Command-Line Data Analysis INX_S17, Day 15,
|
|
- Madeleine Jefferson
- 5 years ago
- Views:
Transcription
1 Command-Line Data Analysis INX_S17, Day 15, General tool efficiency, tr, newlines, join, column Learning Outcome(s): Discuss the theory behind Unix/Linux tool efficiency, e.g., the reasons behind their design from the 1970s and 1980s, and identify these design characteristics in common tools, e.g., cat, grep, awk, sed, and pipes. Matthew Peterson, OSU CGRB, Please do not redistribute outside of OSU; contains copyrighted materials.
2 A note on efficiency The programs we use were written in the 1970s, e.g., sed, awk, sort, etc. Brilliant minds made sure these programs were: efficient, lean, and mean! Why? 1
3 Cray-1 Supercomputer A top of the line 1976 Supercomputer processor ran at 80 Mhz at a cost of $8.86 million. Author: Clemens PFEIFFER 2
4 Cray-2 Supercomputer A top of the line 1985 Supercomputer processor ran at 125 Mhz at a cost of $16 million. 3
5 Apple Watch An Apple Watch 1 (~$269) running at 520 Mhz is equal in processing capacity to two Cray 2s. = Author: Justin14 4
6 Pipe example Write Buffer Read cat fruit.txt grep apple Pipe sets up a small buffer in-between programs When the buffer is full it pauses cat When the buffer is empty it pauses grep If the buffer is ½ full both cat and grep can run simultaneously on different CPUs! 5
7 top example If you re running a big pipeline you ll see multiple programs will be running at the sametime, e.g., Program CPU cat 30% grep 20% awk Show zcat example of Illumina FASTQ 6
8 Class activity: Counts of counts!
9 Class activity: The fruit pipeline
10 Well done! Observations Most of the participants needed very little "working memory" Not much storage space was used by the buffers Many participants could be working simultaneously, but Anyone after sort would have had to wait! 9
11 tr Translates sets of characters tr '<set1>' '<set2>' <file> or... tr '<set1>' '<set2> Example: Change al T s to A s and vice-versa echo "ATTTTTA" tr 'TA' 'AT' TAAAAAT 10
12 tr Dealing with newlines \n The newline is represented in Linux by a special character '\n' You cannot see this character other than it wrapping the text to the next, new line. We can use tr to remove all newlines, e.g., cat lines.txt Line 1 Line 2 Line 3 cat lines.txt tr \n # 11
13 tr To reflow a FASTA file FASTA files often have their sequences span lines after each header, e.g., pz_cdnas.fasta Say we wanted to extract all sequences from the pz_cdnas.fasta that had in its header line (>) an nreads greater than 5. There s a general pattern ( trick ) for this using tr, which can be applied in other use cases. 12
14 tr reflow pattern 1) Check the file for an unused character, e.g., or the tab character ('\t'); verify first with grep! 2) Replace all newlines e.g., tr '\n' '@' 3) Replace start of records ('>') with '\n>' sed r 's/>/\n>/g' # 1 seq/line 13
15 tr reflow pattern (continued) 4) Use grep/awk/sed to modify lines of interest sed -r 's/=/ /1' \ awk '{if($3 > 5) {print $0}}' 5) Reformat back to FASTA (Header line + Seq line) tr '@' '\n' # Could also use sed 6) The previous reformatting will have introduced blank lines, which can be removed, e.g., awk '{if(nf > 0) print $0} 14
16 join files on a common column join -1 <key column in file1> -2 <key column in file2> <file1> <file2> Say we have two output files that share a similar key (identifier), e.g., # blastx pz_cdnas.fasta vs. Yeast ORF, outfmt 6 p450s_blastp_yeast_top1.txt # fasta_stats of pz_cdnas.fasta pz_stats.table 15
17 join files on a common column join -1 <key column in file1> -2 <key column in file2> <file1> <file2> Merges two row/column text files based on lines with similar values in a specified key column. By default, join only outputs rows where data is present in both files. Both input files are required to be similarly sorted (either ascending or descending) on the key columns. 16
18 join BLAST and fasta_stats data Say we have two output files that share a similar key (identifier) in this case the sequence identifier # blastx pz_cdnas.fasta vs. Yeast ORF, outfmt 6 p450s_blastp_yeast_top1.txt # fasta_stats of pz_cdnas.fasta pz_stats.table 17
19 join First sort the files Say we have two output files that share a similar key (identifier) in this case the sequence identifier cat pz_blastx_yeast_top1.txt \ > sort -k1,1d > \ > pz_blastx_yeast_top1.sorted.txt cat pz_stats.table \ > sort -k1,1d > \ > pz_stats.sorted.table 18
20 The output contains: join Sorted output All of the columns for the first file, followed by All of the columns of the second file Without the key column Separated by single spaces join \ pz_stats.sorted.table \ pz_blastx_yeast_top1.sorted.txt 19
21 BLAST matches > 50% GC content awk '{if($1 > 0.5) print $0}' With everything separated by spaces it's still hard to read (for humans) 20
22 join Limitation #1 If any entries in the key columns are repeated, the output will contain a row for each matching pair of keys. 21
23 join Limitation #2 Both input files must be sorted. If they are not sorted join will produce a warning. 22
24 join Limitation #3 join does not easily produce a Full outer join By default it produces an Inner join Python and R excel at these use cases 23
25 column Reformatting column -t <file> or... column -t Reformats whitespace separated row/column input so that the output is human readable Done by replacing one or more spaces and tabs by an appropriate number of spaces so that columns are visually aligned. 24
Command-Line Data Analysis INX_S17, Day 10,
Command-Line Data Analysis INX_S17, Day 10, 2017-05-01 Assignment 4 (quiz). sort, head, tail Learning Outcome(s): Use `sort` to build filtering pipelines for bioinformatics data Matthew Peterson, OSU CGRB,
More informationIntroduction to Unix/Linux INX_S17, Day 8,
Introduction to Unix/Linux INX_S17, Day 8, 2017-04-21 stdin, stdout, stderr, piping, iterative filtering, grep, cat, UUOC Learning Outcome(s): Redirect the standard output to the standard input stream
More informationhttp://xkcd.com/208/ 1. Review of pipes 2. Regular expressions 3. sed 4. awk 5. Editing Files 6. Shell loops 7. Shell scripts cat seqs.fa >0! TGCAGGTATATCTATTAGCAGGTTTAATTTTGCCTGCACTTGGTTGGGTACATTATTTTAAGTGTATTTGACAAG!
More informationUnit 3 Fill Series, Functions, Sorting
Unit 3 Fill Series, Functions, Sorting Fill enter repetitive values or formulas in an indicated direction Using the Fill command is much faster than using copy and paste you can do entire operation in
More informationUnit 3 Functions Review, Fill Series, Sorting, Merge & Center
Unit 3 Functions Review, Fill Series, Sorting, Merge & Center Function built-in formula that performs simple or complex calculations automatically names a function instead of using operators (+, -, *,
More informationEssential Skills for Bioinformatics: Unix/Linux
Essential Skills for Bioinformatics: Unix/Linux WORKING WITH COMPRESSED DATA Overview Data compression, the process of condensing data so that it takes up less space (on disk drives, in memory, or across
More informationhttp://xkcd.com/208/ 1. Review of pipes 2. Regular expressions 3. sed 4. Editing Files 5. Shell loops 6. Shell scripts cat seqs.fa >0! TGCAGGTATATCTATTAGCAGGTTTAATTTTGCCTGCACTTGGTTGGGTACATTATTTTAAGTGTATTTGACAAG!
More informationhttp://xkcd.com/208/ cat seqs.fa >0 TGCAGGTATATCTATTAGCAGGTTTAATTTTGCCTGCACTTGGTTGGGTACATTATTTTAAGTGTATTTGACAAG >1 TGCAGGTTGTTGTTACTCAGGTCCAGTTCTCTGAGACTGGAGGACTGGGAGCTGAGAACTGAGGACAGAGCTTCA >2 TGCAGGGCCGGTCCAAGGCTGCATGAGGCCTGGGGCAGAATCTGACCTAGGGGCCCCTCTTGCTGCTAAAACCAT
More informationSTATS Data Analysis using Python. Lecture 15: Advanced Command Line
STATS 700-002 Data Analysis using Python Lecture 15: Advanced Command Line Why UNIX/Linux? As a data scientist, you will spend most of your time dealing with data Data sets never arrive ready to analyze
More informationLecture 3. Essential skills for bioinformatics: Unix/Linux
Lecture 3 Essential skills for bioinformatics: Unix/Linux RETRIEVING DATA Overview Whether downloading large sequencing datasets or accessing a web application hundreds of times to download specific files,
More informationIntroduction To Linux. Rob Thomas - ACRC
Introduction To Linux Rob Thomas - ACRC What Is Linux A free Operating System based on UNIX (TM) An operating system originating at Bell Labs. circa 1969 in the USA More of this later... Why Linux? Free
More informationGenomic Files. University of Massachusetts Medical School. October, 2015
.. Genomic Files University of Massachusetts Medical School October, 2015 2 / 55. A Typical Deep-Sequencing Workflow Samples Fastq Files Fastq Files Sam / Bam Files Various files Deep Sequencing Further
More information7. Apply a Range of Table Features
Word Processing 5N1358 7. Apply a Range of Table Features Contents Apply a Range of Table Features Including: 1. Creating Tables... 1 2. Resizing... 4 3. Merging Cells... 5 4. Inserting or Deleting columns
More informationGenomic Files. University of Massachusetts Medical School. October, 2014
.. Genomic Files University of Massachusetts Medical School October, 2014 2 / 39. A Typical Deep-Sequencing Workflow Samples Fastq Files Fastq Files Sam / Bam Files Various files Deep Sequencing Further
More information1. Position your mouse over the column line in the column heading so that the white cross becomes a double arrow.
Excel 2010 Modifying Columns, Rows, and Cells Introduction Page 1 When you open a new, blank workbook, the cells are set to a default size.you do have the ability to modify cells, and to insert and delete
More informationAdvanced training. Linux components Command shell. LiLux a.s.b.l.
Advanced training Linux components Command shell LiLux a.s.b.l. alexw@linux.lu Kernel Interface between devices and hardware Monolithic kernel Micro kernel Supports dynamics loading of modules Support
More informationhttp://xkcd.com/208/ 1. Computer Hardware 2. Review of pipes 3. Regular expressions 4. sed 5. awk 6. Editing Files 7. Shell loops 8. Shell scripts Hardware http://www.theverge.com/2011/11/23/2582677/thailand-flood-seagate-hard-drive-shortage
More informationIB047. Unix Text Tools. Pavel Rychlý Mar 3.
Unix Text Tools pary@fi.muni.cz 2014 Mar 3 Unix Text Tools Tradition Unix has tools for text processing from the very beginning (1970s) Small, simple tools, each tool doing only one operation Pipe (pipeline):
More informationMicrosoft Office Illustrated. Using Tables
Microsoft Office 2007 - Illustrated Using Tables Objectives Plan a Table Create a Table Add Table Data Find and Replace Table Data Delete Table Data 2 Objectives Sort Table Data Use Formulas in a Table
More informationLesson 15 Working with Tables
Working with Tables Computer Literacy BASICS: A Comprehensive Guide to IC 3, 4 th Edition 1 Objectives Create a table and insert text. Insert and delete rows and columns. Adjust column width and row height.
More informationLesson 15 Working with Tables
Working with Tables Computer Literacy BASICS: A Comprehensive Guide to IC 3, 5 th Edition 1 Objectives Create a table and insert text. Insert and delete rows and columns. Adjust column width and row height.
More informationPractical: Using LAST and MEGAN to get a quick view of a metagenome
Practical: Using LAST and MEGAN to get a quick view of a metagenome Daniel Lundin Linneaeus University November 14, 2014 Daniel Lundin (LNU) LAST+MEGAN practical November 14, 2014 1 / 25 A GIT archive
More informationLecture 5. Essential skills for bioinformatics: Unix/Linux
Lecture 5 Essential skills for bioinformatics: Unix/Linux UNIX DATA TOOLS Text processing with awk We have illustrated two ways awk can come in handy: Filtering data using rules that can combine regular
More informationls /data/atrnaseq/ egrep "(fastq fasta fq fa)\.gz" ls /data/atrnaseq/ egrep "(cn ts)[1-3]ln[^3a-za-z]\."
Command line tools - bash, awk and sed We can only explore a small fraction of the capabilities of the bash shell and command-line utilities in Linux during this course. An entire course could be taught
More information5/8/2012. Exploring Utilities Chapter 5
Exploring Utilities Chapter 5 Examining the contents of files. Working with the cut and paste feature. Formatting output with the column utility. Searching for lines containing a target string with grep.
More informationUNIX, GNU/Linux and simple tools for data manipulation
UNIX, GNU/Linux and simple tools for data manipulation Dr Jean-Baka DOMELEVO ENTFELLNER BecA-ILRI Hub Basic Bioinformatics Training Workshop @ILRI Addis Ababa Wednesday December 13 th 2017 Dr Jean-Baka
More informationLinux Introduction to Linux
Linux Introduction to Linux Most computational biologists use either Apple Macs or Linux machines. There are a couple of reasons for this: * Much of the software is free * Many of the tools require a command
More informationCreating dependent menus with Moodle Database activity. William Lu
Creating dependent menus with Moodle Database activity William Lu Hello, everyone My name is William. In this session, I will show you how to create a dependent menu with Moodle Database activity. 2 Sometimes,
More informationUser Manual Mail Merge
User Manual Mail Merge Version: 1.0 Mail Merge Date: 27-08-2013 How to print letters using Mail Merge You can use Mail Merge to create a series of documents, such as a standard letter that you want to
More information-Using Excel- *The columns are marked by letters, the rows by numbers. For example, A1 designates row A, column 1.
-Using Excel- Note: The version of Excel that you are using might vary slightly from this handout. This is for Office 2004 (Mac). If you are using a different version, while things may look slightly different,
More information1. What tool do you use to check which cells are referenced in formulas that are assigned to the active cell?
Q75-100 1. What tool do you use to check which cells are referenced in formulas that are assigned to the active cell? A. Reference Finder B. Range Finder C. Reference Checker D. Address Finder B. Range
More informationUseful commands in Linux and other tools for quality control. Ignacio Aguilar INIA Uruguay
Useful commands in Linux and other tools for quality control Ignacio Aguilar INIA Uruguay 05-2018 Unix Basic Commands pwd ls ll mkdir d cd d show working directory list files in working directory as before
More informationIntroduction to UNIX command-line II
Introduction to UNIX command-line II Boyce Thompson Institute 2017 Prashant Hosmani Class Content Terminal file system navigation Wildcards, shortcuts and special characters File permissions Compression
More informationOnline Business Account How to view and download reports
Online Business Account How to view and download reports Online Business Account How to view and download reports There are a range of reports in the reporting suite that can provide you with information
More informationPart III. Shell Config. Tobias Neckel: Scripting with Bash and Python Compact Max-Planck, February 16-26,
Part III Shell Config Compact Course @ Max-Planck, February 16-26, 2015 33 Special Directories. current directory.. parent directory ~ own home directory ~user home directory of user ~- previous directory
More informationWorking with Tables in Word 2010
Working with Tables in Word 2010 Table of Contents INSERT OR CREATE A TABLE... 2 USE TABLE TEMPLATES (QUICK TABLES)... 2 USE THE TABLE MENU... 2 USE THE INSERT TABLE COMMAND... 2 KNOW YOUR AUTOFIT OPTIONS...
More informationSequence Data Quality Assessment Exercises and Solutions.
Sequence Data Quality Assessment Exercises and Solutions. Starting Note: Please do not copy and paste the commands. Characters in this document may not be copied correctly. Please type the commands and
More informationHandling important NGS data formats in UNIX Prac8cal training course NGS Workshop in Nove Hrady 2014
Handling important NGS data formats in UNIX Prac8cal training course NGS Workshop in Nove Hrady 2014 Vaclav Janousek, Libor Morkovsky hjp://ngs- course- nhrady.readthedocs.org (Exercises & Reference Manual)
More informationTable of contents. Our goal. Notes. Notes. Notes. Summer June 29, Our goal is to see how we can use Unix as a tool for developing programs
Summer 2010 Department of Computer Science and Engineering York University Toronto June 29, 2010 1 / 36 Table of contents 1 2 3 4 2 / 36 Our goal Our goal is to see how we can use Unix as a tool for developing
More informationCyverse tutorial 1 Logging in to Cyverse and data management. Open an Internet browser window and navigate to the Cyverse discovery environment:
Cyverse tutorial 1 Logging in to Cyverse and data management Open an Internet browser window and navigate to the Cyverse discovery environment: https://de.cyverse.org/de/ Click Log in with your CyVerse
More informationApplied Systems Client Network SEMINAR HANDOUT. Excel 2007: Level 1
Applied Systems Client Network SEMINAR HANDOUT Excel 2007: Level 1 Prepared for ASCnet Applied Systems Client Network 801 Douglas Avenue #205 Altamonte Springs, FL 32714 Phone: 407-869-0404 Fax: 407-869-0418
More informationIntroduction to Unix/Linux INX_S17, Day 6,
Introduction to Unix/Linux INX_S17, Day 6, 2017-04-17 Installing binaries, uname, hmmer and muscle, public data (wget and sftp) Learning Outcome(s): Install and run software from your home directory. Download
More informationEssential Skills for Bioinformatics: Unix/Linux
Essential Skills for Bioinformatics: Unix/Linux SHELL SCRIPTING Overview Bash, the shell we have used interactively in this course, is a full-fledged scripting language. Unlike Python, Bash is not a general-purpose
More informationLinux Text Utilities 101 for S/390 Wizards SHARE Session 9220/5522
Linux Text Utilities 101 for S/390 Wizards SHARE Session 9220/5522 Scott D. Courtney Senior Engineer, Sine Nomine Associates March 7, 2002 http://www.sinenomine.net/ Table of Contents Concepts of the Linux
More informationIntroduction to Text-Processing. Jim Notwell 23 January 2013
Introduction to Text-Processing Jim Notwell 23 January 2013 1 Stanford UNIX Resources Host: cardinal.stanford.edu To connect from UNIX / Linux / Mac: ssh user@cardinal.stanford.edu To connect from Windows
More informationShell Programming Overview
Overview Shell programming is a way of taking several command line instructions that you would use in a Unix command prompt and incorporating them into one program. There are many versions of Unix. Some
More informationPower Query for Parsing Data
Excel Power Query Power Query for Parsing Data Data Models Screen 1In Excel 2010 and 2013 need to install the Power Query; however, in 2016 is automatically part of the Data Tab ribbon and the commands
More informationSequence Analysis Pipeline
Sequence Analysis Pipeline Transcript fragments 1. PREPROCESSING 2. ASSEMBLY (today) Removal of contaminants, vector, adaptors, etc Put overlapping sequence together and calculate bigger sequences 3. Analysis/Annotation
More informationADD AND NAME WORKSHEETS
1 INTERMEDIATE EXCEL While its primary function is to be a number cruncher, Excel is a versatile program that is used in a variety of ways. Because it easily organizes, manages, and displays information,
More informationCS 124/LINGUIST 180 From Languages to Information. Unix for Poets Dan Jurafsky
CS 124/LINGUIST 180 From Languages to Information Unix for Poets Dan Jurafsky (original by Ken Church, modifications by me and Chris Manning) Stanford University Unix for Poets Text is everywhere The Web
More informationMicrosoft Word 2013 Working with tables
Microsoft Word 2013 Working with tables LIBRARY AND LEARNING SERVICES WORKING WITH TABLES www.eit.ac.nz/library/ls_computer_word2013_tables.html What is a table? A table is information arranged in horizontal
More informationPractical Linux Examples
Practical Linux Examples Processing large text file Parallelization of independent tasks Qi Sun & Robert Bukowski Bioinformatics Facility Cornell University http://cbsu.tc.cornell.edu/lab/doc/linux_examples_slides.pdf
More informationBasic Shell Scripting Practice. HPC User Services LSU HPC & LON March 2018
Basic Shell Scripting Practice HPC User Services LSU HPC & LON sys-help@loni.org March 2018 Quotation Exercise 1. Print out your $LOGNAME 2. Print date 3. Print `who am i` 4. Print your current directory
More informationRich Text Editor Quick Reference
Rich Text Editor Quick Reference Introduction Using the rich text editor is similar to using a word processing application such as Microsoft Word. After data is typed into the editing area it can be formatted
More informationTechnology Webinar. Integrating Spreadsheets into Core Curriculum. Part 1
Technology Webinar Integrating Spreadsheets into Core Curriculum Part 1 Online Workshop Adobe Connect overview Core curriculum TEKS Spreadsheet basics Cell cell name Column and row Entering data into a
More informationCSC2100-Data Structures
CSC2100-Data Structures Final Remarks Department of Computer Science and Engineering The Chinese University of Hong Kong, Shatin, New Territories Interesting Topics More Graph Algorithms Finding cycles,
More informationExcel 2013 Next Steps
Excel 2013 Next Steps ADULT SERVICES DEPARTMENT CRYSTAL LAKE PUBLIC LIBRARY 126 W. PADDOCK STREET CRYSTAL LAKE, IL 60014 815-459-1687, X7 WWW.CLPL.ORG Agenda 2 Home Toolbar Alignment Group Number Formats
More informationWorkshop Practical on concatenation and model testing
Workshop Practical on concatenation and model testing Jacob L. Steenwyk & Antonis Rokas Programs that you will use: Bash, Python, Perl, Phyutility, PartitionFinder, awk To infer a putative species phylogeny
More information7 CREATING QUERY WITH QUERY WIZARD AND QUERY DESIGNER
7 CREATING QUERY WITH QUERY WIZARD AND QUERY DESIGNER 7.1 INTRODUCTION Query is the most powerful feature of any database. A Query is a set of instructions in a logical order, required to produce the output
More informationINFORMATION TECHNOLOGY 402 UNIT IV SPREADSHEET
INFORMATION TECHNOLOGY 402 UNIT IV SPREADSHEET AUTOSUM AutoSum is a function in Microsoft Excel and other spreadsheet programs that automatically enters the appropriate formula or function into your spreadsheet.
More informationWorking with Cells, Rows, and Columns
Working with Cells, Rows, and Columns It is important to remember that there is no way to undo actions in an EQSS. Before making changes you are unsure of, you might want to save the page, so that you
More informationMerge Conflicts p. 92 More GitHub Workflows: Forking and Pull Requests p. 97 Using Git to Make Life Easier: Working with Past Commits p.
Preface p. xiii Ideology: Data Skills for Robust and Reproducible Bioinformatics How to Learn Bioinformatics p. 1 Why Bioinformatics? Biology's Growing Data p. 1 Learning Data Skills to Learn Bioinformatics
More informationWeek Overview. Simple filter commands: head, tail, cut, sort, tr, wc grep utility stdin, stdout, stderr Redirection and piping /dev/null file
ULI101 Week 05 Week Overview Simple filter commands: head, tail, cut, sort, tr, wc grep utility stdin, stdout, stderr Redirection and piping /dev/null file head and tail commands These commands display
More informationSorting Pearson Education, Inc. All rights reserved.
1 19 Sorting 2 19.1 Introduction (Cont.) Sorting data Place data in order Typically ascending or descending Based on one or more sort keys Algorithms Insertion sort Selection sort Merge sort More efficient,
More informationWebIntelligence. Creating Documents
Creating Documents This page is intentionally left blank. 2 WIC110904 Table of Contents Lesson Objective... 5 For Assistance...6 Introduction... 7 Document Editor... 7 Designing a Query Flowchart... 9
More informationExcel Tools Features... 1 Comments... 2 List Comments Formatting... 3 Center Across... 3 Hide Blank Rows... 3 Lists... 3 Sheet Links...
CONTEXTURES EXCEL TOOLS FEATURES LIST PAGE 1 Excel Tools Features The following features are contained in the Excel Tools Add-in. Excel Tools Features... 1 Comments... 2 List Comments... 2 Comments...
More informationCreating Accessible Word Documents Tutorial
Creating Accessible Word Documents Tutorial 1. Use uniform heading structure/style guides to reinforce structure To keep trail of the structure, you can open the Navigation Pane. Edit built-in heading
More informationWord 2007 Tables Part 2
Word 2007 Tables Part 2 In this lesson you will learn to use formulas within tables, change the size and positions of a tables, convert information from table form to text form and vice versa, insert clipart
More informationThe Streetscape User Guide Dynamic Watch List
Overview The Streetscape User Guide 1.756501.100 The enables you to track and monitor securities by grouping them into lists or portfolios based on one or more common characteristics. You can create an
More informationDAY 7: EXCEL CHAPTER 5. Divya Ganesan February 5, 2013
DAY 7: EXCEL CHAPTER 5 Divya Ganesan divya.ganesan@mail.wvu.edu February 5, 2013 1 FREEZING ROWS AND COLUMNS Freezing keeps rows and columns visible during scrolling Click View tab in Ribbon Click on Freeze
More informationUsing the Galaxy Local Bioinformatics Cloud at CARC
Using the Galaxy Local Bioinformatics Cloud at CARC Lijing Bu Sr. Research Scientist Bioinformatics Specialist Center for Evolutionary and Theoretical Immunology (CETI) Department of Biology, University
More informationEssential Linux Shell Commands
Essential Linux Shell Commands Special Characters Quoting and Escaping Change Directory Show Current Directory List Directory Contents Working with Files Working with Directories Special Characters There
More informationDecision Logic: if, if else, switch, Boolean conditions and variables
CS 1044 roject 4 Summer I 2007 Decision Logic: if, if else, switch, Boolean conditions and variables This programming assignment uses many of the ideas presented in sections 3 through 5 of the course notes,
More informationFrequency tables Create a new Frequency Table
Frequency tables Create a new Frequency Table Contents FREQUENCY TABLES CREATE A NEW FREQUENCY TABLE... 1 Results Table... 2 Calculate Descriptive Statistics for Frequency Tables... 6 Transfer Results
More informationDepartment of Computer Science and Technology
M.Sc. (CA) (2 nd Semester) 040020202 : UNIX Internals and Shell Programming Teaching Schedule Objective: To acquaint the students with the basic internal structure & operations of UNIX operating system,
More informationUNIX / LINUX - REGULAR EXPRESSIONS WITH SED
UNIX / LINUX - REGULAR EXPRESSIONS WITH SED http://www.tutorialspoint.com/unix/unix-regular-expressions.htm Copyright tutorialspoint.com Advertisements In this chapter, we will discuss in detail about
More informationAccess Groups. Collect and Store. Text Currency Date/Time. Tables Fields Data Type. You Your Friend Your Parent. Unique information
Tutorial A database is a computerized record keeping system used to collect, store, analyze and report electronic information for a variety of purposes. Microsoft Access is a database. There are three
More informationIn this document, you will learn how to take a Microsoft Word Document and make it accessible and available as a PDF.
Accessibility Creating Accessible PDFs using Microsoft Word What is PDF Accessibility? Accessibility is a general term used to describe the degree to which a product, device, service, or environment is
More informationUsing Reports and Graphs
Using Reports and Graphs Information in this section explains how to generate and use PCS Axis reports and graphs. The information is intended for PCS Axis users with SysAdmin, User, and Read Only user
More informationA Brief Introduction to the Linux Shell for Data Science
A Brief Introduction to the Linux Shell for Data Science Aris Anagnostopoulos 1 Introduction Here we will see a brief introduction of the Linux command line or shell as it is called. Linux is a Unix-like
More informationsottotitolo A.A. 2016/17 Federico Reghenzani, Alessandro Barenghi
Titolo presentazione Piattaforme Software per la Rete sottotitolo BASH Scripting Milano, XX mese 20XX A.A. 2016/17, Alessandro Barenghi Outline 1) Introduction to BASH 2) Helper commands 3) Control Flow
More informationHuman Resource Management System User Guide
11.0 Human Resource Management System User Guide Unit 0: Introduction Unit 1: HRMS Basics Unit 2: DateTracking Unit 3: Hiring a New Employee Unit 4: Electronic Approvals Unit 5: Maintaining Existing Employees
More informationSortMeRNA User Manual
SortMeRNA User Manual Evguenia Kopylova evguenia.kopylova@lifl.fr January 2013 1 Contents 1 Introduction 3 2 Installation 3 2.1 Required g++ compiler version............................... 3 2.1.1 Ubuntu
More informationReading and manipulating files
Reading and manipulating files Goals By the end of this lesson you will be able to Read files without using text editors Access specific parts of files Count the number of words and lines in a file Sort
More informationAccess Groups. Collect and Store. Text Currency Date/Time. Tables Fields Data Type. You Your Friend Your Parent. Unique information
Tutorial A database is a computerized record keeping system used to collect, store, analyze and report electronic information for a variety of purposes. Microsoft Access is a database. There are three
More informationPractical Linux examples: Exercises
Practical Linux examples: Exercises 1. Login (ssh) to the machine that you are assigned for this workshop (assigned machines: https://cbsu.tc.cornell.edu/ww/machines.aspx?i=87 ). Prepare working directory,
More informationUnleashing the Shell Hands-On UNIX System Administration DeCal Week 6 28 February 2011
Unleashing the Shell Hands-On UNIX System Administration DeCal Week 6 28 February 2011 Last time Compiling software and the three-step procedure (./configure && make && make install). Dependency hell and
More informationExamining De Novo Transcriptome Assemblies via a Quality Assessment Pipeline
Examining De Novo Transcriptome Assemblies via a Quality Assessment Pipeline Noushin Ghaffari, Osama A. Arshad, Hyundoo Jeong, John Thiltges, Michael F. Criscitiello, Byung-Jun Yoon, Aniruddha Datta, Charles
More informationThe Professional Services Of Dojo Technology. Spreadsheet Files
The Professional Services Of Dojo Technology Spreadsheet Files File Conversion Solutions This document serves as an opportunity to introduce the custom solutions that have been developed by Dojo for processing
More informationSTIDistrict Query (Basic)
STIDistrict Query (Basic) Creating a Basic Query To create a basic query in the Query Builder, open the STIDistrict workstation and click on Utilities Query Builder. When the program opens, database objects
More informationEXCELLING WITH ANALYSIS AND VISUALIZATION
EXCELLING WITH ANALYSIS AND VISUALIZATION A PRACTICAL GUIDE FOR DEALING WITH DATA Prepared by Ann K. Emery July 2016 Ann K. Emery 1 Welcome Hello there! In July 2016, I led two workshops Excel Basics for
More informationLecture 11. Lecture 11: External Sorting
Lecture 11 Lecture 11: External Sorting Lecture 11 Announcements 1. Midterm Review: This Friday! 2. Project Part #2 is out. Implement CLOCK! 3. Midterm Material: Everything up to Buffer management. 1.
More informationLinux command line basics III: piping commands for text processing. Yanbin Yin Fall 2015
Linux command line basics III: piping commands for text processing Yanbin Yin Fall 2015 1 h.p://korflab.ucdavis.edu/unix_and_perl/unix_and_perl_v3.1.1.pdf 2 The beauty of Unix for bioinformagcs sort, cut,
More informationGo back to your Excel sheet. Choose Paste to Sheet tab at the bottom.
PCC: How to easily calculate monthly weights. All names on this report are fictitious to protect patient information. The images contained are from a Mac computer, if you use a PC and have difficulty with
More informationIntroduction to Linux. Roman Cheplyaka
Introduction to Linux Roman Cheplyaka Generic commands, files, directories What am I running? ngsuser@ubuntu:~$ cat /etc/lsb-release DISTRIB_ID=Ubuntu DISTRIB_RELEASE=16.04 DISTRIB_CODENAME=xenial DISTRIB_DESCRIPTION="Ubuntu
More informationChapter 4. Microsoft Excel
Chapter 4 Microsoft Excel Topic Introduction Spreadsheet Basic Screen Layout Modifying a Worksheet Formatting Cells Formulas and Functions Sorting and Filling Borders and Shading Charts Introduction A
More informationCSE2031. Lab 2 FALL 2009
CSE2031 Lab 2 FALL 2009 In this lab, you will be introduced to more complex Unix commands. After this lab, you should be comfortable using Unix/Linux in the lab and as a platform for software development.
More informationGetting Started with Microsoft Excel 2013
2015 Bow Valley College 1 Microsoft Excel Vocabulary Getting Started with Microsoft Excel 2013 Column: A grouping of information or data organized from top to bottom. In Excel columns are named with letters
More informationDealing with the way Mail Merge changed in MS Word 2003
Dealing with the way Mail Merge changed in MS Word 2003 Go From This: To This: The New and Improved Mail Merge Mail Merge has changed dramatically from the older versions of Word. They just forgot to tell
More information"Bash vs Python Throwdown" -or- "How you can accomplish common tasks using each of these tools" Bash Examples. Copying a file: $ cp file1 file2
"Bash vs Python Throwdown" -or- "How you can accomplish common tasks using each of these tools" Bash Examples Copying a file: $ cp file1 file2 Wrangling "csv" files: Consider a file named 20140209.csv
More information