Command-Line Data Analysis INX_S17, Day 10,
|
|
- Kory Nash
- 6 years ago
- Views:
Transcription
1 Command-Line Data Analysis INX_S17, Day 10, Assignment 4 (quiz). sort, head, tail Learning Outcome(s): Use `sort` to build filtering pipelines for bioinformatics data Matthew Peterson, OSU CGRB, matthew@cgrb.oregonstate.edu Please do not redistribute outside of OSU; contains copyrighted materials.
2 Command-line Set 1
3 Bonus! (ok, not really ) 2
4 Review: fasta_stats A Python script from the book Generates statistics about a FASTA file it's supplied./fasta_stats Usage: fasta_dna_stats <fasta_file> This script is for informational purposes only, and requires that the input file be a DNA (As, Ts, Cs, and Gs) FASTA-formatted file../fasta_stats pz_cdnas_sample.fasta # Only 2 sequences in this FASTA file html 3
5 PZ example PZ ACAAA 5 unit:attta 10 pentanucleotide 2: GC content of 37.8% (vs. AT) 3: 486 base pairs (bp) long 4: Most common 5-bp sequence is ACAAA 5: This 5-bp sequence ACAAA appears 5 times 6: Longest perfect repeat sequence is ATTTA 7: and is 10bp long 8: caused by the pentanucleotide ATTTA appearing twice (ATTTAATTTA) 4
6 fasta_stats continued 7 th column contains the length (as an integer) of the longest perfect repeat in characters (bases) 5
7 fasta_stats question Q: What sequence (in pz_cdnas.fasta) contains the longest perfect repeat (column 7)? A: Sort the output by column 7 * PZ TTTCT 5 unit:ctttccg 14 heptanucleotide PZ TTATT 11 unit:tat 15 trinucleotide PZ AGCAA 6 unit:gag 6 trinucleotide PZ4990_P TTATA 5 unit:attata 12 hexanucleotide PZ AAAAA 11 unit:taat 8 tetranucleotide PZ TTTTT 19 unit:taatttt 14 heptanucleotide PZ ATATT 8 unit:gtata 10 pentanucleotide PZ TTTTT 18 unit:attt 8 tetranucleotide PZ TTTAA 6 unit:gct 6 trinucleotide * Filter the (#) header of fasta_stats : grep v # or grep 'unit:' 6
8 sort <file> or sort Lots of options! No options? It sorts all columns. By default sort sorts by dictionary order. Uses whitespace as column separator. 7
9 sort by key (column) sort by columns 2-4 ("conglomerated"), in dictionary order, and in reverse. ast_lines.html 8
10 sort Break ties by Break ties by sorting 1 st column in dictionary order. 9
11 sort Break further ties by Break further ties by sorting by 5 st column in numeric order. numeric is faster than general numeric, which can handle scientific notation (1e-6) 10
12 sort -unique Optional unique flag specifies if there are still ties to only show the first row. 11
13 fasta_stats example sort./fasta_stats pz_cdnas.fasta \ grep v '#' \ sort k7,7nr \ less S Sort on longest perfect repeat in column 7 in reverse, numeric order 12
14 fasta_stats sort output Longest perfect repeat is 94 base pairs Several ties of 18 base pair sequences 13
15 fasta_stats sort unique bp Show one sequence per base pair length: sort k7,7nr u 14
16 fasta_stats sort GC content Sort by GC content sort k7,7nr k2,2g 15
17 Pipelining (chaining) sorts together Sort by highest GC content (column 2) and then Re-sort by unique repeat length (column 7)./fasta_stats pz_cdnas.fasta \ grep v '#' \ sort k7,7nr k2,2gr \ sort k7,7nr u \ less S 16
18 Sort GC content, unique repeat length -s stable guarantees our 2 nd sort will not "undo" the the GC content sorting of our 1 st sort cat x sort k2,2 x sort s -k2,2 x D 2 A 2 D 2 B 2 B 2 B 2 A 2 D 2 A 2 See also: 17
19 Extract first or last lines head n <number> <file> tail n <number> <file> or head n <number> tail n <number> 18
20 First (top) 3 lines of our sort via head./fasta_stats pz_cdnas.fasta \ grep v '#' \ sort k7,7nr k2,2gr \ sort k7,7nr u \ head n3 19
21 Offset in tail Start printing with second row on (skip our top hit)./fasta_stats pz_cdnas.fasta \ grep v '#' \ sort k7,7nr k2,2gr \ sort k7,7nr u \ tail n +2 20
22 tail f Follow Constantly watch output appended to a file When would we use this? e.g., You have a BLAST job (submitted via SGE) that you know is going to take days to complete. You know that it's writing its stdout to a file into the log directory you specified (via SGE_Batch) You can watch the file's stdout "grow" (be appended) in real-time, e.g., tail -f MYJOB.o Ctrl-c to quit 21
23 sort head tail Command / Concept Review 22
Introduction to Unix/Linux INX_S17, Day 8,
Introduction to Unix/Linux INX_S17, Day 8, 2017-04-21 stdin, stdout, stderr, piping, iterative filtering, grep, cat, UUOC Learning Outcome(s): Redirect the standard output to the standard input stream
More informationCommand-Line Data Analysis INX_S17, Day 15,
Command-Line Data Analysis INX_S17, Day 15, 2017-05-12 General tool efficiency, tr, newlines, join, column Learning Outcome(s): Discuss the theory behind Unix/Linux tool efficiency, e.g., the reasons behind
More informationCommand Line and Python Introduction. Jennifer Helsby, Eric Potash Computation for Public Policy Lecture 2: January 7, 2016
Command Line and Python Introduction Jennifer Helsby, Eric Potash Computation for Public Policy Lecture 2: January 7, 2016 Today Assignment #1! Computer architecture Basic command line skills Python fundamentals
More informationAnthill User Group Meeting, 2015
Agenda Anthill User Group Meeting, 2015 1. Introduction to the machines and the networks 2. Accessing the machines 3. Command line introduction 4. Setting up your environment to see the queues 5. The different
More informationThese will serve as a basic guideline for read prep. This assumes you have demultiplexed Illumina data.
These will serve as a basic guideline for read prep. This assumes you have demultiplexed Illumina data. We have a few different choices for running jobs on DT2 we will explore both here. We need to alter
More informationIntroduction to Unix/Linux INX_S17, Day 6,
Introduction to Unix/Linux INX_S17, Day 6, 2017-04-17 Installing binaries, uname, hmmer and muscle, public data (wget and sftp) Learning Outcome(s): Install and run software from your home directory. Download
More informationWeek Overview. Simple filter commands: head, tail, cut, sort, tr, wc grep utility stdin, stdout, stderr Redirection and piping /dev/null file
ULI101 Week 05 Week Overview Simple filter commands: head, tail, cut, sort, tr, wc grep utility stdin, stdout, stderr Redirection and piping /dev/null file head and tail commands These commands display
More informationIntroduction to UNIX command-line II
Introduction to UNIX command-line II Boyce Thompson Institute 2017 Prashant Hosmani Class Content Terminal file system navigation Wildcards, shortcuts and special characters File permissions Compression
More informationITST Searching, Extracting & Archiving Data
ITST 1136 - Searching, Extracting & Archiving Data Name: Step 1 Sign into a Pi UN = pi PW = raspberry Step 2 - Grep - One of the most useful and versatile commands in a Linux terminal environment is the
More informationPython Working with files. May 4, 2017
Python Working with files May 4, 2017 So far, everything we have done in Python was using in-memory operations. After closing the Python interpreter or after the script was done, all our input and output
More informationChapter 6. Files and Exceptions I
Chapter 6 Files and Exceptions I What is a file? a file is a collection of data that is stored on secondary storage like a disk or a thumb drive accessing a file means establishing a connection between
More informationAssignment 6: Motif Finding Bio5488 2/24/17. Slide Credits: Nicole Rockweiler
Assignment 6: Motif Finding Bio5488 2/24/17 Slide Credits: Nicole Rockweiler Assignment 6: Motif finding Input Promoter sequences PWMs of DNA-binding proteins Goal Find putative binding sites in the sequences
More informationUnit 10: Data Structures CS 101, Fall 2018
Unit 10: Data Structures CS 101, Fall 2018 Learning Objectives After completing this unit, you should be able to: Define and give everyday examples of arrays, stacks, queues, and trees. Explain what a
More informationIntroduction p. 1 Who Should Read This Book? p. 1 What You Need to Know Before Reading This Book p. 2 How This Book Is Organized p.
Introduction p. 1 Who Should Read This Book? p. 1 What You Need to Know Before Reading This Book p. 2 How This Book Is Organized p. 2 Conventions Used in This Book p. 2 Introduction to UNIX p. 5 An Overview
More informationModule 8 Pipes, Redirection and REGEX
Module 8 Pipes, Redirection and REGEX Exam Objective 3.2 Searching and Extracting Data from Files Objective Summary Piping and redirection Partial POSIX Command Line and Redirection Command Line Pipes
More informationIntroduction to UNIX command-line
Introduction to UNIX command-line Boyce Thompson Institute March 17, 2015 Lukas Mueller & Noe Fernandez Class Content Terminal file system navigation Wildcards, shortcuts and special characters File permissions
More informationMore text file manipulation: sorting, cutting, pasting, joining, subsetting,
More text file manipulation: sorting, cutting, pasting, joining, subsetting, Laboratory of Genomics & Bioinformatics in Parasitology Department of Parasitology, ICB, USP Inverse cat Last week we learned
More informationShort Answer Questions (40 points)
CS 1112 Fall 2017 Test 2 Page 1 of 6 Short Answer Questions (40 points) 1. TRUE FALSE You have very legibly printed your name and email id below. Name = EMAILD = 2. TRUE FALSE On my honor, I pledge that
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature25174 Sequences of DNA primers used in this study. Primer Primer sequence code 498 GTCCAGATCTTGATTAAGAAAAATGAAGAAA F pegfp 499 GTCCAGATCTTGGTTAAGAAAAATGAAGAAA F pegfp 500 GTCCCTGCAGCCTAGAGGGTTAGG
More informationContents. Note: pay attention to where you are. Note: Plaintext version. Note: pay attention to where you are... 1 Note: Plaintext version...
Contents Note: pay attention to where you are........................................... 1 Note: Plaintext version................................................... 1 Hello World of the Bash shell 2 Accessing
More informationhttp://xkcd.com/208/ 1. Review of pipes 2. Regular expressions 3. sed 4. awk 5. Editing Files 6. Shell loops 7. Shell scripts cat seqs.fa >0! TGCAGGTATATCTATTAGCAGGTTTAATTTTGCCTGCACTTGGTTGGGTACATTATTTTAAGTGTATTTGACAAG!
More informationCOMS 6100 Class Notes 3
COMS 6100 Class Notes 3 Daniel Solus September 1, 2016 1 General Remarks The class was split into two main sections. We finished our introduction to Linux commands by reviewing Linux commands I and II
More informationHashing. 1. Introduction. 2. Direct-address tables. CmSc 250 Introduction to Algorithms
Hashing CmSc 250 Introduction to Algorithms 1. Introduction Hashing is a method of storing elements in a table in a way that reduces the time for search. Elements are assumed to be records with several
More informationLinux Introduction to Linux
Linux Introduction to Linux Most computational biologists use either Apple Macs or Linux machines. There are a couple of reasons for this: * Much of the software is free * Many of the tools require a command
More informationCS 25200: Systems Programming. Lecture 10: Shell Scripting in Bash
CS 25200: Systems Programming Lecture 10: Shell Scripting in Bash Dr. Jef Turkstra 2018 Dr. Jeffrey A. Turkstra 1 Lecture 10 Getting started with Bash Data types Reading and writing Control loops Decision
More informationhttp://xkcd.com/208/ 1. Review of pipes 2. Regular expressions 3. sed 4. Editing Files 5. Shell loops 6. Shell scripts cat seqs.fa >0! TGCAGGTATATCTATTAGCAGGTTTAATTTTGCCTGCACTTGGTTGGGTACATTATTTTAAGTGTATTTGACAAG!
More informationWorking With Unix. Scott A. Handley* September 15, *Adapted from UNIX introduction material created by Dr. Julian Catchen
Working With Unix Scott A. Handley* September 15, 2014 *Adapted from UNIX introduction material created by Dr. Julian Catchen What is UNIX? An operating system (OS) Designed to be multiuser and multitasking
More informationOverview.
Overview day one 0. getting set up 1. text output and manipulation day two 2. reading and writing files 3. lists and loops day three 4. writing functions 5. conditional statements day four today day six
More informationCloud Computing and Unix: An Introduction. Dr. Sophie Shaw University of Aberdeen, UK
Cloud Computing and Unix: An Introduction Dr. Sophie Shaw University of Aberdeen, UK s.shaw@abdn.ac.uk Aberdeen London Exeter What We re Going To Do Why Unix? Cloud Computing Connecting to AWS Introduction
More informationCloud Computing and Unix: An Introduction. Dr. Sophie Shaw University of Aberdeen, UK
Cloud Computing and Unix: An Introduction Dr. Sophie Shaw University of Aberdeen, UK s.shaw@abdn.ac.uk Aberdeen London Exeter What We re Going To Do Why Unix? Cloud Computing Connecting to AWS Introduction
More informationWorking with files. File Reading and Writing. Reading and writing. Opening a file
Working with files File Reading and Writing Reading get info into your program Parsing processing file contents Writing get info out of your program MBV-INFx410 Fall 2014 Reading and writing Three-step
More informationBioinformatics Programming. EE, NCKU Tien-Hao Chang (Darby Chang)
Bioinformatics Programming EE, NCKU Tien-Hao Chang (Darby Chang) 1 Regular Expression 2 http://rp1.monday.vip.tw1.yahoo.net/res/gdsale/st_pic/0469/st-469571-1.jpg 3 Text patterns and matches A regular
More informationC++ Programming. Final Project. Implementing the Smith-Waterman Algorithm Software Engineering, EIM-I Philipp Schubert Version 1.1.
C++ Programming Implementing the Smith-Waterman Algorithm Software Engineering, EIM-I Philipp Schubert Version 1.1 January 26, 2018 This project is mandatory in order to pass the course and to obtain the
More informationUnix Essentials. BaRC Hot Topics Bioinformatics and Research Computing Whitehead Institute October 12 th
Unix Essentials BaRC Hot Topics Bioinformatics and Research Computing Whitehead Institute October 12 th 2016 http://barc.wi.mit.edu/hot_topics/ 1 Outline Unix overview Logging in to tak Directory structure
More informationManaging Your Biological Data with Python
Chapman & Hall/CRC Mathematical and Computational Biology Series Managing Your Biological Data with Python Ailegra Via Kristian Rother Anna Tramontano CRC Press Taylor & Francis Group Boca Raton London
More informationbistro Documentation Release dev Philippe Veber
bistro Documentation Release dev Philippe Veber Oct 10, 2018 Contents 1 Getting started 1 1.1 Installation................................................ 1 1.2 A simple example............................................
More informationCS 1044 Program 6 Summer I dimension ??????
Managing a simple array: Validating Array Indices Most interesting programs deal with considerable amounts of data, and must store much, or all, of that data on one time. The simplest effective means for
More informationCSE 303 Midterm Exam
CSE 303 Midterm Exam October 29, 2008 Name Sample Solution The exam is closed book, except that you may have a single page of hand written notes for reference. If you don t remember the details of how
More informationCS ) PROGRAMMING ASSIGNMENT 11:00 PM 11:00 PM
CS3114 (Fall 2017) PROGRAMMING ASSIGNMENT #4 Due Thursday, December 7 th @ 11:00 PM for 100 points Due Tuesday, December 5 th @ 11:00 PM for 10 point bonus Last updated: 11/13/2017 Assignment: Update:
More informationGenomes On The Cloud GotCloud. University of Michigan Center for Statistical Genetics Mary Kate Wing Goo Jun
Genomes On The Cloud GotCloud University of Michigan Center for Statistical Genetics Mary Kate Wing Goo Jun Friday, March 8, 2013 Why GotCloud? Connects sequence analysis tools together Alignment, quality
More informationReading and manipulating files
Reading and manipulating files Goals By the end of this lesson you will be able to Read files without using text editors Access specific parts of files Count the number of words and lines in a file Sort
More informationSequence Analysis with Perl. Unix, Perl and BioPerl. Why Perl? Objectives. A first Perl program. Perl Input/Output. II: Sequence Analysis with Perl
Sequence Analysis with Perl Unix, Perl and BioPerl II: Sequence Analysis with Perl George Bell, Ph.D. WIBR Bioinformatics and Research Computing Introduction Input/output Variables Functions Control structures
More informationEssential Skills for Bioinformatics: Unix/Linux
Essential Skills for Bioinformatics: Unix/Linux WORKING WITH COMPRESSED DATA Overview Data compression, the process of condensing data so that it takes up less space (on disk drives, in memory, or across
More informationMerge Conflicts p. 92 More GitHub Workflows: Forking and Pull Requests p. 97 Using Git to Make Life Easier: Working with Past Commits p.
Preface p. xiii Ideology: Data Skills for Robust and Reproducible Bioinformatics How to Learn Bioinformatics p. 1 Why Bioinformatics? Biology's Growing Data p. 1 Learning Data Skills to Learn Bioinformatics
More informationContents Systems of Linear Equations and Determinants
Contents 6. Systems of Linear Equations and Determinants 2 Example 6.9................................. 2 Example 6.10................................ 3 6.5 Determinants................................
More informationInterim Standards New Directions Workbook One EASI Tool Excel Support Document Contents:
Interim Standards New Directions Workbook One EASI Tool Excel Support Document Contents: 1. EASI Tool Template.... 2 2. Accessing and Saving the Tool Template.... 2 3. Screen View... 3 4. Comments/Guidance
More informationUnix, Perl and BioPerl
Unix, Perl and BioPerl II: Sequence Analysis with Perl George Bell, Ph.D. WIBR Bioinformatics and Research Computing Sequence Analysis with Perl Introduction Input/output Variables Functions Control structures
More informationMolecular Index Error correction
Molecular Index Error correction Overview: This section provides directions for generating SSCS (Single Strand Consensus Sequence) reads and trimming molecular indexes from raw fastq files. Learning Objectives:
More informationAn Introduction to Python
An Introduction to Python Day 3 Renaud Dessalles dessalles@ucla.edu Writing Modules Combining what we ve learnt Yesterday we learnt a lot of different bits of Python. Let s summarize that knowledge by
More informationCallManager Server: Use PsList to Troubleshoot a Memory Leak Problem
CallManager Server: Use PsList to Troubleshoot a Memory Leak Problem Document ID: 66967 Contents Introduction Prerequisites Requirements Components Used Conventions Background Usage Setup PsList on the
More informationRecap From Last Time:
Recap From Last Time: BGGN 213 Working with UNIX Barry Grant http://thegrantlab.org/bggn213 Motivation: Why we use UNIX for bioinformatics. Modularity, Programmability, Infrastructure, Reliability and
More informationBGGN 213 Working with UNIX Barry Grant
BGGN 213 Working with UNIX Barry Grant http://thegrantlab.org/bggn213 Recap From Last Time: Motivation: Why we use UNIX for bioinformatics. Modularity, Programmability, Infrastructure, Reliability and
More informationAdministration CS 412/413. Instruction ordering issues. Simplified architecture model. Examples. Impact of instruction ordering
dministration CS 1/13 Introduction to Compilers and Translators ndrew Myers Cornell University P due in 1 week Optional reading: Muchnick 17 Lecture 30: Instruction scheduling 1 pril 00 1 Impact of instruction
More informationDictionary. Dictionary. stores key-value pairs. Find(k) Insert(k, v) Delete(k) List O(n) O(1) O(n) Sorted Array O(log n) O(n) O(n)
Hash-Tables Introduction Dictionary Dictionary stores key-value pairs Find(k) Insert(k, v) Delete(k) List O(n) O(1) O(n) Sorted Array O(log n) O(n) O(n) Balanced BST O(log n) O(log n) O(log n) Dictionary
More informationCSC209H Lecture 1. Dan Zingaro. January 7, 2015
CSC209H Lecture 1 Dan Zingaro January 7, 2015 Welcome! Welcome to CSC209 Comments or questions during class? Let me know! Topics: shell and Unix, pipes and filters, C programming, processes, system calls,
More information7.2. The Standard Normal Distribution
7.2 The Standard Normal Distribution Standard Normal The standard normal curve is the one with mean μ = 0 and standard deviation σ = 1 We have related the general normal random variable to the standard
More informationECE 461 Internetworking Fall Quiz 1
ECE 461 Internetworking Fall 2013 Quiz 1 Instructions (read carefully): The time for this quiz is 50 minutes. This is a closed book and closed notes in-class exam. Non-programmable (Type 2) calculators
More informationUNIX, GNU/Linux and simple tools for data manipulation
UNIX, GNU/Linux and simple tools for data manipulation Dr Jean-Baka DOMELEVO ENTFELLNER BecA-ILRI Hub Basic Bioinformatics Training Workshop @ILRI Addis Ababa Wednesday December 13 th 2017 Dr Jean-Baka
More informationIntroduction To. Barry Grant
Introduction To Barry Grant bjgrant@umich.edu http://thegrantlab.org Working with Unix How do we actually use Unix? Inspecting text files less - visualize a text file: use arrow keys page down/page up
More informationLab 4: Bash Scripting
Lab 4: Bash Scripting February 20, 2018 Introduction This lab will give you some experience writing bash scripts. You will need to sign in to https://git-classes. mst.edu and git clone the repository for
More informationSTORING DATA: DISK AND FILES
STORING DATA: DISK AND FILES CS 564- Fall 2016 ACKs: Dan Suciu, Jignesh Patel, AnHai Doan MANAGING DISK SPACE The disk space is organized into files Files are made up of pages s contain records 2 FILE
More information1. Enter the Order Number in the smartdocs search field, then press the Enter key on your keyboard while the cursor is still blinking in the field.
Creating a smartbinder Presentation Overview: This job aid shows you how to create a smartbinder Presentation in smartdocs. A smartbinder is an HTML document that creates a Table of Contents with links
More informationUser Preferences & Security Snapshots
App Number: 010011 User Preferences & Security Snapshots Last Updated 9 th January 2013 Powered by: AppsForGreentree.com 2013 1 Table of Contents Features... 3 Important Notes... 3 Other Requirements...
More informationSOLiD GFF File Format
SOLiD GFF File Format 1 Introduction The GFF file is a text based repository and contains data and analysis results; colorspace calls, quality values (QV) and variant annotations. The inputs to the GFF
More informationDepartment of Computer Science and Technology
M.Sc. (CA) (2 nd Semester) 040020202 : UNIX Internals and Shell Programming Teaching Schedule Objective: To acquaint the students with the basic internal structure & operations of UNIX operating system,
More informationLab #2 Physics 91SI Spring 2013
Lab #2 Physics 91SI Spring 2013 Objective: Some more experience with advanced UNIX concepts, such as redirecting and piping. You will also explore the usefulness of Mercurial version control and how to
More informationCPSC 217 Midterm (Python 3 version)
CPSC 217 Midterm (Python 3 version) Duration: 50 minutes 6 March 2009 This exam has 61 questions and 11 pages. This exam is closed book. No notes, books, calculators or electronic devices, or other assistance
More informationThe Big Python Guide
The Big Python Guide Big Python Guide - Page 1 Contents Input, Output and Variables........ 3 Selection (if...then)......... 4 Iteration (for loops)......... 5 Iteration (while loops)........ 6 String
More informationLecture 3. Essential skills for bioinformatics: Unix/Linux
Lecture 3 Essential skills for bioinformatics: Unix/Linux RETRIEVING DATA Overview Whether downloading large sequencing datasets or accessing a web application hundreds of times to download specific files,
More informationWorking with files. File Reading and Writing. Reading and writing. Opening a file
Working with files File Reading and Writing Reading get info into your program Parsing processing file contents Writing get info out of your program MBV-INFx410 Fall 2015 Reading and writing Three-step
More informationUnix basics exercise MBV-INFX410
Unix basics exercise MBV-INFX410 In order to start this exercise, you need to be logged in on a UNIX computer with a terminal window open on your computer. It is best if you are logged in on freebee.abel.uio.no.
More informationAdd Bullets and Numbers
. Lesson 5: Adding Bullets and Numbers, If you have lists of data, you may want to bullet or number them. When using Microsoft Word, bulleting and numbering are easy. The first part of this lesson teaches
More informationLAB 8 (Aug 4/5) Unix Utilities
Aug 4/5 Due: Aug 11 in class Name: CSE number: LAB 8 (Aug 4/5) Unix Utilities The purpose of this lab exercise is for you to get some hands-on experience on using some fundamental Unix utilities (commands).
More informationBinary, Hexadecimal and Octal number system
Binary, Hexadecimal and Octal number system Binary, hexadecimal, and octal refer to different number systems. The one that we typically use is called decimal. These number systems refer to the number of
More informationLecture 11: Packet forwarding
Lecture 11: Packet forwarding Anirudh Sivaraman 2017/10/23 This week we ll talk about the data plane. Recall that the routing layer broadly consists of two parts: (1) the control plane that computes routes
More information1. BASICS OF PYTHON. JHU Physics & Astronomy Python Workshop Lecturer: Mubdi Rahman
1. BASICS OF PYTHON JHU Physics & Astronomy Python Workshop 2017 Lecturer: Mubdi Rahman HOW IS THIS WORKSHOP GOING TO WORK? We will be going over all the basics you need to get started and get productive
More informationDecision Logic: if, if else, switch, Boolean conditions and variables
CS 1044 roject 4 Summer I 2007 Decision Logic: if, if else, switch, Boolean conditions and variables This programming assignment uses many of the ideas presented in sections 3 through 5 of the course notes,
More informationCS S-02 Python 1. Most python references use examples involving spam, parrots (deceased), silly walks, and the like
CS662-2013S-02 Python 1 02-0: Python Name python comes from Monte Python s Flying Circus Most python references use examples involving spam, parrots (deceased), silly walks, and the like Interpreted language
More informationUNIX Essentials Featuring Solaris 10 Op System
A Active Window... 7:11 Application Development Tools... 7:7 Application Manager... 7:4 Architectures - Supported - UNIX... 1:13 Arithmetic Expansion... 9:10 B Background Processing... 3:14 Background
More informationLAB 8 (Aug 4/5) Unix Utilities
Aug 4/5 Due: Aug 11 in class Name: CSE number: LAB 8 (Aug 4/5) Unix Utilities The purpose of this lab exercise is for you to get some hands-on experience on using some fundamental Unix utilities (commands).
More informationWildcards and Regular Expressions
CSCI 2132: Software Development Wildcards and Regular Expressions Norbert Zeh Faculty of Computer Science Dalhousie University Winter 2019 Searching Problem: Find all files whose names match a certain
More informationExcel Level Three. You can also go the Format, Column, Width menu to enter the new width of the column.
Introduction Excel Level Three This workshop shows you how to change column and rows, insert and delete columns and rows, how and what to print, and setting up to print your documents. Contents Introduction
More informationsottotitolo A.A. 2016/17 Federico Reghenzani, Alessandro Barenghi
Titolo presentazione Piattaforme Software per la Rete sottotitolo BASH Scripting Milano, XX mese 20XX A.A. 2016/17, Alessandro Barenghi Outline 1) Introduction to BASH 2) Helper commands 3) Control Flow
More informationTOTAL ECLIPSE POCKET GUIDE CONTENTS
TOTAL ECLIPSE POCKET GUIDE CONTENTS Stentura SRT Clear Memory... 1 Stentura 400SRT Light Indicator Table... 1 Flush Delay... 1 Read In, Translate Notes, & Separate Files... 2 How to Create a Realtime File...
More informationCOMPARATIVE MICROBIAL GENOMICS ANALYSIS WORKSHOP. Exercise 2: Predicting Protein-encoding Genes, BlastMatrix, BlastAtlas
COMPARATIVE MICROBIAL GENOMICS ANALYSIS WORKSHOP Exercise 2: Predicting Protein-encoding Genes, BlastMatrix, BlastAtlas First of all connect once again to the CBS system: Open ssh shell client. Press Quick
More informationReference Guide. Adding a Generic File Store - Importing From a Local or Network ShipWorks Page 1 of 21
Reference Guide Adding a Generic File Store - Importing From a Local or Network Folder Page 1 of 21 Adding a Generic File Store TABLE OF CONTENTS Background First Things First The Process Creating the
More informationIntroduction to Linux for BlueBEAR. January
Introduction to Linux for BlueBEAR January 2019 http://intranet.birmingham.ac.uk/bear Overview Understanding of the BlueBEAR workflow Logging in to BlueBEAR Introduction to basic Linux commands Basic file
More informationPractical Linux Examples
Practical Linux Examples Processing large text file Parallelization of independent tasks Qi Sun & Robert Bukowski Bioinformatics Facility Cornell University http://cbsu.tc.cornell.edu/lab/doc/linux_examples_slides.pdf
More informationExcel 2013 Intermediate
Instructor s Excel 2013 Tutorial 2 - Charts Excel 2013 Intermediate 103-124 Unit 2 - Charts Quick Links Chart Concepts Page EX197 EX199 EX200 Selecting Source Data Pages EX198 EX234 EX237 Creating a Chart
More informationUtilities. September 8, 2015
Utilities September 8, 2015 Useful ideas Listing files and display text and binary files Copy, move, and remove files Search, sort, print, compare files Using pipes Compression and archiving Your fellow
More informationAbout these slides Prolog programming hints
About these slides Prolog programming hints COMP9414-2008 Semester 1 Ronnie Taib (ronniet@cse.unsw.edu.au)! Practical notes on using Prolog! Some hints for better code! LECTURE NOTES ALWAYS PREVAIL!! The
More informationBasics. I think that the later is better.
Basics Before we take up shell scripting, let s review some of the basic features and syntax of the shell, specifically the major shells in the sh lineage. Command Editing If you like vi, put your shell
More informationSecret-Key Encryption Lab
SEED Labs Secret-Key Encryption Lab 1 Secret-Key Encryption Lab Copyright 2018 Wenliang Du, Syracuse University. The development of this document was partially funded by the National Science Foundation
More informationA Brief Introduction to the Linux Shell for Data Science
A Brief Introduction to the Linux Shell for Data Science Aris Anagnostopoulos 1 Introduction Here we will see a brief introduction of the Linux command line or shell as it is called. Linux is a Unix-like
More information18-Sep CSCI 2132 Software Development Lecture 6: Links and Inodes. Faculty of Computer Science, Dalhousie University. Lecture 6 p.
Lecture 6 p.1 Faculty of Computer Science, Dalhousie University CSCI 2132 Software Development Lecture 6: Links and s 18-Sep-2017 Location: Goldberg CS 127 Time: 14:35 15:25 Instructor: Vlado Keselj Previous
More informationBioinformatics. Computational Methods II: Sequence Analysis with Perl. George Bell WIBR Biocomputing Group
Bioinformatics Computational Methods II: Sequence Analysis with Perl George Bell WIBR Biocomputing Group Sequence Analysis with Perl Introduction Input/output Variables Functions Control structures Arrays
More informationCSC209. Software Tools and Systems Programming. https://mcs.utm.utoronto.ca/~209
CSC209 Software Tools and Systems Programming https://mcs.utm.utoronto.ca/~209 What is this Course About? Software Tools Using them Building them Systems Programming Quirks of C The file system System
More informationUnix Guide. Meher Krishna Patel. Created on : Octorber, 2017 Last updated : December, More documents are freely available at PythonDSP
Unix Guide Meher Krishna Patel Created on : Octorber, 2017 Last updated : December, 2017 More documents are freely available at PythonDSP Table of contents Table of contents i 1 Unix commands 1 1.1 Unix
More informationIrish Collegiate Programming Competition Problem Set
Irish Collegiate Programming Competition 24 Problem Set University College Cork ACM Student Chapter March 29, 24 Instructions Rules All mobile phones, laptops and other electronic devices must be powered
More informationTo become familiar with array manipulation, searching, and sorting.
ELECTRICAL AND COMPUTER ENGINEERING 06-88-211: COMPUTER AIDED ANALYSIS LABORATORY EXPERIMENT #2: INTRODUCTION TO ARRAYS SID: OBJECTIVE: SECTIONS: Total Mark (out of 20): To become familiar with array manipulation,
More information