Metasearch Process for Transcription Targets

Size: px
Start display at page:

Download "Metasearch Process for Transcription Targets"

Transcription

1 Step 1 Select 'Genes' This is the primary interface for the Metasearch add on to Thomson Reuters (GeneGO) platform. Metasearch allows one to make complex queries for information extraction. This document will walk you through how to do that in order to curate out transcription factor downstream genes, ie what genes does my transcription factor of interest regulate? Metasearch Process for Transcription Targets Page 1

2 Step 2 Constrain to 'Human' We want to constrain to human as that is our model system. Can be a litttle less stringent and include the other species to but that would have to convert those genes back to human ids. Metasearch Process for Transcription Targets Page 2

3 Step 3 Select 'interact downstream with' We chose this filter as we want genes that are 'downstream' from our Transcription factor because we are interested in genes being regulated. The upstream selection would select those genes that regulate our transcription factor. Metasearch Process for Transcription Targets Page 3

4 Step 4 - Filters for 'interact with downstream with' relations to Transcription Factor 1. Select 'Human' and 'Human specific' to constrain relation to an observation made in human model system. 2. The effect of relation from Transcription factor to target gene. 3. For finding genes regulated by transcription factor two mechanism are appropriate: 'Transcription regulation' and 'Influence on expression' Definitions Effect 'Unspecified': Direct interaction between two proteins via an unknown mechanism or indirect interaction between two proteins via unknown intermediate signal protein. Mechanism Direct 'Transcription regualtion': A change in gene expression levels by altering transcription rates regulated by transcription factors that physically bind to specific regulatory sequences of target genes. One of the direct interaction mechanisms in MetaCore. Mechanism Indirect 'Influence on expression': In MetaCore, change in expression level of a gene (target gene) caused by a protein or compound. One of the indirect interaction mechanisms in MetaCore. Metasearch Process for Transcription Targets Page 4

5 One can chose different combinations of these filters. It is dependent on what is being looked for. For example, if one wants high confidence downstream targets that are inhibited by your transcription factor of interest one would chose 'human' 'human specific' 'Inhibition' 'Transcription regulation' Step 5 - Example of 'Human' 'Human specific' 'Activation' 'Transcription regulation' Note the 'use high trust interactions only' box. This is an annotation stringency filter to observations in Metacore database. I leave it checked by default. Metasearch Process for Transcription Targets Page 5

6 Step 6 Select 'Network Objects' for Transcription Factor selection. A network object is a convention in Metacore to represent molecular entities. It allows mapping of multiple genes to a network for visualization. For example, NFkB is a transcription factor but it consists of the partnering of a number of protein gene products that come together in various ways. NFkB network object would encompass all of those, rather than just RELA for example. Picking the network object will capture more specific information rather than single genes by themselves. Metasearch Process for Transcription Targets Page 6

7 Step 7 Constrain TF 'Network Object' to 'Human' 'Human specific only' Again, 'Human specific only' keeps data strictly for human. Metasearch Process for Transcription Targets Page 7

8 Step 8 Select your Transcription Factor 'Network Object' Search box has autocomplete fucntions for what you are searching for proper matching. Metasearch Process for Transcription Targets Page 8

9 Step 9 Final search screen Metasearch Process for Transcription Targets Page 9

10 Step 10 Search Result Screeen Metasearch Process for Transcription Targets Page 10

11 Step 11 Export 1. Hit this to bring up the Export dialog window. Metasearch Process for Transcription Targets Page 11

12 Step 12 Select Export Options 1. Select this to get query results as they appear in search result screen. 2. Make sure to select all rows, as there is usually more than one page of results. Metasearch Process for Transcription Targets Page 12

13 Step 13 Final Output File Metasearch Process for Transcription Targets Page 13

Genome Browsers - The UCSC Genome Browser

Genome Browsers - The UCSC Genome Browser Genome Browsers - The UCSC Genome Browser Background The UCSC Genome Browser is a well-curated site that provides users with a view of gene or sequence information in genomic context for a specific species,

More information

NetWalker Genomic Data Integration Platform. User Guide

NetWalker Genomic Data Integration Platform. User Guide NetWalker Genomic Data Integration Platform User Guide Table of Contents NetWalker Genomic Data Integration Platform... 0 General Object Structure and software layout... 1 1. NetWalker Interactome Knowledgebase...

More information

You will be re-directed to the following result page.

You will be re-directed to the following result page. ENCODE Element Browser Goal: to navigate the candidate DNA elements predicted by the ENCODE consortium, including gene expression, DNase I hypersensitive sites, TF binding sites, and candidate enhancers/promoters.

More information

Finding and Exporting Data. BioMart

Finding and Exporting Data. BioMart September 2017 Finding and Exporting Data Not sure what tool to use to find and export data? BioMart is used to retrieve data for complex queries, involving a few or many genes or even complete genomes.

More information

Boolean Network Modeling

Boolean Network Modeling Boolean Network Modeling Bioinformatics: Sequence Analysis COMP 571 - Spring 2015 Luay Nakhleh, Rice University Gene Regulatory Networks Gene regulatory networks describe the molecules involved in gene

More information

VectorBase Web Apollo April Web Apollo 1

VectorBase Web Apollo April Web Apollo 1 Web Apollo 1 Contents 1. Access points: Web Apollo, Genome Browser and BLAST 2. How to identify genes that need to be annotated? 3. Gene manual annotations 4. Metadata 1. Access points Web Apollo tool

More information

Min Wang. April, 2003

Min Wang. April, 2003 Development of a co-regulated gene expression analysis tool (CREAT) By Min Wang April, 2003 Project Documentation Description of CREAT CREAT (coordinated regulatory element analysis tool) are developed

More information

Exercises. Biological Data Analysis Using InterMine workshop exercises with answers

Exercises. Biological Data Analysis Using InterMine workshop exercises with answers Exercises Biological Data Analysis Using InterMine workshop exercises with answers Exercise1: Faceted Search Use HumanMine for this exercise 1. Search for one or more of the following using the keyword

More information

Pathway Studio Quick Start Guide

Pathway Studio Quick Start Guide Pathway Studio Quick Start Guide This Quick Start Guide is for users of the Pathway Studio 4.0 pathway analysis software. The Quick Start Guide demonstrates the key features of the software and provides

More information

Tutorial: chloroplast genomes

Tutorial: chloroplast genomes Tutorial: chloroplast genomes Stacia Wyman Department of Computer Sciences Williams College Williamstown, MA 01267 March 10, 2005 ASSUMPTIONS: You are using Internet Explorer under OS X on the Mac. You

More information

INTRODUCTION TO BIOINFORMATICS

INTRODUCTION TO BIOINFORMATICS Molecular Biology-2019 1 INTRODUCTION TO BIOINFORMATICS In this section, we want to provide a simple introduction to using the web site of the National Center for Biotechnology Information NCBI) to obtain

More information

ViTraM: VIsualization of TRAnscriptional Modules

ViTraM: VIsualization of TRAnscriptional Modules ViTraM: VIsualization of TRAnscriptional Modules Version 2.0 October 1st, 2009 KULeuven, Belgium 1 Contents 1 INTRODUCTION AND INSTALLATION... 4 1.1 Introduction...4 1.2 Software structure...5 1.3 Requirements...5

More information

ViTraM: VIsualization of TRAnscriptional Modules

ViTraM: VIsualization of TRAnscriptional Modules ViTraM: VIsualization of TRAnscriptional Modules Version 1.0 June 1st, 2009 Hong Sun, Karen Lemmens, Tim Van den Bulcke, Kristof Engelen, Bart De Moor and Kathleen Marchal KULeuven, Belgium 1 Contents

More information

HymenopteraMine Documentation

HymenopteraMine Documentation HymenopteraMine Documentation Release 1.0 Aditi Tayal, Deepak Unni, Colin Diesh, Chris Elsik, Darren Hagen Apr 06, 2017 Contents 1 Welcome to HymenopteraMine 3 1.1 Overview of HymenopteraMine.....................................

More information

Tutorial:OverRepresentation - OpenTutorials

Tutorial:OverRepresentation - OpenTutorials Tutorial:OverRepresentation From OpenTutorials Slideshow OverRepresentation (about 12 minutes) (http://opentutorials.rbvi.ucsf.edu/index.php?title=tutorial:overrepresentation& ce_slide=true&ce_style=cytoscape)

More information

CS313 Exercise 4 Cover Page Fall 2017

CS313 Exercise 4 Cover Page Fall 2017 CS313 Exercise 4 Cover Page Fall 2017 Due by the start of class on Thursday, October 12, 2017. Name(s): In the TIME column, please estimate the time you spent on the parts of this exercise. Please try

More information

bcnql: A Query Language for Biochemical Network Hong Yang, Rajshekhar Sunderraman, Hao Tian Computer Science Department Georgia State University

bcnql: A Query Language for Biochemical Network Hong Yang, Rajshekhar Sunderraman, Hao Tian Computer Science Department Georgia State University bcnql: A Query Language for Biochemical Network Hong Yang, Rajshekhar Sunderraman, Hao Tian Computer Science Department Georgia State University Introduction Outline Graph Data Model Query Language for

More information

The genexplain platform. Workshop SW2: Pathway Analysis in Transcriptomics, Proteomics and Metabolomics

The genexplain platform. Workshop SW2: Pathway Analysis in Transcriptomics, Proteomics and Metabolomics The genexplain platform Workshop SW2: Pathway Analysis in Transcriptomics, Proteomics and Metabolomics Saturday, March 17, 2012 2 genexplain GmbH Am Exer 10b D-38302 Wolfenbüttel Germany E-mail: olga.kel-margoulis@genexplain.com,

More information

Annotating a single sequence

Annotating a single sequence BioNumerics Tutorial: Annotating a single sequence 1 Aim The annotation application in BioNumerics has been designed for the annotation of coding regions on sequences. In this tutorial you will learn how

More information

Wilson Leung 01/03/2018 An Introduction to NCBI BLAST. Prerequisites: Detecting and Interpreting Genetic Homology: Lecture Notes on Alignment

Wilson Leung 01/03/2018 An Introduction to NCBI BLAST. Prerequisites: Detecting and Interpreting Genetic Homology: Lecture Notes on Alignment An Introduction to NCBI BLAST Prerequisites: Detecting and Interpreting Genetic Homology: Lecture Notes on Alignment Resources: The BLAST web server is available at https://blast.ncbi.nlm.nih.gov/blast.cgi

More information

Contractual Approaches to Data Protection in Clinical Research Projects

Contractual Approaches to Data Protection in Clinical Research Projects Contractual Approaches to Data Protection in Clinical Research Projects EICAR, 24th Annual Conference Nürnberg, October 2016 Dr. jur. Marc Stauch Institute for Legal Informatics Leibniz Universität Hannover

More information

Machine Learning. Computational biology: Sequence alignment and profile HMMs

Machine Learning. Computational biology: Sequence alignment and profile HMMs 10-601 Machine Learning Computational biology: Sequence alignment and profile HMMs Central dogma DNA CCTGAGCCAACTATTGATGAA transcription mrna CCUGAGCCAACUAUUGAUGAA translation Protein PEPTIDE 2 Growth

More information

Locality-sensitive hashing and biological network alignment

Locality-sensitive hashing and biological network alignment Locality-sensitive hashing and biological network alignment Laura LeGault - University of Wisconsin, Madison 12 May 2008 Abstract Large biological networks contain much information about the functionality

More information

BovineMine Documentation

BovineMine Documentation BovineMine Documentation Release 1.0 Deepak Unni, Aditi Tayal, Colin Diesh, Christine Elsik, Darren Hag Oct 06, 2017 Contents 1 Tutorial 3 1.1 Overview.................................................

More information

Tutorial: How to use the Wheat TILLING database

Tutorial: How to use the Wheat TILLING database Tutorial: How to use the Wheat TILLING database Last Updated: 9/7/16 1. Visit http://dubcovskylab.ucdavis.edu/wheat_blast to go to the BLAST page or click on the Wheat BLAST button on the homepage. 2.

More information

Tutorial 4 BLAST Searching the CHO Genome

Tutorial 4 BLAST Searching the CHO Genome Tutorial 4 BLAST Searching the CHO Genome Accessing the CHO Genome BLAST Tool The CHO BLAST server can be accessed by clicking on the BLAST button on the home page or by selecting BLAST from the menu bar

More information

INTRODUCTION TO BIOINFORMATICS

INTRODUCTION TO BIOINFORMATICS Molecular Biology-2017 1 INTRODUCTION TO BIOINFORMATICS In this section, we want to provide a simple introduction to using the web site of the National Center for Biotechnology Information NCBI) to obtain

More information

Tutorial for Windows and Macintosh SNP Hunting

Tutorial for Windows and Macintosh SNP Hunting Tutorial for Windows and Macintosh SNP Hunting 2017 Gene Codes Corporation Gene Codes Corporation 525 Avis Drive, Ann Arbor, MI 48108 USA 1.800.497.4939 (USA) +1.734.769.7249 (elsewhere) +1.734.769.7074

More information

efip online Help Document

efip online Help Document efip online Help Document University of Delaware Computer and Information Sciences & Center for Bioinformatics and Computational Biology Newark, DE, USA December 2013 K K S I K K Table of Contents INTRODUCTION...

More information

CyKEGGParser User Manual

CyKEGGParser User Manual CyKEGGParser User Manual Table of Contents Introduction... 3 Development... 3 Citation... 3 License... 3 Getting started... 4 Pathway loading... 4 Laoding KEGG pathways from local KGML files... 4 Importing

More information

Bioinformatics Hubs on the Web

Bioinformatics Hubs on the Web Bioinformatics Hubs on the Web Take a class The Galter Library teaches a related class called Bioinformatics Hubs on the Web. See our Classes schedule for the next available offering. If this class is

More information

Network Analysis, Visualization, & Graphing TORonto (NAViGaTOR) User Documentation

Network Analysis, Visualization, & Graphing TORonto (NAViGaTOR) User Documentation Network Analysis, Visualization, & Graphing TORonto (NAViGaTOR) User Documentation Jurisica Lab, Ontario Cancer Institute http://ophid.utoronto.ca/navigator/ November 10, 2006 Contents 1 Introduction 2

More information

MetaCore Training Manual

MetaCore Training Manual MetaCore Training Manual Version 5.0 GeneGo, Inc. 500 Renaissance Dr., Ste. 106, St. Joseph, MI 49085 Phone: 888-59-314, 858 756 7996, 69-983-7869 or +447786150699 Fax: 69-983-7654 customersupport@genego.com

More information

Network analysis. Martina Kutmon Department of Bioinformatics Maastricht University

Network analysis. Martina Kutmon Department of Bioinformatics Maastricht University Network analysis Martina Kutmon Department of Bioinformatics Maastricht University What's gonna happen today? Network Analysis Introduction Quiz Hands-on session ConsensusPathDB interaction database Outline

More information

Gene regulation. DNA is merely the blueprint Shared spatially (among all tissues) and temporally But cells manage to differentiate

Gene regulation. DNA is merely the blueprint Shared spatially (among all tissues) and temporally But cells manage to differentiate Gene regulation DNA is merely the blueprint Shared spatially (among all tissues) and temporally But cells manage to differentiate Especially but not only during developmental stage And cells respond to

More information

Tutorial 1: Exploring the UCSC Genome Browser

Tutorial 1: Exploring the UCSC Genome Browser Last updated: May 12, 2011 Tutorial 1: Exploring the UCSC Genome Browser Open the homepage of the UCSC Genome Browser at: http://genome.ucsc.edu/ In the blue bar at the top, click on the Genomes link.

More information

Package TDCor. October 26, 2015

Package TDCor. October 26, 2015 Type Package Package TDCor October 26, 2015 Title Gene Network Inference from Time-Series Transcriptomic Data Version 0.1-2 Date 2015-10-05 Author Julien Lavenus Maintainer Mikael Lucas

More information

Getting Started with Multiseq

Getting Started with Multiseq Getting Started with Multiseq Requirements MultiSeq must be correctly installed and configured before you can begin using it to analyze the evolution of protein structure. This section walks you through

More information

The GENIA corpus Linguistic and Semantic Annotation of Biomedical Literature. Jin-Dong Kim Tsujii Laboratory, University of Tokyo

The GENIA corpus Linguistic and Semantic Annotation of Biomedical Literature. Jin-Dong Kim Tsujii Laboratory, University of Tokyo The GENIA corpus Linguistic and Semantic Annotation of Biomedical Literature Jin-Dong Kim Tsujii Laboratory, University of Tokyo Contents Ontology, Corpus and Annotation for IE Annotation and Information

More information

Tutorial: Building up and querying databases

Tutorial: Building up and querying databases Tutorial: Building up and querying databases Objectives During this tutorial you will build a custom database on data retrieved from the BioMart portal. BioMart provides a data acquisition and mining platform,

More information

Lecture 5. Functional Analysis with Blast2GO Enriched functions. Kegg Pathway Analysis Functional Similarities B2G-Far. FatiGO Babelomics.

Lecture 5. Functional Analysis with Blast2GO Enriched functions. Kegg Pathway Analysis Functional Similarities B2G-Far. FatiGO Babelomics. Lecture 5 Functional Analysis with Blast2GO Enriched functions FatiGO Babelomics FatiScan Kegg Pathway Analysis Functional Similarities B2G-Far 1 Fisher's Exact Test One Gene List (A) The other list (B)

More information

Exercises: Motif Searching

Exercises: Motif Searching Exercises: Motif Searching Version 2019-02 Exercises: Motif Searching 2 Licence This manual is 2016-17, Simon Andrews. This manual is distributed under the creative commons Attribution-Non-Commercial-Share

More information

MetaStorm: User Manual

MetaStorm: User Manual MetaStorm: User Manual User Account: First, either log in as a guest or login to your user account. If you login as a guest, you can visualize public MetaStorm projects, but can not run any analysis. To

More information

Tutorial:Basic Expression Analysis in Cytoscape

Tutorial:Basic Expression Analysis in Cytoscape Tutorial:Basic Expression Analysis in Cytoscape 1 Tutorial:Basic Expression Analysis in Cytoscape Slideshow Basic Expression Analysis in Cytoscape (30 min) [1] Handout Basic_Expression_Analysis_in_Cytoscape.pdf

More information

SEEK User Manual. Introduction

SEEK User Manual. Introduction SEEK User Manual Introduction SEEK is a computational gene co-expression search engine. It utilizes a vast human gene expression compendium to deliver fast, integrative, cross-platform co-expression analyses.

More information

7.36/7.91/20.390/20.490/6.802/6.874 PROBLEM SET 3. Gibbs Sampler, RNA secondary structure, Protein Structure with PyRosetta, Connections (25 Points)

7.36/7.91/20.390/20.490/6.802/6.874 PROBLEM SET 3. Gibbs Sampler, RNA secondary structure, Protein Structure with PyRosetta, Connections (25 Points) 7.36/7.91/20.390/20.490/6.802/6.874 PROBLEM SET 3. Gibbs Sampler, RNA secondary structure, Protein Structure with PyRosetta, Connections (25 Points) Due: Thursday, April 3 th at noon. Python Scripts All

More information

Package rgreat. June 19, 2018

Package rgreat. June 19, 2018 Type Package Title Client for GREAT Analysis Version 1.12.0 Date 2018-2-20 Author Zuguang Gu Maintainer Zuguang Gu Package rgreat June 19, 2018 Depends R (>= 3.1.2), GenomicRanges, IRanges,

More information

Open PHACTS Explorer: Pharmacology by Enzyme Family

Open PHACTS Explorer: Pharmacology by Enzyme Family Open PHACTS Explorer: Pharmacology by Enzyme Family This document is a tutorial for using Open PHACTS Explorer (explorer.openphacts.org) to obtain pharmacological information for families of enzymes classified

More information

Comparative Sequencing

Comparative Sequencing Tutorial for Windows and Macintosh Comparative Sequencing 2017 Gene Codes Corporation Gene Codes Corporation 525 Avis Drive, Ann Arbor, MI 48108 USA 1.800.497.4939 (USA) +1.734.769.7249 (elsewhere) +1.734.769.7074

More information

Supplementary Figure 1. Fast read-mapping algorithm of BrowserGenome.

Supplementary Figure 1. Fast read-mapping algorithm of BrowserGenome. Supplementary Figure 1 Fast read-mapping algorithm of BrowserGenome. (a) Indexing strategy: The genome sequence of interest is divided into non-overlapping 12-mers. A Hook table is generated that contains

More information

Editing Pathway/Genome Databases

Editing Pathway/Genome Databases Editing Pathway/Genome Databases By Ron Caspi This presentation can be found at http://bioinformatics.ai.sri.com/ptools/tutorial/sessions/ 1 Pathway Tools in Editing Mode The database is separate from

More information

Bioinformatics explained: BLAST. March 8, 2007

Bioinformatics explained: BLAST. March 8, 2007 Bioinformatics Explained Bioinformatics explained: BLAST March 8, 2007 CLC bio Gustav Wieds Vej 10 8000 Aarhus C Denmark Telephone: +45 70 22 55 09 Fax: +45 70 22 55 19 www.clcbio.com info@clcbio.com Bioinformatics

More information

BILKENT UNIVERSITY. Bilkent Center for Bioinformatics

BILKENT UNIVERSITY. Bilkent Center for Bioinformatics versiion 2.1 BILKENT UNIVERSITY Bilkent Center for Bioinformatics PATİKAweb User s Guide BILKENT UNIVERSITY - CENTER FOR BIOINFORMATICS PATIKAweb User s Guide PATIKAweb 2007 Bilkent University Center for

More information

RLIMS-P Website Help Document

RLIMS-P Website Help Document RLIMS-P Website Help Document Table of Contents Introduction... 1 RLIMS-P architecture... 2 RLIMS-P interface... 2 Login...2 Input page...3 Results Page...4 Text Evidence/Curation Page...9 URL: http://annotation.dbi.udel.edu/text_mining/rlimsp2/

More information

What s New Essential Studio Reporting Edition

What s New Essential Studio Reporting Edition What s New Essential Studio Reporting Edition Table of Contents Essential XlsIO... 3 Essential PDF... 5 Essential DocIO... 6 Report Viewer for WPF... 7 Report Designer for WPF... 9 Essential RDLIO... 15

More information

CACAO Training. Jim Hu and Suzi Aleksander Spring 2016

CACAO Training. Jim Hu and Suzi Aleksander Spring 2016 CACAO Training Jim Hu and Suzi Aleksander Spring 2016 1 What is CACAO? Community Assessment of Community Annotation with Ontologies (CACAO) Annotation of gene function Competition Within a class Between

More information

Special course in Computer Science: Advanced Text Algorithms

Special course in Computer Science: Advanced Text Algorithms Special course in Computer Science: Advanced Text Algorithms Lecture 6: Alignments Elena Czeizler and Ion Petre Department of IT, Abo Akademi Computational Biomodelling Laboratory http://www.users.abo.fi/ipetre/textalg

More information

Introduction to Genome Browsers

Introduction to Genome Browsers Introduction to Genome Browsers Rolando Garcia-Milian, MLS, AHIP (Rolando.milian@ufl.edu) Department of Biomedical and Health Information Services Health Sciences Center Libraries, University of Florida

More information

PROVIEW PRACTICE SERIES GLOBAL USER GUIDE

PROVIEW PRACTICE SERIES GLOBAL USER GUIDE PROVIEW PRACTICE SERIES GLOBAL USER GUIDE Thomson Reuters ProView is the premier ebook experience for professionals worldwide. ProView has an expanding list of titles across 17 countries, currently supports

More information

@Note2 tutorial. Hugo Costa Ruben Rodrigues Miguel Rocha

@Note2 tutorial. Hugo Costa Ruben Rodrigues Miguel Rocha @Note2 tutorial Hugo Costa (hcosta@silicolife.com) Ruben Rodrigues (pg25227@alunos.uminho.pt) Miguel Rocha (mrocha@di.uminho.pt) 23-01-2018 The document presents a typical workflow using @Note2 platform

More information

mpmorfsdb: A database of Molecular Recognition Features (MoRFs) in membrane proteins. Introduction

mpmorfsdb: A database of Molecular Recognition Features (MoRFs) in membrane proteins. Introduction mpmorfsdb: A database of Molecular Recognition Features (MoRFs) in membrane proteins. Introduction Molecular Recognition Features (MoRFs) are short, intrinsically disordered regions in proteins that undergo

More information

Retina Workbench Users Guide

Retina Workbench Users Guide Retina Workbench Users Guide 1. Installing Retina Workbench 2. Launching Retina Workbench a. Starting Retina Workbench b. Registering for a new account c. Connecting to database 3. Expression data window

More information

15-780: Graduate Artificial Intelligence. Computational biology: Sequence alignment and profile HMMs

15-780: Graduate Artificial Intelligence. Computational biology: Sequence alignment and profile HMMs 5-78: Graduate rtificial Intelligence omputational biology: Sequence alignment and profile HMMs entral dogma DN GGGG transcription mrn UGGUUUGUG translation Protein PEPIDE 2 omparison of Different Organisms

More information

TAIR User guide. TAIR User Guide Version 1.0 1

TAIR User guide. TAIR User Guide Version 1.0 1 TAIR User guide TAIR User Guide Version 1.0 1 Getting Started... 3 Browser compatibility and configuration.... 3 Additional Resources... 3 Finding help documents for TAIR tools... 3 Requesting Help....

More information

User guide for GEM-TREND

User guide for GEM-TREND User guide for GEM-TREND 1. Requirements for Using GEM-TREND GEM-TREND is implemented as a java applet which can be run in most common browsers and has been test with Internet Explorer 7.0, Internet Explorer

More information

GenViewer Tutorial / Manual

GenViewer Tutorial / Manual GenViewer Tutorial / Manual Table of Contents Importing Data Files... 2 Configuration File... 2 Primary Data... 4 Primary Data Format:... 4 Connectivity Data... 5 Module Declaration File Format... 5 Module

More information

KaPPA-View 4. Manual for Beginners. ver Kazusa DNA Research Institute. The Kazusa Plant Pathway Viewer, Version 4.0

KaPPA-View 4. Manual for Beginners. ver Kazusa DNA Research Institute. The Kazusa Plant Pathway Viewer, Version 4.0 KaPPA-View 4 The Kazusa Plant Pathway Viewer, Version 4.0 Manual for Beginners ver. 1.2 Kazusa DNA Research Institute Table of Contents Table of Contents 1. Introduction... 1 1-1. Overview of KaPPA-View4...

More information

The CALBC RDF Triple store: retrieval over large literature content

The CALBC RDF Triple store: retrieval over large literature content The CALBC RDF Triple store: retrieval over large literature content Samuel Croset, Christoph Grabmüller, Chen Li, Silverstras Kavaliauskas, Dietrich Rebholz-Schuhmann croset@ebi.ac.uk 10 th December 2010,

More information

FunRich Tool Documentation

FunRich Tool Documentation FunRich Tool Documentation Version 2.1.2 Shivakumar Keerthikumar, Mohashin Pathan, Johnson Agbinya and Suresh Mathivanan Mathivanan Lab http://www.mathivananlab.org La Trobe University LIMS1 Department

More information

User Guide for DNAFORM Clone Search Engine

User Guide for DNAFORM Clone Search Engine User Guide for DNAFORM Clone Search Engine Document Version: 3.0 Dated from: 1 October 2010 The document is the property of K.K. DNAFORM and may not be disclosed, distributed, or replicated without the

More information

Structure of biological networks. Presentation by Atanas Kamburov

Structure of biological networks. Presentation by Atanas Kamburov Structure of biological networks Presentation by Atanas Kamburov Seminar Gute Ideen in der theoretischen Biologie / Systembiologie 08.05.2007 Overview Motivation Definitions Large-scale properties of cellular

More information

Tutorial 1: Using Excel to find unique values in a list

Tutorial 1: Using Excel to find unique values in a list Tutorial 1: Using Excel to find unique values in a list It is not uncommon to have a list of data that contains redundant values. Genes with multiple transcript isoforms is one example. If you are only

More information

How to Work with a Substance Answer Set

How to Work with a Substance Answer Set How to Work with a Substance Answer Set Easily identify and isolate substances of interest Quickly retrieve relevant information from the world s largest, publicly available substance database. This guide

More information

Genomic Analysis with Genome Browsers.

Genomic Analysis with Genome Browsers. Genomic Analysis with Genome Browsers http://barc.wi.mit.edu/hot_topics/ 1 Outline Genome browsers overview UCSC Genome Browser Navigating: View your list of regions in the browser Available tracks (eg.

More information

<Partner Name> RSA ARCHER GRC Platform Implementation Guide. Global-Regulation International Law Search V. 1. <Partner Product>

<Partner Name> RSA ARCHER GRC Platform Implementation Guide. Global-Regulation International Law Search V. 1. <Partner Product> RSA ARCHER GRC Platform Implementation Guide Global-Regulation Jeffrey Carlson, RSA Partner Engineering Last Modified: May 15 th, 2017 Solution Summary Global-Regulation.com

More information

SDCSB Cytoscape Workshop 12/4/2012 Keiichiro Ono

SDCSB Cytoscape Workshop 12/4/2012 Keiichiro Ono Cytoscape Basic Tutorial SDCSB Cytoscape Workshop 12/4/2012 Keiichiro Ono Navigating Cytoscape Navigating Cytoscape This section will introduce the Cytoscape user interface. First of all we will look at

More information

IPA: networks generation algorithm

IPA: networks generation algorithm IPA: networks generation algorithm Dr. Michael Shmoish Bioinformatics Knowledge Unit, Head The Lorry I. Lokey Interdisciplinary Center for Life Sciences and Engineering Technion Israel Institute of Technology

More information

Tax Library - Single Computer Install

Tax Library - Single Computer Install Tax Library - Single Computer Install Before You Install or Update Your Software One of the most important things to remember before you start updating OR reinstalling any computer software, is to turn

More information

Logging in to Checkpoint

Logging in to Checkpoint Logging in to Checkpoint 1. Launch your browser and enter the Checkpoint address in the browser location bar: http://checkpoint.tr.com The Checkpoint Login screen appears. Note: Bookmark this page or add

More information

Logging in to Checkpoint

Logging in to Checkpoint Logging in to Checkpoint 1. Launch your browser and enter the Checkpoint address in the browser location bar: http://checkpoint.tr.com The Checkpoint Login screen appears. NOTE: Bookmark this page or add

More information

IRanges and GenomicRanges An introduction

IRanges and GenomicRanges An introduction IRanges and GenomicRanges An introduction Kasper Daniel Hansen CSAMA, Brixen 2011 1 / 28 Why you should care IRanges and GRanges are data structures I use often to solve a variety of

More information

Powering Knowledge Discovery. Insights from big data with Linguamatics I2E

Powering Knowledge Discovery. Insights from big data with Linguamatics I2E Powering Knowledge Discovery Insights from big data with Linguamatics I2E Gain actionable insights from unstructured data The world now generates an overwhelming amount of data, most of it written in natural

More information

Tutorial: Using the SFLD and Cytoscape to Make Hypotheses About Enzyme Function for an Isoprenoid Synthase Superfamily Sequence

Tutorial: Using the SFLD and Cytoscape to Make Hypotheses About Enzyme Function for an Isoprenoid Synthase Superfamily Sequence Tutorial: Using the SFLD and Cytoscape to Make Hypotheses About Enzyme Function for an Isoprenoid Synthase Superfamily Sequence Requirements: 1. A web browser 2. The cytoscape program (available for download

More information

CFinder The Community / Cluster Finding Program. Users' Guide

CFinder The Community / Cluster Finding Program. Users' Guide CFinder The Community / Cluster Finding Program Users' Guide Copyright (C) Department of Biological Physics, Eötvös University, Budapest, 2005 Contents 1. General information and license...3 2. Quick start...4

More information

Huber & Bulyk, BMC Bioinformatics MS ID , Additional Methods. Installation and Usage of MultiFinder, SequenceExtractor and BlockFilter

Huber & Bulyk, BMC Bioinformatics MS ID , Additional Methods. Installation and Usage of MultiFinder, SequenceExtractor and BlockFilter Installation and Usage of MultiFinder, SequenceExtractor and BlockFilter I. Introduction: MultiFinder is a tool designed to combine the results of multiple motif finders and analyze the resulting motifs

More information

Homology Modeling FABP

Homology Modeling FABP Homology Modeling FABP Homology modeling is a technique used to approximate the 3D structure of a protein when no experimentally determined structure exists. It operates under the principle that protein

More information

PICS: Probabilistic Inference for ChIP-Seq

PICS: Probabilistic Inference for ChIP-Seq PICS: Probabilistic Inference for ChIP-Seq Xuekui Zhang * and Raphael Gottardo, Arnaud Droit and Renan Sauteraud April 30, 2018 A step-by-step guide in the analysis of ChIP-Seq data using the PICS package

More information

Mouse Atlas DiscoverySpace Tutorial

Mouse Atlas DiscoverySpace Tutorial Mouse Atlas DiscoverySpace Tutorial Example 1: Foregut vs. Hindgut 1. Find all the tags that are exclusive to the Foregut (SM107) and not in Hindgut (SM112).. pg 2 2. Identify Tags that are up regulated

More information

DREM. Dynamic Regulatory Events Miner (v1.0.9b) User Manual

DREM. Dynamic Regulatory Events Miner (v1.0.9b) User Manual DREM Dynamic Regulatory Events Miner (v1.0.9b) User Manual Jason Ernst (jernst@cs.cmu.edu) Ziv Bar-Joseph Machine Learning Department School of Computer Science Carnegie Mellon University Contents 1 Introduction

More information

Geneious 5.6 Quickstart Manual. Biomatters Ltd

Geneious 5.6 Quickstart Manual. Biomatters Ltd Geneious 5.6 Quickstart Manual Biomatters Ltd October 15, 2012 2 Introduction This quickstart manual will guide you through the features of Geneious 5.6 s interface and help you orient yourself. You should

More information

Tour Guide for Windows and Macintosh

Tour Guide for Windows and Macintosh Tour Guide for Windows and Macintosh 2011 Gene Codes Corporation Gene Codes Corporation 775 Technology Drive, Suite 100A, Ann Arbor, MI 48108 USA phone 1.800.497.4939 or 1.734.769.7249 (fax) 1.734.769.7074

More information

How to store and visualize RNA-seq data

How to store and visualize RNA-seq data How to store and visualize RNA-seq data Gabriella Rustici Functional Genomics Group gabry@ebi.ac.uk EBI is an Outstation of the European Molecular Biology Laboratory. Talk summary How do we archive RNA-seq

More information

Drosophila protein network generation in Cytoscape, v1.0

Drosophila protein network generation in Cytoscape, v1.0 Drosophila protein network generation in Cytoscape, v1.0 If you have any questions or comments please e-mail me: till.andlauer@fu-berlin.de Of course itʼs especially important to inform me about any errors

More information

Data Curation Profile Human Genomics

Data Curation Profile Human Genomics Data Curation Profile Human Genomics Profile Author Profile Author Institution Name Contact J. Carlson N. Brown Purdue University J. Carlson, jrcarlso@purdue.edu Date of Creation October 27, 2009 Date

More information

Supplementary Material. Cell type-specific termination of transcription by transposable element sequences

Supplementary Material. Cell type-specific termination of transcription by transposable element sequences Supplementary Material Cell type-specific termination of transcription by transposable element sequences Andrew B. Conley and I. King Jordan Controls for TTS identification using PET A series of controls

More information

Browser Exercises - I. Alignments and Comparative genomics

Browser Exercises - I. Alignments and Comparative genomics Browser Exercises - I Alignments and Comparative genomics 1. Navigating to the Genome Browser (GBrowse) Note: For this exercise use http://www.tritrypdb.org a. Navigate to the Genome Browser (GBrowse)

More information

A quick review. Which molecular processes/functions are involved in a certain phenotype (e.g., disease, stress response, etc.)

A quick review. Which molecular processes/functions are involved in a certain phenotype (e.g., disease, stress response, etc.) Gene expression profiling A quick review Which molecular processes/functions are involved in a certain phenotype (e.g., disease, stress response, etc.) The Gene Ontology (GO) Project Provides shared vocabulary/annotation

More information

Microsoft Access 2010

Microsoft Access 2010 Microsoft Access 2010 Chapter 2 Querying a Database Objectives Create queries using Design view Include fields in the design grid Use text and numeric data in criteria Save a query and use the saved query

More information

Twine User Guide. version 5/17/ Joseph Pearson, Ph.D. Stephen Crews Lab.

Twine User Guide. version 5/17/ Joseph Pearson, Ph.D. Stephen Crews Lab. Twine User Guide version 5/17/2013 http://labs.bio.unc.edu/crews/twine/ Joseph Pearson, Ph.D. Stephen Crews Lab http://www.unc.edu/~crews/ Copyright 2013 The University of North Carolina at Chapel Hill

More information

Useful software utilities for computational genomics. Shamith Samarajiwa CRUK Autumn School in Bioinformatics September 2017

Useful software utilities for computational genomics. Shamith Samarajiwa CRUK Autumn School in Bioinformatics September 2017 Useful software utilities for computational genomics Shamith Samarajiwa CRUK Autumn School in Bioinformatics September 2017 Overview Search and download genomic datasets: GEOquery, GEOsearch and GEOmetadb,

More information