Command-Line Data Analysis INX_S17, Day 15,

Size: px
Start display at page:

Download "Command-Line Data Analysis INX_S17, Day 15,"

Transcription

1 Command-Line Data Analysis INX_S17, Day 15, General tool efficiency, tr, newlines, join, column Learning Outcome(s): Discuss the theory behind Unix/Linux tool efficiency, e.g., the reasons behind their design from the 1970s and 1980s, and identify these design characteristics in common tools, e.g., cat, grep, awk, sed, and pipes. Matthew Peterson, OSU CGRB, Please do not redistribute outside of OSU; contains copyrighted materials.

2 A note on efficiency The programs we use were written in the 1970s, e.g., sed, awk, sort, etc. Brilliant minds made sure these programs were: efficient, lean, and mean! Why? 1

3 Cray-1 Supercomputer A top of the line 1976 Supercomputer processor ran at 80 Mhz at a cost of $8.86 million. Author: Clemens PFEIFFER 2

4 Cray-2 Supercomputer A top of the line 1985 Supercomputer processor ran at 125 Mhz at a cost of $16 million. 3

5 Apple Watch An Apple Watch 1 (~$269) running at 520 Mhz is equal in processing capacity to two Cray 2s. = Author: Justin14 4

6 Pipe example Write Buffer Read cat fruit.txt grep apple Pipe sets up a small buffer in-between programs When the buffer is full it pauses cat When the buffer is empty it pauses grep If the buffer is ½ full both cat and grep can run simultaneously on different CPUs! 5

7 top example If you re running a big pipeline you ll see multiple programs will be running at the sametime, e.g., Program CPU cat 30% grep 20% awk Show zcat example of Illumina FASTQ 6

8 Class activity: Counts of counts!

9 Class activity: The fruit pipeline

10 Well done! Observations Most of the participants needed very little "working memory" Not much storage space was used by the buffers Many participants could be working simultaneously, but Anyone after sort would have had to wait! 9

11 tr Translates sets of characters tr '<set1>' '<set2>' <file> or... tr '<set1>' '<set2> Example: Change al T s to A s and vice-versa echo "ATTTTTA" tr 'TA' 'AT' TAAAAAT 10

12 tr Dealing with newlines \n The newline is represented in Linux by a special character '\n' You cannot see this character other than it wrapping the text to the next, new line. We can use tr to remove all newlines, e.g., cat lines.txt Line 1 Line 2 Line 3 cat lines.txt tr \n # 11

13 tr To reflow a FASTA file FASTA files often have their sequences span lines after each header, e.g., pz_cdnas.fasta Say we wanted to extract all sequences from the pz_cdnas.fasta that had in its header line (>) an nreads greater than 5. There s a general pattern ( trick ) for this using tr, which can be applied in other use cases. 12

14 tr reflow pattern 1) Check the file for an unused character, e.g., or the tab character ('\t'); verify first with grep! 2) Replace all newlines e.g., tr '\n' '@' 3) Replace start of records ('>') with '\n>' sed r 's/>/\n>/g' # 1 seq/line 13

15 tr reflow pattern (continued) 4) Use grep/awk/sed to modify lines of interest sed -r 's/=/ /1' \ awk '{if($3 > 5) {print $0}}' 5) Reformat back to FASTA (Header line + Seq line) tr '@' '\n' # Could also use sed 6) The previous reformatting will have introduced blank lines, which can be removed, e.g., awk '{if(nf > 0) print $0} 14

16 join files on a common column join -1 <key column in file1> -2 <key column in file2> <file1> <file2> Say we have two output files that share a similar key (identifier), e.g., # blastx pz_cdnas.fasta vs. Yeast ORF, outfmt 6 p450s_blastp_yeast_top1.txt # fasta_stats of pz_cdnas.fasta pz_stats.table 15

17 join files on a common column join -1 <key column in file1> -2 <key column in file2> <file1> <file2> Merges two row/column text files based on lines with similar values in a specified key column. By default, join only outputs rows where data is present in both files. Both input files are required to be similarly sorted (either ascending or descending) on the key columns. 16

18 join BLAST and fasta_stats data Say we have two output files that share a similar key (identifier) in this case the sequence identifier # blastx pz_cdnas.fasta vs. Yeast ORF, outfmt 6 p450s_blastp_yeast_top1.txt # fasta_stats of pz_cdnas.fasta pz_stats.table 17

19 join First sort the files Say we have two output files that share a similar key (identifier) in this case the sequence identifier cat pz_blastx_yeast_top1.txt \ > sort -k1,1d > \ > pz_blastx_yeast_top1.sorted.txt cat pz_stats.table \ > sort -k1,1d > \ > pz_stats.sorted.table 18

20 The output contains: join Sorted output All of the columns for the first file, followed by All of the columns of the second file Without the key column Separated by single spaces join \ pz_stats.sorted.table \ pz_blastx_yeast_top1.sorted.txt 19

21 BLAST matches > 50% GC content awk '{if($1 > 0.5) print $0}' With everything separated by spaces it's still hard to read (for humans) 20

22 join Limitation #1 If any entries in the key columns are repeated, the output will contain a row for each matching pair of keys. 21

23 join Limitation #2 Both input files must be sorted. If they are not sorted join will produce a warning. 22

24 join Limitation #3 join does not easily produce a Full outer join By default it produces an Inner join Python and R excel at these use cases 23

25 column Reformatting column -t <file> or... column -t Reformats whitespace separated row/column input so that the output is human readable Done by replacing one or more spaces and tabs by an appropriate number of spaces so that columns are visually aligned. 24

Command-Line Data Analysis INX_S17, Day 10,

Command-Line Data Analysis INX_S17, Day 10, Command-Line Data Analysis INX_S17, Day 10, 2017-05-01 Assignment 4 (quiz). sort, head, tail Learning Outcome(s): Use `sort` to build filtering pipelines for bioinformatics data Matthew Peterson, OSU CGRB,

More information

Introduction to Unix/Linux INX_S17, Day 8,

Introduction to Unix/Linux INX_S17, Day 8, Introduction to Unix/Linux INX_S17, Day 8, 2017-04-21 stdin, stdout, stderr, piping, iterative filtering, grep, cat, UUOC Learning Outcome(s): Redirect the standard output to the standard input stream

More information

http://xkcd.com/208/ 1. Review of pipes 2. Regular expressions 3. sed 4. awk 5. Editing Files 6. Shell loops 7. Shell scripts cat seqs.fa >0! TGCAGGTATATCTATTAGCAGGTTTAATTTTGCCTGCACTTGGTTGGGTACATTATTTTAAGTGTATTTGACAAG!

More information

Unit 3 Fill Series, Functions, Sorting

Unit 3 Fill Series, Functions, Sorting Unit 3 Fill Series, Functions, Sorting Fill enter repetitive values or formulas in an indicated direction Using the Fill command is much faster than using copy and paste you can do entire operation in

More information

Unit 3 Functions Review, Fill Series, Sorting, Merge & Center

Unit 3 Functions Review, Fill Series, Sorting, Merge & Center Unit 3 Functions Review, Fill Series, Sorting, Merge & Center Function built-in formula that performs simple or complex calculations automatically names a function instead of using operators (+, -, *,

More information

Essential Skills for Bioinformatics: Unix/Linux

Essential Skills for Bioinformatics: Unix/Linux Essential Skills for Bioinformatics: Unix/Linux WORKING WITH COMPRESSED DATA Overview Data compression, the process of condensing data so that it takes up less space (on disk drives, in memory, or across

More information

http://xkcd.com/208/ 1. Review of pipes 2. Regular expressions 3. sed 4. Editing Files 5. Shell loops 6. Shell scripts cat seqs.fa >0! TGCAGGTATATCTATTAGCAGGTTTAATTTTGCCTGCACTTGGTTGGGTACATTATTTTAAGTGTATTTGACAAG!

More information

http://xkcd.com/208/ cat seqs.fa >0 TGCAGGTATATCTATTAGCAGGTTTAATTTTGCCTGCACTTGGTTGGGTACATTATTTTAAGTGTATTTGACAAG >1 TGCAGGTTGTTGTTACTCAGGTCCAGTTCTCTGAGACTGGAGGACTGGGAGCTGAGAACTGAGGACAGAGCTTCA >2 TGCAGGGCCGGTCCAAGGCTGCATGAGGCCTGGGGCAGAATCTGACCTAGGGGCCCCTCTTGCTGCTAAAACCAT

More information

STATS Data Analysis using Python. Lecture 15: Advanced Command Line

STATS Data Analysis using Python. Lecture 15: Advanced Command Line STATS 700-002 Data Analysis using Python Lecture 15: Advanced Command Line Why UNIX/Linux? As a data scientist, you will spend most of your time dealing with data Data sets never arrive ready to analyze

More information

Lecture 3. Essential skills for bioinformatics: Unix/Linux

Lecture 3. Essential skills for bioinformatics: Unix/Linux Lecture 3 Essential skills for bioinformatics: Unix/Linux RETRIEVING DATA Overview Whether downloading large sequencing datasets or accessing a web application hundreds of times to download specific files,

More information

Introduction To Linux. Rob Thomas - ACRC

Introduction To Linux. Rob Thomas - ACRC Introduction To Linux Rob Thomas - ACRC What Is Linux A free Operating System based on UNIX (TM) An operating system originating at Bell Labs. circa 1969 in the USA More of this later... Why Linux? Free

More information

Genomic Files. University of Massachusetts Medical School. October, 2015

Genomic Files. University of Massachusetts Medical School. October, 2015 .. Genomic Files University of Massachusetts Medical School October, 2015 2 / 55. A Typical Deep-Sequencing Workflow Samples Fastq Files Fastq Files Sam / Bam Files Various files Deep Sequencing Further

More information

7. Apply a Range of Table Features

7. Apply a Range of Table Features Word Processing 5N1358 7. Apply a Range of Table Features Contents Apply a Range of Table Features Including: 1. Creating Tables... 1 2. Resizing... 4 3. Merging Cells... 5 4. Inserting or Deleting columns

More information

Genomic Files. University of Massachusetts Medical School. October, 2014

Genomic Files. University of Massachusetts Medical School. October, 2014 .. Genomic Files University of Massachusetts Medical School October, 2014 2 / 39. A Typical Deep-Sequencing Workflow Samples Fastq Files Fastq Files Sam / Bam Files Various files Deep Sequencing Further

More information

1. Position your mouse over the column line in the column heading so that the white cross becomes a double arrow.

1. Position your mouse over the column line in the column heading so that the white cross becomes a double arrow. Excel 2010 Modifying Columns, Rows, and Cells Introduction Page 1 When you open a new, blank workbook, the cells are set to a default size.you do have the ability to modify cells, and to insert and delete

More information

Advanced training. Linux components Command shell. LiLux a.s.b.l.

Advanced training. Linux components Command shell. LiLux a.s.b.l. Advanced training Linux components Command shell LiLux a.s.b.l. alexw@linux.lu Kernel Interface between devices and hardware Monolithic kernel Micro kernel Supports dynamics loading of modules Support

More information

http://xkcd.com/208/ 1. Computer Hardware 2. Review of pipes 3. Regular expressions 4. sed 5. awk 6. Editing Files 7. Shell loops 8. Shell scripts Hardware http://www.theverge.com/2011/11/23/2582677/thailand-flood-seagate-hard-drive-shortage

More information

IB047. Unix Text Tools. Pavel Rychlý Mar 3.

IB047. Unix Text Tools. Pavel Rychlý Mar 3. Unix Text Tools pary@fi.muni.cz 2014 Mar 3 Unix Text Tools Tradition Unix has tools for text processing from the very beginning (1970s) Small, simple tools, each tool doing only one operation Pipe (pipeline):

More information

Microsoft Office Illustrated. Using Tables

Microsoft Office Illustrated. Using Tables Microsoft Office 2007 - Illustrated Using Tables Objectives Plan a Table Create a Table Add Table Data Find and Replace Table Data Delete Table Data 2 Objectives Sort Table Data Use Formulas in a Table

More information

Lesson 15 Working with Tables

Lesson 15 Working with Tables Working with Tables Computer Literacy BASICS: A Comprehensive Guide to IC 3, 4 th Edition 1 Objectives Create a table and insert text. Insert and delete rows and columns. Adjust column width and row height.

More information

Lesson 15 Working with Tables

Lesson 15 Working with Tables Working with Tables Computer Literacy BASICS: A Comprehensive Guide to IC 3, 5 th Edition 1 Objectives Create a table and insert text. Insert and delete rows and columns. Adjust column width and row height.

More information

Practical: Using LAST and MEGAN to get a quick view of a metagenome

Practical: Using LAST and MEGAN to get a quick view of a metagenome Practical: Using LAST and MEGAN to get a quick view of a metagenome Daniel Lundin Linneaeus University November 14, 2014 Daniel Lundin (LNU) LAST+MEGAN practical November 14, 2014 1 / 25 A GIT archive

More information

Lecture 5. Essential skills for bioinformatics: Unix/Linux

Lecture 5. Essential skills for bioinformatics: Unix/Linux Lecture 5 Essential skills for bioinformatics: Unix/Linux UNIX DATA TOOLS Text processing with awk We have illustrated two ways awk can come in handy: Filtering data using rules that can combine regular

More information

ls /data/atrnaseq/ egrep "(fastq fasta fq fa)\.gz" ls /data/atrnaseq/ egrep "(cn ts)[1-3]ln[^3a-za-z]\."

ls /data/atrnaseq/ egrep (fastq fasta fq fa)\.gz ls /data/atrnaseq/ egrep (cn ts)[1-3]ln[^3a-za-z]\. Command line tools - bash, awk and sed We can only explore a small fraction of the capabilities of the bash shell and command-line utilities in Linux during this course. An entire course could be taught

More information

5/8/2012. Exploring Utilities Chapter 5

5/8/2012. Exploring Utilities Chapter 5 Exploring Utilities Chapter 5 Examining the contents of files. Working with the cut and paste feature. Formatting output with the column utility. Searching for lines containing a target string with grep.

More information

UNIX, GNU/Linux and simple tools for data manipulation

UNIX, GNU/Linux and simple tools for data manipulation UNIX, GNU/Linux and simple tools for data manipulation Dr Jean-Baka DOMELEVO ENTFELLNER BecA-ILRI Hub Basic Bioinformatics Training Workshop @ILRI Addis Ababa Wednesday December 13 th 2017 Dr Jean-Baka

More information

Linux Introduction to Linux

Linux Introduction to Linux Linux Introduction to Linux Most computational biologists use either Apple Macs or Linux machines. There are a couple of reasons for this: * Much of the software is free * Many of the tools require a command

More information

Creating dependent menus with Moodle Database activity. William Lu

Creating dependent menus with Moodle Database activity. William Lu Creating dependent menus with Moodle Database activity William Lu Hello, everyone My name is William. In this session, I will show you how to create a dependent menu with Moodle Database activity. 2 Sometimes,

More information

User Manual Mail Merge

User Manual Mail Merge User Manual Mail Merge Version: 1.0 Mail Merge Date: 27-08-2013 How to print letters using Mail Merge You can use Mail Merge to create a series of documents, such as a standard letter that you want to

More information

-Using Excel- *The columns are marked by letters, the rows by numbers. For example, A1 designates row A, column 1.

-Using Excel- *The columns are marked by letters, the rows by numbers. For example, A1 designates row A, column 1. -Using Excel- Note: The version of Excel that you are using might vary slightly from this handout. This is for Office 2004 (Mac). If you are using a different version, while things may look slightly different,

More information

1. What tool do you use to check which cells are referenced in formulas that are assigned to the active cell?

1. What tool do you use to check which cells are referenced in formulas that are assigned to the active cell? Q75-100 1. What tool do you use to check which cells are referenced in formulas that are assigned to the active cell? A. Reference Finder B. Range Finder C. Reference Checker D. Address Finder B. Range

More information

Useful commands in Linux and other tools for quality control. Ignacio Aguilar INIA Uruguay

Useful commands in Linux and other tools for quality control. Ignacio Aguilar INIA Uruguay Useful commands in Linux and other tools for quality control Ignacio Aguilar INIA Uruguay 05-2018 Unix Basic Commands pwd ls ll mkdir d cd d show working directory list files in working directory as before

More information

Introduction to UNIX command-line II

Introduction to UNIX command-line II Introduction to UNIX command-line II Boyce Thompson Institute 2017 Prashant Hosmani Class Content Terminal file system navigation Wildcards, shortcuts and special characters File permissions Compression

More information

Online Business Account How to view and download reports

Online Business Account How to view and download reports Online Business Account How to view and download reports Online Business Account How to view and download reports There are a range of reports in the reporting suite that can provide you with information

More information

Part III. Shell Config. Tobias Neckel: Scripting with Bash and Python Compact Max-Planck, February 16-26,

Part III. Shell Config. Tobias Neckel: Scripting with Bash and Python Compact Max-Planck, February 16-26, Part III Shell Config Compact Course @ Max-Planck, February 16-26, 2015 33 Special Directories. current directory.. parent directory ~ own home directory ~user home directory of user ~- previous directory

More information

Working with Tables in Word 2010

Working with Tables in Word 2010 Working with Tables in Word 2010 Table of Contents INSERT OR CREATE A TABLE... 2 USE TABLE TEMPLATES (QUICK TABLES)... 2 USE THE TABLE MENU... 2 USE THE INSERT TABLE COMMAND... 2 KNOW YOUR AUTOFIT OPTIONS...

More information

Sequence Data Quality Assessment Exercises and Solutions.

Sequence Data Quality Assessment Exercises and Solutions. Sequence Data Quality Assessment Exercises and Solutions. Starting Note: Please do not copy and paste the commands. Characters in this document may not be copied correctly. Please type the commands and

More information

Handling important NGS data formats in UNIX Prac8cal training course NGS Workshop in Nove Hrady 2014

Handling important NGS data formats in UNIX Prac8cal training course NGS Workshop in Nove Hrady 2014 Handling important NGS data formats in UNIX Prac8cal training course NGS Workshop in Nove Hrady 2014 Vaclav Janousek, Libor Morkovsky hjp://ngs- course- nhrady.readthedocs.org (Exercises & Reference Manual)

More information

Table of contents. Our goal. Notes. Notes. Notes. Summer June 29, Our goal is to see how we can use Unix as a tool for developing programs

Table of contents. Our goal. Notes. Notes. Notes. Summer June 29, Our goal is to see how we can use Unix as a tool for developing programs Summer 2010 Department of Computer Science and Engineering York University Toronto June 29, 2010 1 / 36 Table of contents 1 2 3 4 2 / 36 Our goal Our goal is to see how we can use Unix as a tool for developing

More information

Cyverse tutorial 1 Logging in to Cyverse and data management. Open an Internet browser window and navigate to the Cyverse discovery environment:

Cyverse tutorial 1 Logging in to Cyverse and data management. Open an Internet browser window and navigate to the Cyverse discovery environment: Cyverse tutorial 1 Logging in to Cyverse and data management Open an Internet browser window and navigate to the Cyverse discovery environment: https://de.cyverse.org/de/ Click Log in with your CyVerse

More information

Applied Systems Client Network SEMINAR HANDOUT. Excel 2007: Level 1

Applied Systems Client Network SEMINAR HANDOUT. Excel 2007: Level 1 Applied Systems Client Network SEMINAR HANDOUT Excel 2007: Level 1 Prepared for ASCnet Applied Systems Client Network 801 Douglas Avenue #205 Altamonte Springs, FL 32714 Phone: 407-869-0404 Fax: 407-869-0418

More information

Introduction to Unix/Linux INX_S17, Day 6,

Introduction to Unix/Linux INX_S17, Day 6, Introduction to Unix/Linux INX_S17, Day 6, 2017-04-17 Installing binaries, uname, hmmer and muscle, public data (wget and sftp) Learning Outcome(s): Install and run software from your home directory. Download

More information

Essential Skills for Bioinformatics: Unix/Linux

Essential Skills for Bioinformatics: Unix/Linux Essential Skills for Bioinformatics: Unix/Linux SHELL SCRIPTING Overview Bash, the shell we have used interactively in this course, is a full-fledged scripting language. Unlike Python, Bash is not a general-purpose

More information

Linux Text Utilities 101 for S/390 Wizards SHARE Session 9220/5522

Linux Text Utilities 101 for S/390 Wizards SHARE Session 9220/5522 Linux Text Utilities 101 for S/390 Wizards SHARE Session 9220/5522 Scott D. Courtney Senior Engineer, Sine Nomine Associates March 7, 2002 http://www.sinenomine.net/ Table of Contents Concepts of the Linux

More information

Introduction to Text-Processing. Jim Notwell 23 January 2013

Introduction to Text-Processing. Jim Notwell 23 January 2013 Introduction to Text-Processing Jim Notwell 23 January 2013 1 Stanford UNIX Resources Host: cardinal.stanford.edu To connect from UNIX / Linux / Mac: ssh user@cardinal.stanford.edu To connect from Windows

More information

Shell Programming Overview

Shell Programming Overview Overview Shell programming is a way of taking several command line instructions that you would use in a Unix command prompt and incorporating them into one program. There are many versions of Unix. Some

More information

Power Query for Parsing Data

Power Query for Parsing Data Excel Power Query Power Query for Parsing Data Data Models Screen 1In Excel 2010 and 2013 need to install the Power Query; however, in 2016 is automatically part of the Data Tab ribbon and the commands

More information

Sequence Analysis Pipeline

Sequence Analysis Pipeline Sequence Analysis Pipeline Transcript fragments 1. PREPROCESSING 2. ASSEMBLY (today) Removal of contaminants, vector, adaptors, etc Put overlapping sequence together and calculate bigger sequences 3. Analysis/Annotation

More information

ADD AND NAME WORKSHEETS

ADD AND NAME WORKSHEETS 1 INTERMEDIATE EXCEL While its primary function is to be a number cruncher, Excel is a versatile program that is used in a variety of ways. Because it easily organizes, manages, and displays information,

More information

CS 124/LINGUIST 180 From Languages to Information. Unix for Poets Dan Jurafsky

CS 124/LINGUIST 180 From Languages to Information. Unix for Poets Dan Jurafsky CS 124/LINGUIST 180 From Languages to Information Unix for Poets Dan Jurafsky (original by Ken Church, modifications by me and Chris Manning) Stanford University Unix for Poets Text is everywhere The Web

More information

Microsoft Word 2013 Working with tables

Microsoft Word 2013 Working with tables Microsoft Word 2013 Working with tables LIBRARY AND LEARNING SERVICES WORKING WITH TABLES www.eit.ac.nz/library/ls_computer_word2013_tables.html What is a table? A table is information arranged in horizontal

More information

Practical Linux Examples

Practical Linux Examples Practical Linux Examples Processing large text file Parallelization of independent tasks Qi Sun & Robert Bukowski Bioinformatics Facility Cornell University http://cbsu.tc.cornell.edu/lab/doc/linux_examples_slides.pdf

More information

Basic Shell Scripting Practice. HPC User Services LSU HPC & LON March 2018

Basic Shell Scripting Practice. HPC User Services LSU HPC & LON March 2018 Basic Shell Scripting Practice HPC User Services LSU HPC & LON sys-help@loni.org March 2018 Quotation Exercise 1. Print out your $LOGNAME 2. Print date 3. Print `who am i` 4. Print your current directory

More information

Rich Text Editor Quick Reference

Rich Text Editor Quick Reference Rich Text Editor Quick Reference Introduction Using the rich text editor is similar to using a word processing application such as Microsoft Word. After data is typed into the editing area it can be formatted

More information

Technology Webinar. Integrating Spreadsheets into Core Curriculum. Part 1

Technology Webinar. Integrating Spreadsheets into Core Curriculum. Part 1 Technology Webinar Integrating Spreadsheets into Core Curriculum Part 1 Online Workshop Adobe Connect overview Core curriculum TEKS Spreadsheet basics Cell cell name Column and row Entering data into a

More information

CSC2100-Data Structures

CSC2100-Data Structures CSC2100-Data Structures Final Remarks Department of Computer Science and Engineering The Chinese University of Hong Kong, Shatin, New Territories Interesting Topics More Graph Algorithms Finding cycles,

More information

Excel 2013 Next Steps

Excel 2013 Next Steps Excel 2013 Next Steps ADULT SERVICES DEPARTMENT CRYSTAL LAKE PUBLIC LIBRARY 126 W. PADDOCK STREET CRYSTAL LAKE, IL 60014 815-459-1687, X7 WWW.CLPL.ORG Agenda 2 Home Toolbar Alignment Group Number Formats

More information

Workshop Practical on concatenation and model testing

Workshop Practical on concatenation and model testing Workshop Practical on concatenation and model testing Jacob L. Steenwyk & Antonis Rokas Programs that you will use: Bash, Python, Perl, Phyutility, PartitionFinder, awk To infer a putative species phylogeny

More information

7 CREATING QUERY WITH QUERY WIZARD AND QUERY DESIGNER

7 CREATING QUERY WITH QUERY WIZARD AND QUERY DESIGNER 7 CREATING QUERY WITH QUERY WIZARD AND QUERY DESIGNER 7.1 INTRODUCTION Query is the most powerful feature of any database. A Query is a set of instructions in a logical order, required to produce the output

More information

INFORMATION TECHNOLOGY 402 UNIT IV SPREADSHEET

INFORMATION TECHNOLOGY 402 UNIT IV SPREADSHEET INFORMATION TECHNOLOGY 402 UNIT IV SPREADSHEET AUTOSUM AutoSum is a function in Microsoft Excel and other spreadsheet programs that automatically enters the appropriate formula or function into your spreadsheet.

More information

Working with Cells, Rows, and Columns

Working with Cells, Rows, and Columns Working with Cells, Rows, and Columns It is important to remember that there is no way to undo actions in an EQSS. Before making changes you are unsure of, you might want to save the page, so that you

More information

Merge Conflicts p. 92 More GitHub Workflows: Forking and Pull Requests p. 97 Using Git to Make Life Easier: Working with Past Commits p.

Merge Conflicts p. 92 More GitHub Workflows: Forking and Pull Requests p. 97 Using Git to Make Life Easier: Working with Past Commits p. Preface p. xiii Ideology: Data Skills for Robust and Reproducible Bioinformatics How to Learn Bioinformatics p. 1 Why Bioinformatics? Biology's Growing Data p. 1 Learning Data Skills to Learn Bioinformatics

More information

Week Overview. Simple filter commands: head, tail, cut, sort, tr, wc grep utility stdin, stdout, stderr Redirection and piping /dev/null file

Week Overview. Simple filter commands: head, tail, cut, sort, tr, wc grep utility stdin, stdout, stderr Redirection and piping /dev/null file ULI101 Week 05 Week Overview Simple filter commands: head, tail, cut, sort, tr, wc grep utility stdin, stdout, stderr Redirection and piping /dev/null file head and tail commands These commands display

More information

Sorting Pearson Education, Inc. All rights reserved.

Sorting Pearson Education, Inc. All rights reserved. 1 19 Sorting 2 19.1 Introduction (Cont.) Sorting data Place data in order Typically ascending or descending Based on one or more sort keys Algorithms Insertion sort Selection sort Merge sort More efficient,

More information

WebIntelligence. Creating Documents

WebIntelligence. Creating Documents Creating Documents This page is intentionally left blank. 2 WIC110904 Table of Contents Lesson Objective... 5 For Assistance...6 Introduction... 7 Document Editor... 7 Designing a Query Flowchart... 9

More information

Excel Tools Features... 1 Comments... 2 List Comments Formatting... 3 Center Across... 3 Hide Blank Rows... 3 Lists... 3 Sheet Links...

Excel Tools Features... 1 Comments... 2 List Comments Formatting... 3 Center Across... 3 Hide Blank Rows... 3 Lists... 3 Sheet Links... CONTEXTURES EXCEL TOOLS FEATURES LIST PAGE 1 Excel Tools Features The following features are contained in the Excel Tools Add-in. Excel Tools Features... 1 Comments... 2 List Comments... 2 Comments...

More information

Creating Accessible Word Documents Tutorial

Creating Accessible Word Documents Tutorial Creating Accessible Word Documents Tutorial 1. Use uniform heading structure/style guides to reinforce structure To keep trail of the structure, you can open the Navigation Pane. Edit built-in heading

More information

Word 2007 Tables Part 2

Word 2007 Tables Part 2 Word 2007 Tables Part 2 In this lesson you will learn to use formulas within tables, change the size and positions of a tables, convert information from table form to text form and vice versa, insert clipart

More information

The Streetscape User Guide Dynamic Watch List

The Streetscape User Guide Dynamic Watch List Overview The Streetscape User Guide 1.756501.100 The enables you to track and monitor securities by grouping them into lists or portfolios based on one or more common characteristics. You can create an

More information

DAY 7: EXCEL CHAPTER 5. Divya Ganesan February 5, 2013

DAY 7: EXCEL CHAPTER 5. Divya Ganesan February 5, 2013 DAY 7: EXCEL CHAPTER 5 Divya Ganesan divya.ganesan@mail.wvu.edu February 5, 2013 1 FREEZING ROWS AND COLUMNS Freezing keeps rows and columns visible during scrolling Click View tab in Ribbon Click on Freeze

More information

Using the Galaxy Local Bioinformatics Cloud at CARC

Using the Galaxy Local Bioinformatics Cloud at CARC Using the Galaxy Local Bioinformatics Cloud at CARC Lijing Bu Sr. Research Scientist Bioinformatics Specialist Center for Evolutionary and Theoretical Immunology (CETI) Department of Biology, University

More information

Essential Linux Shell Commands

Essential Linux Shell Commands Essential Linux Shell Commands Special Characters Quoting and Escaping Change Directory Show Current Directory List Directory Contents Working with Files Working with Directories Special Characters There

More information

Decision Logic: if, if else, switch, Boolean conditions and variables

Decision Logic: if, if else, switch, Boolean conditions and variables CS 1044 roject 4 Summer I 2007 Decision Logic: if, if else, switch, Boolean conditions and variables This programming assignment uses many of the ideas presented in sections 3 through 5 of the course notes,

More information

Frequency tables Create a new Frequency Table

Frequency tables Create a new Frequency Table Frequency tables Create a new Frequency Table Contents FREQUENCY TABLES CREATE A NEW FREQUENCY TABLE... 1 Results Table... 2 Calculate Descriptive Statistics for Frequency Tables... 6 Transfer Results

More information

Department of Computer Science and Technology

Department of Computer Science and Technology M.Sc. (CA) (2 nd Semester) 040020202 : UNIX Internals and Shell Programming Teaching Schedule Objective: To acquaint the students with the basic internal structure & operations of UNIX operating system,

More information

UNIX / LINUX - REGULAR EXPRESSIONS WITH SED

UNIX / LINUX - REGULAR EXPRESSIONS WITH SED UNIX / LINUX - REGULAR EXPRESSIONS WITH SED http://www.tutorialspoint.com/unix/unix-regular-expressions.htm Copyright tutorialspoint.com Advertisements In this chapter, we will discuss in detail about

More information

Access Groups. Collect and Store. Text Currency Date/Time. Tables Fields Data Type. You Your Friend Your Parent. Unique information

Access Groups. Collect and Store. Text Currency Date/Time. Tables Fields Data Type. You Your Friend Your Parent. Unique information Tutorial A database is a computerized record keeping system used to collect, store, analyze and report electronic information for a variety of purposes. Microsoft Access is a database. There are three

More information

In this document, you will learn how to take a Microsoft Word Document and make it accessible and available as a PDF.

In this document, you will learn how to take a Microsoft Word Document and make it accessible and available as a PDF. Accessibility Creating Accessible PDFs using Microsoft Word What is PDF Accessibility? Accessibility is a general term used to describe the degree to which a product, device, service, or environment is

More information

Using Reports and Graphs

Using Reports and Graphs Using Reports and Graphs Information in this section explains how to generate and use PCS Axis reports and graphs. The information is intended for PCS Axis users with SysAdmin, User, and Read Only user

More information

A Brief Introduction to the Linux Shell for Data Science

A Brief Introduction to the Linux Shell for Data Science A Brief Introduction to the Linux Shell for Data Science Aris Anagnostopoulos 1 Introduction Here we will see a brief introduction of the Linux command line or shell as it is called. Linux is a Unix-like

More information

sottotitolo A.A. 2016/17 Federico Reghenzani, Alessandro Barenghi

sottotitolo A.A. 2016/17 Federico Reghenzani, Alessandro Barenghi Titolo presentazione Piattaforme Software per la Rete sottotitolo BASH Scripting Milano, XX mese 20XX A.A. 2016/17, Alessandro Barenghi Outline 1) Introduction to BASH 2) Helper commands 3) Control Flow

More information

Human Resource Management System User Guide

Human Resource Management System User Guide 11.0 Human Resource Management System User Guide Unit 0: Introduction Unit 1: HRMS Basics Unit 2: DateTracking Unit 3: Hiring a New Employee Unit 4: Electronic Approvals Unit 5: Maintaining Existing Employees

More information

SortMeRNA User Manual

SortMeRNA User Manual SortMeRNA User Manual Evguenia Kopylova evguenia.kopylova@lifl.fr January 2013 1 Contents 1 Introduction 3 2 Installation 3 2.1 Required g++ compiler version............................... 3 2.1.1 Ubuntu

More information

Reading and manipulating files

Reading and manipulating files Reading and manipulating files Goals By the end of this lesson you will be able to Read files without using text editors Access specific parts of files Count the number of words and lines in a file Sort

More information

Access Groups. Collect and Store. Text Currency Date/Time. Tables Fields Data Type. You Your Friend Your Parent. Unique information

Access Groups. Collect and Store. Text Currency Date/Time. Tables Fields Data Type. You Your Friend Your Parent. Unique information Tutorial A database is a computerized record keeping system used to collect, store, analyze and report electronic information for a variety of purposes. Microsoft Access is a database. There are three

More information

Practical Linux examples: Exercises

Practical Linux examples: Exercises Practical Linux examples: Exercises 1. Login (ssh) to the machine that you are assigned for this workshop (assigned machines: https://cbsu.tc.cornell.edu/ww/machines.aspx?i=87 ). Prepare working directory,

More information

Unleashing the Shell Hands-On UNIX System Administration DeCal Week 6 28 February 2011

Unleashing the Shell Hands-On UNIX System Administration DeCal Week 6 28 February 2011 Unleashing the Shell Hands-On UNIX System Administration DeCal Week 6 28 February 2011 Last time Compiling software and the three-step procedure (./configure && make && make install). Dependency hell and

More information

Examining De Novo Transcriptome Assemblies via a Quality Assessment Pipeline

Examining De Novo Transcriptome Assemblies via a Quality Assessment Pipeline Examining De Novo Transcriptome Assemblies via a Quality Assessment Pipeline Noushin Ghaffari, Osama A. Arshad, Hyundoo Jeong, John Thiltges, Michael F. Criscitiello, Byung-Jun Yoon, Aniruddha Datta, Charles

More information

The Professional Services Of Dojo Technology. Spreadsheet Files

The Professional Services Of Dojo Technology. Spreadsheet Files The Professional Services Of Dojo Technology Spreadsheet Files File Conversion Solutions This document serves as an opportunity to introduce the custom solutions that have been developed by Dojo for processing

More information

STIDistrict Query (Basic)

STIDistrict Query (Basic) STIDistrict Query (Basic) Creating a Basic Query To create a basic query in the Query Builder, open the STIDistrict workstation and click on Utilities Query Builder. When the program opens, database objects

More information

EXCELLING WITH ANALYSIS AND VISUALIZATION

EXCELLING WITH ANALYSIS AND VISUALIZATION EXCELLING WITH ANALYSIS AND VISUALIZATION A PRACTICAL GUIDE FOR DEALING WITH DATA Prepared by Ann K. Emery July 2016 Ann K. Emery 1 Welcome Hello there! In July 2016, I led two workshops Excel Basics for

More information

Lecture 11. Lecture 11: External Sorting

Lecture 11. Lecture 11: External Sorting Lecture 11 Lecture 11: External Sorting Lecture 11 Announcements 1. Midterm Review: This Friday! 2. Project Part #2 is out. Implement CLOCK! 3. Midterm Material: Everything up to Buffer management. 1.

More information

Linux command line basics III: piping commands for text processing. Yanbin Yin Fall 2015

Linux command line basics III: piping commands for text processing. Yanbin Yin Fall 2015 Linux command line basics III: piping commands for text processing Yanbin Yin Fall 2015 1 h.p://korflab.ucdavis.edu/unix_and_perl/unix_and_perl_v3.1.1.pdf 2 The beauty of Unix for bioinformagcs sort, cut,

More information

Go back to your Excel sheet. Choose Paste to Sheet tab at the bottom.

Go back to your Excel sheet. Choose Paste to Sheet tab at the bottom. PCC: How to easily calculate monthly weights. All names on this report are fictitious to protect patient information. The images contained are from a Mac computer, if you use a PC and have difficulty with

More information

Introduction to Linux. Roman Cheplyaka

Introduction to Linux. Roman Cheplyaka Introduction to Linux Roman Cheplyaka Generic commands, files, directories What am I running? ngsuser@ubuntu:~$ cat /etc/lsb-release DISTRIB_ID=Ubuntu DISTRIB_RELEASE=16.04 DISTRIB_CODENAME=xenial DISTRIB_DESCRIPTION="Ubuntu

More information

Chapter 4. Microsoft Excel

Chapter 4. Microsoft Excel Chapter 4 Microsoft Excel Topic Introduction Spreadsheet Basic Screen Layout Modifying a Worksheet Formatting Cells Formulas and Functions Sorting and Filling Borders and Shading Charts Introduction A

More information

CSE2031. Lab 2 FALL 2009

CSE2031. Lab 2 FALL 2009 CSE2031 Lab 2 FALL 2009 In this lab, you will be introduced to more complex Unix commands. After this lab, you should be comfortable using Unix/Linux in the lab and as a platform for software development.

More information

Getting Started with Microsoft Excel 2013

Getting Started with Microsoft Excel 2013 2015 Bow Valley College 1 Microsoft Excel Vocabulary Getting Started with Microsoft Excel 2013 Column: A grouping of information or data organized from top to bottom. In Excel columns are named with letters

More information

Dealing with the way Mail Merge changed in MS Word 2003

Dealing with the way Mail Merge changed in MS Word 2003 Dealing with the way Mail Merge changed in MS Word 2003 Go From This: To This: The New and Improved Mail Merge Mail Merge has changed dramatically from the older versions of Word. They just forgot to tell

More information

"Bash vs Python Throwdown" -or- "How you can accomplish common tasks using each of these tools" Bash Examples. Copying a file: $ cp file1 file2

Bash vs Python Throwdown -or- How you can accomplish common tasks using each of these tools Bash Examples. Copying a file: $ cp file1 file2 "Bash vs Python Throwdown" -or- "How you can accomplish common tasks using each of these tools" Bash Examples Copying a file: $ cp file1 file2 Wrangling "csv" files: Consider a file named 20140209.csv

More information