. Sophie Shaw University of Aberdeen, UK

Cloud Computing and Unix: An Introduction. Dr. Sophie Shaw University of Aberdeen, UK Cloud Computing and Unix: An Introduction Dr. Sophie Shaw University of Aberdeen, UK s.shaw@abdn.ac.uk Aberdeen London Exeter What We re Going To Do Why Unix? Cloud Computing Connecting to AWS Introduction

More information

Working with files. File Reading and Writing. Reading and writing. Opening a file

Working with files. File Reading and Writing. Reading and writing. Opening a file Working with files File Reading and Writing Reading get info into your program Parsing processing file contents Writing get info out of your program MBV-INFx410 Fall 2014 Reading and writing Three-step

More information

Bioinformatics Programming. EE, NCKU Tien-Hao Chang (Darby Chang)

Bioinformatics Programming. EE, NCKU Tien-Hao Chang (Darby Chang) Bioinformatics Programming EE, NCKU Tien-Hao Chang (Darby Chang) 1 Regular Expression 2 http://rp1.monday.vip.tw1.yahoo.net/res/gdsale/st_pic/0469/st-469571-1.jpg 3 Text patterns and matches A regular

More information

C++ Programming. Final Project. Implementing the Smith-Waterman Algorithm Software Engineering, EIM-I Philipp Schubert Version 1.1.

C++ Programming. Final Project. Implementing the Smith-Waterman Algorithm Software Engineering, EIM-I Philipp Schubert Version 1.1. C++ Programming Implementing the Smith-Waterman Algorithm Software Engineering, EIM-I Philipp Schubert Version 1.1 January 26, 2018 This project is mandatory in order to pass the course and to obtain the

More information

Unix Essentials. BaRC Hot Topics Bioinformatics and Research Computing Whitehead Institute October 12 th

Unix Essentials. BaRC Hot Topics Bioinformatics and Research Computing Whitehead Institute October 12 th Unix Essentials BaRC Hot Topics Bioinformatics and Research Computing Whitehead Institute October 12 th 2016 http://barc.wi.mit.edu/hot_topics/ 1 Outline Unix overview Logging in to tak Directory structure

More information

Managing Your Biological Data with Python

Managing Your Biological Data with Python Chapman & Hall/CRC Mathematical and Computational Biology Series Managing Your Biological Data with Python Ailegra Via Kristian Rother Anna Tramontano CRC Press Taylor & Francis Group Boca Raton London

More information

bistro Documentation Release dev Philippe Veber

bistro Documentation Release dev Philippe Veber bistro Documentation Release dev Philippe Veber Oct 10, 2018 Contents 1 Getting started 1 1.1 Installation................................................ 1 1.2 A simple example............................................

More information

CS 1044 Program 6 Summer I dimension ??????

CS 1044 Program 6 Summer I dimension ?????? Managing a simple array: Validating Array Indices Most interesting programs deal with considerable amounts of data, and must store much, or all, of that data on one time. The simplest effective means for

More information

CSE 303 Midterm Exam

CSE 303 Midterm Exam CSE 303 Midterm Exam October 29, 2008 Name Sample Solution The exam is closed book, except that you may have a single page of hand written notes for reference. If you don t remember the details of how

More information

CS ) PROGRAMMING ASSIGNMENT 11:00 PM 11:00 PM

CS ) PROGRAMMING ASSIGNMENT 11:00 PM 11:00 PM CS3114 (Fall 2017) PROGRAMMING ASSIGNMENT #4 Due Thursday, December 7 th @ 11:00 PM for 100 points Due Tuesday, December 5 th @ 11:00 PM for 10 point bonus Last updated: 11/13/2017 Assignment: Update:

More information

Genomes On The Cloud GotCloud. University of Michigan Center for Statistical Genetics Mary Kate Wing Goo Jun

Genomes On The Cloud GotCloud. University of Michigan Center for Statistical Genetics Mary Kate Wing Goo Jun Genomes On The Cloud GotCloud University of Michigan Center for Statistical Genetics Mary Kate Wing Goo Jun Friday, March 8, 2013 Why GotCloud? Connects sequence analysis tools together Alignment, quality

More information

Reading and manipulating files

Reading and manipulating files Reading and manipulating files Goals By the end of this lesson you will be able to Read files without using text editors Access specific parts of files Count the number of words and lines in a file Sort

More information

Sequence Analysis with Perl. Unix, Perl and BioPerl. Why Perl? Objectives. A first Perl program. Perl Input/Output. II: Sequence Analysis with Perl

Sequence Analysis with Perl. Unix, Perl and BioPerl. Why Perl? Objectives. A first Perl program. Perl Input/Output. II: Sequence Analysis with Perl Sequence Analysis with Perl Unix, Perl and BioPerl II: Sequence Analysis with Perl George Bell, Ph.D. WIBR Bioinformatics and Research Computing Introduction Input/output Variables Functions Control structures

More information

Essential Skills for Bioinformatics: Unix/Linux

Essential Skills for Bioinformatics: Unix/Linux Essential Skills for Bioinformatics: Unix/Linux WORKING WITH COMPRESSED DATA Overview Data compression, the process of condensing data so that it takes up less space (on disk drives, in memory, or across

More information

Merge Conflicts p. 92 More GitHub Workflows: Forking and Pull Requests p. 97 Using Git to Make Life Easier: Working with Past Commits p.

Merge Conflicts p. 92 More GitHub Workflows: Forking and Pull Requests p. 97 Using Git to Make Life Easier: Working with Past Commits p. Preface p. xiii Ideology: Data Skills for Robust and Reproducible Bioinformatics How to Learn Bioinformatics p. 1 Why Bioinformatics? Biology's Growing Data p. 1 Learning Data Skills to Learn Bioinformatics

More information

Contents Systems of Linear Equations and Determinants

Contents Systems of Linear Equations and Determinants Contents 6. Systems of Linear Equations and Determinants 2 Example 6.9................................. 2 Example 6.10................................ 3 6.5 Determinants................................

More information

Interim Standards New Directions Workbook One EASI Tool Excel Support Document Contents:

Interim Standards New Directions Workbook One EASI Tool Excel Support Document Contents: Interim Standards New Directions Workbook One EASI Tool Excel Support Document Contents: 1. EASI Tool Template.... 2 2. Accessing and Saving the Tool Template.... 2 3. Screen View... 3 4. Comments/Guidance

More information

Unix, Perl and BioPerl

Unix, Perl and BioPerl Unix, Perl and BioPerl II: Sequence Analysis with Perl George Bell, Ph.D. WIBR Bioinformatics and Research Computing Sequence Analysis with Perl Introduction Input/output Variables Functions Control structures

More information

Molecular Index Error correction

Molecular Index Error correction Molecular Index Error correction Overview: This section provides directions for generating SSCS (Single Strand Consensus Sequence) reads and trimming molecular indexes from raw fastq files. Learning Objectives:

More information

An Introduction to Python

An Introduction to Python An Introduction to Python Day 3 Renaud Dessalles dessalles@ucla.edu Writing Modules Combining what we ve learnt Yesterday we learnt a lot of different bits of Python. Let s summarize that knowledge by

More information

CallManager Server: Use PsList to Troubleshoot a Memory Leak Problem

CallManager Server: Use PsList to Troubleshoot a Memory Leak Problem CallManager Server: Use PsList to Troubleshoot a Memory Leak Problem Document ID: 66967 Contents Introduction Prerequisites Requirements Components Used Conventions Background Usage Setup PsList on the

More information

Recap From Last Time:

Recap From Last Time: Recap From Last Time: BGGN 213 Working with UNIX Barry Grant http://thegrantlab.org/bggn213 Motivation: Why we use UNIX for bioinformatics. Modularity, Programmability, Infrastructure, Reliability and

More information

BGGN 213 Working with UNIX Barry Grant

BGGN 213 Working with UNIX Barry Grant BGGN 213 Working with UNIX Barry Grant http://thegrantlab.org/bggn213 Recap From Last Time: Motivation: Why we use UNIX for bioinformatics. Modularity, Programmability, Infrastructure, Reliability and

More information

Administration CS 412/413. Instruction ordering issues. Simplified architecture model. Examples. Impact of instruction ordering

Administration CS 412/413. Instruction ordering issues. Simplified architecture model. Examples. Impact of instruction ordering dministration CS 1/13 Introduction to Compilers and Translators ndrew Myers Cornell University P due in 1 week Optional reading: Muchnick 17 Lecture 30: Instruction scheduling 1 pril 00 1 Impact of instruction

More information

Dictionary. Dictionary. stores key-value pairs. Find(k) Insert(k, v) Delete(k) List O(n) O(1) O(n) Sorted Array O(log n) O(n) O(n)

Dictionary. Dictionary. stores key-value pairs. Find(k) Insert(k, v) Delete(k) List O(n) O(1) O(n) Sorted Array O(log n) O(n) O(n) Hash-Tables Introduction Dictionary Dictionary stores key-value pairs Find(k) Insert(k, v) Delete(k) List O(n) O(1) O(n) Sorted Array O(log n) O(n) O(n) Balanced BST O(log n) O(log n) O(log n) Dictionary

More information

CSC209H Lecture 1. Dan Zingaro. January 7, 2015

CSC209H Lecture 1. Dan Zingaro. January 7, 2015 CSC209H Lecture 1 Dan Zingaro January 7, 2015 Welcome! Welcome to CSC209 Comments or questions during class? Let me know! Topics: shell and Unix, pipes and filters, C programming, processes, system calls,

More information

7.2. The Standard Normal Distribution

7.2. The Standard Normal Distribution 7.2 The Standard Normal Distribution Standard Normal The standard normal curve is the one with mean μ = 0 and standard deviation σ = 1 We have related the general normal random variable to the standard

More information

ECE 461 Internetworking Fall Quiz 1

ECE 461 Internetworking Fall Quiz 1 ECE 461 Internetworking Fall 2013 Quiz 1 Instructions (read carefully): The time for this quiz is 50 minutes. This is a closed book and closed notes in-class exam. Non-programmable (Type 2) calculators

More information

UNIX, GNU/Linux and simple tools for data manipulation

UNIX, GNU/Linux and simple tools for data manipulation UNIX, GNU/Linux and simple tools for data manipulation Dr Jean-Baka DOMELEVO ENTFELLNER BecA-ILRI Hub Basic Bioinformatics Training Workshop @ILRI Addis Ababa Wednesday December 13 th 2017 Dr Jean-Baka

More information

Introduction To. Barry Grant

Introduction To. Barry Grant Introduction To Barry Grant bjgrant@umich.edu http://thegrantlab.org Working with Unix How do we actually use Unix? Inspecting text files less - visualize a text file: use arrow keys page down/page up

More information

Lab 4: Bash Scripting

Lab 4: Bash Scripting Lab 4: Bash Scripting February 20, 2018 Introduction This lab will give you some experience writing bash scripts. You will need to sign in to https://git-classes. mst.edu and git clone the repository for

More information

STORING DATA: DISK AND FILES

STORING DATA: DISK AND FILES STORING DATA: DISK AND FILES CS 564- Fall 2016 ACKs: Dan Suciu, Jignesh Patel, AnHai Doan MANAGING DISK SPACE The disk space is organized into files Files are made up of pages s contain records 2 FILE

More information

1. Enter the Order Number in the smartdocs search field, then press the Enter key on your keyboard while the cursor is still blinking in the field.

1. Enter the Order Number in the smartdocs search field, then press the Enter key on your keyboard while the cursor is still blinking in the field. Creating a smartbinder Presentation Overview: This job aid shows you how to create a smartbinder Presentation in smartdocs. A smartbinder is an HTML document that creates a Table of Contents with links

More information

User Preferences & Security Snapshots

User Preferences & Security Snapshots App Number: 010011 User Preferences & Security Snapshots Last Updated 9 th January 2013 Powered by: AppsForGreentree.com 2013 1 Table of Contents Features... 3 Important Notes... 3 Other Requirements...

More information

SOLiD GFF File Format

SOLiD GFF File Format SOLiD GFF File Format 1 Introduction The GFF file is a text based repository and contains data and analysis results; colorspace calls, quality values (QV) and variant annotations. The inputs to the GFF

More information

Department of Computer Science and Technology

Department of Computer Science and Technology M.Sc. (CA) (2 nd Semester) 040020202 : UNIX Internals and Shell Programming Teaching Schedule Objective: To acquaint the students with the basic internal structure & operations of UNIX operating system,

More information

Lab #2 Physics 91SI Spring 2013

Lab #2 Physics 91SI Spring 2013 Lab #2 Physics 91SI Spring 2013 Objective: Some more experience with advanced UNIX concepts, such as redirecting and piping. You will also explore the usefulness of Mercurial version control and how to

More information

CPSC 217 Midterm (Python 3 version)

CPSC 217 Midterm (Python 3 version) CPSC 217 Midterm (Python 3 version) Duration: 50 minutes 6 March 2009 This exam has 61 questions and 11 pages. This exam is closed book. No notes, books, calculators or electronic devices, or other assistance

More information

The Big Python Guide

The Big Python Guide The Big Python Guide Big Python Guide - Page 1 Contents Input, Output and Variables........ 3 Selection (if...then)......... 4 Iteration (for loops)......... 5 Iteration (while loops)........ 6 String

More information

Lecture 3. Essential skills for bioinformatics: Unix/Linux

Lecture 3. Essential skills for bioinformatics: Unix/Linux Lecture 3 Essential skills for bioinformatics: Unix/Linux RETRIEVING DATA Overview Whether downloading large sequencing datasets or accessing a web application hundreds of times to download specific files,

More information

Working with files. File Reading and Writing. Reading and writing. Opening a file

Working with files. File Reading and Writing. Reading and writing. Opening a file Working with files File Reading and Writing Reading get info into your program Parsing processing file contents Writing get info out of your program MBV-INFx410 Fall 2015 Reading and writing Three-step

More information

Unix basics exercise MBV-INFX410

Unix basics exercise MBV-INFX410 Unix basics exercise MBV-INFX410 In order to start this exercise, you need to be logged in on a UNIX computer with a terminal window open on your computer. It is best if you are logged in on freebee.abel.uio.no.

More information

Add Bullets and Numbers

Add Bullets and Numbers . Lesson 5: Adding Bullets and Numbers, If you have lists of data, you may want to bullet or number them. When using Microsoft Word, bulleting and numbering are easy. The first part of this lesson teaches

More information

LAB 8 (Aug 4/5) Unix Utilities

LAB 8 (Aug 4/5) Unix Utilities Aug 4/5 Due: Aug 11 in class Name: CSE number: LAB 8 (Aug 4/5) Unix Utilities The purpose of this lab exercise is for you to get some hands-on experience on using some fundamental Unix utilities (commands).

More information

Binary, Hexadecimal and Octal number system

Binary, Hexadecimal and Octal number system Binary, Hexadecimal and Octal number system Binary, hexadecimal, and octal refer to different number systems. The one that we typically use is called decimal. These number systems refer to the number of

More information

Lecture 11: Packet forwarding

Lecture 11: Packet forwarding Lecture 11: Packet forwarding Anirudh Sivaraman 2017/10/23 This week we ll talk about the data plane. Recall that the routing layer broadly consists of two parts: (1) the control plane that computes routes

More information

1. BASICS OF PYTHON. JHU Physics & Astronomy Python Workshop Lecturer: Mubdi Rahman

1. BASICS OF PYTHON. JHU Physics & Astronomy Python Workshop Lecturer: Mubdi Rahman 1. BASICS OF PYTHON JHU Physics & Astronomy Python Workshop 2017 Lecturer: Mubdi Rahman HOW IS THIS WORKSHOP GOING TO WORK? We will be going over all the basics you need to get started and get productive

More information

Decision Logic: if, if else, switch, Boolean conditions and variables

Decision Logic: if, if else, switch, Boolean conditions and variables CS 1044 roject 4 Summer I 2007 Decision Logic: if, if else, switch, Boolean conditions and variables This programming assignment uses many of the ideas presented in sections 3 through 5 of the course notes,

More information

CS S-02 Python 1. Most python references use examples involving spam, parrots (deceased), silly walks, and the like

CS S-02 Python 1. Most python references use examples involving spam, parrots (deceased), silly walks, and the like CS662-2013S-02 Python 1 02-0: Python Name python comes from Monte Python s Flying Circus Most python references use examples involving spam, parrots (deceased), silly walks, and the like Interpreted language

More information

UNIX Essentials Featuring Solaris 10 Op System

UNIX Essentials Featuring Solaris 10 Op System A Active Window... 7:11 Application Development Tools... 7:7 Application Manager... 7:4 Architectures - Supported - UNIX... 1:13 Arithmetic Expansion... 9:10 B Background Processing... 3:14 Background

More information

LAB 8 (Aug 4/5) Unix Utilities

LAB 8 (Aug 4/5) Unix Utilities Aug 4/5 Due: Aug 11 in class Name: CSE number: LAB 8 (Aug 4/5) Unix Utilities The purpose of this lab exercise is for you to get some hands-on experience on using some fundamental Unix utilities (commands).

More information

Wildcards and Regular Expressions

Wildcards and Regular Expressions CSCI 2132: Software Development Wildcards and Regular Expressions Norbert Zeh Faculty of Computer Science Dalhousie University Winter 2019 Searching Problem: Find all files whose names match a certain

More information

Excel Level Three. You can also go the Format, Column, Width menu to enter the new width of the column.

Excel Level Three. You can also go the Format, Column, Width menu to enter the new width of the column. Introduction Excel Level Three This workshop shows you how to change column and rows, insert and delete columns and rows, how and what to print, and setting up to print your documents. Contents Introduction

More information

sottotitolo A.A. 2016/17 Federico Reghenzani, Alessandro Barenghi

sottotitolo A.A. 2016/17 Federico Reghenzani, Alessandro Barenghi Titolo presentazione Piattaforme Software per la Rete sottotitolo BASH Scripting Milano, XX mese 20XX A.A. 2016/17, Alessandro Barenghi Outline 1) Introduction to BASH 2) Helper commands 3) Control Flow

More information

TOTAL ECLIPSE POCKET GUIDE CONTENTS

TOTAL ECLIPSE POCKET GUIDE CONTENTS TOTAL ECLIPSE POCKET GUIDE CONTENTS Stentura SRT Clear Memory... 1 Stentura 400SRT Light Indicator Table... 1 Flush Delay... 1 Read In, Translate Notes, & Separate Files... 2 How to Create a Realtime File...

More information

COMPARATIVE MICROBIAL GENOMICS ANALYSIS WORKSHOP. Exercise 2: Predicting Protein-encoding Genes, BlastMatrix, BlastAtlas

COMPARATIVE MICROBIAL GENOMICS ANALYSIS WORKSHOP. Exercise 2: Predicting Protein-encoding Genes, BlastMatrix, BlastAtlas COMPARATIVE MICROBIAL GENOMICS ANALYSIS WORKSHOP Exercise 2: Predicting Protein-encoding Genes, BlastMatrix, BlastAtlas First of all connect once again to the CBS system: Open ssh shell client. Press Quick

More information

Reference Guide. Adding a Generic File Store - Importing From a Local or Network ShipWorks Page 1 of 21

Reference Guide. Adding a Generic File Store - Importing From a Local or Network ShipWorks Page 1 of 21 Reference Guide Adding a Generic File Store - Importing From a Local or Network Folder Page 1 of 21 Adding a Generic File Store TABLE OF CONTENTS Background First Things First The Process Creating the

More information

Introduction to Linux for BlueBEAR. January

Introduction to Linux for BlueBEAR. January Introduction to Linux for BlueBEAR January 2019 http://intranet.birmingham.ac.uk/bear Overview Understanding of the BlueBEAR workflow Logging in to BlueBEAR Introduction to basic Linux commands Basic file

More information

Practical Linux Examples

Practical Linux Examples Practical Linux Examples Processing large text file Parallelization of independent tasks Qi Sun & Robert Bukowski Bioinformatics Facility Cornell University http://cbsu.tc.cornell.edu/lab/doc/linux_examples_slides.pdf

More information

Excel 2013 Intermediate

Excel 2013 Intermediate Instructor s Excel 2013 Tutorial 2 - Charts Excel 2013 Intermediate 103-124 Unit 2 - Charts Quick Links Chart Concepts Page EX197 EX199 EX200 Selecting Source Data Pages EX198 EX234 EX237 Creating a Chart

More information

Utilities. September 8, 2015

Utilities. September 8, 2015 Utilities September 8, 2015 Useful ideas Listing files and display text and binary files Copy, move, and remove files Search, sort, print, compare files Using pipes Compression and archiving Your fellow

More information

About these slides Prolog programming hints

About these slides Prolog programming hints About these slides Prolog programming hints COMP9414-2008 Semester 1 Ronnie Taib (ronniet@cse.unsw.edu.au)! Practical notes on using Prolog! Some hints for better code! LECTURE NOTES ALWAYS PREVAIL!! The

More information

Basics. I think that the later is better.

Basics.  I think that the later is better. Basics Before we take up shell scripting, let s review some of the basic features and syntax of the shell, specifically the major shells in the sh lineage. Command Editing If you like vi, put your shell

More information

Secret-Key Encryption Lab

Secret-Key Encryption Lab SEED Labs Secret-Key Encryption Lab 1 Secret-Key Encryption Lab Copyright 2018 Wenliang Du, Syracuse University. The development of this document was partially funded by the National Science Foundation

More information

A Brief Introduction to the Linux Shell for Data Science

A Brief Introduction to the Linux Shell for Data Science A Brief Introduction to the Linux Shell for Data Science Aris Anagnostopoulos 1 Introduction Here we will see a brief introduction of the Linux command line or shell as it is called. Linux is a Unix-like

More information

18-Sep CSCI 2132 Software Development Lecture 6: Links and Inodes. Faculty of Computer Science, Dalhousie University. Lecture 6 p.

18-Sep CSCI 2132 Software Development Lecture 6: Links and Inodes. Faculty of Computer Science, Dalhousie University. Lecture 6 p. Lecture 6 p.1 Faculty of Computer Science, Dalhousie University CSCI 2132 Software Development Lecture 6: Links and s 18-Sep-2017 Location: Goldberg CS 127 Time: 14:35 15:25 Instructor: Vlado Keselj Previous

More information

Bioinformatics. Computational Methods II: Sequence Analysis with Perl. George Bell WIBR Biocomputing Group

Bioinformatics. Computational Methods II: Sequence Analysis with Perl. George Bell WIBR Biocomputing Group Bioinformatics Computational Methods II: Sequence Analysis with Perl George Bell WIBR Biocomputing Group Sequence Analysis with Perl Introduction Input/output Variables Functions Control structures Arrays

More information

CSC209. Software Tools and Systems Programming. https://mcs.utm.utoronto.ca/~209

CSC209. Software Tools and Systems Programming. https://mcs.utm.utoronto.ca/~209 CSC209 Software Tools and Systems Programming https://mcs.utm.utoronto.ca/~209 What is this Course About? Software Tools Using them Building them Systems Programming Quirks of C The file system System

More information

Unix Guide. Meher Krishna Patel. Created on : Octorber, 2017 Last updated : December, More documents are freely available at PythonDSP

Unix Guide. Meher Krishna Patel. Created on : Octorber, 2017 Last updated : December, More documents are freely available at PythonDSP Unix Guide Meher Krishna Patel Created on : Octorber, 2017 Last updated : December, 2017 More documents are freely available at PythonDSP Table of contents Table of contents i 1 Unix commands 1 1.1 Unix

More information

Irish Collegiate Programming Competition Problem Set

Irish Collegiate Programming Competition Problem Set Irish Collegiate Programming Competition 24 Problem Set University College Cork ACM Student Chapter March 29, 24 Instructions Rules All mobile phones, laptops and other electronic devices must be powered

More information

To become familiar with array manipulation, searching, and sorting.

To become familiar with array manipulation, searching, and sorting. ELECTRICAL AND COMPUTER ENGINEERING 06-88-211: COMPUTER AIDED ANALYSIS LABORATORY EXPERIMENT #2: INTRODUCTION TO ARRAYS SID: OBJECTIVE: SECTIONS: Total Mark (out of 20): To become familiar with array manipulation,

More information