Metasearch Process for Transcription Targets
|
|
- Kevin Lloyd
- 6 years ago
- Views:
Transcription
1 Step 1 Select 'Genes' This is the primary interface for the Metasearch add on to Thomson Reuters (GeneGO) platform. Metasearch allows one to make complex queries for information extraction. This document will walk you through how to do that in order to curate out transcription factor downstream genes, ie what genes does my transcription factor of interest regulate? Metasearch Process for Transcription Targets Page 1
2 Step 2 Constrain to 'Human' We want to constrain to human as that is our model system. Can be a litttle less stringent and include the other species to but that would have to convert those genes back to human ids. Metasearch Process for Transcription Targets Page 2
3 Step 3 Select 'interact downstream with' We chose this filter as we want genes that are 'downstream' from our Transcription factor because we are interested in genes being regulated. The upstream selection would select those genes that regulate our transcription factor. Metasearch Process for Transcription Targets Page 3
4 Step 4 - Filters for 'interact with downstream with' relations to Transcription Factor 1. Select 'Human' and 'Human specific' to constrain relation to an observation made in human model system. 2. The effect of relation from Transcription factor to target gene. 3. For finding genes regulated by transcription factor two mechanism are appropriate: 'Transcription regulation' and 'Influence on expression' Definitions Effect 'Unspecified': Direct interaction between two proteins via an unknown mechanism or indirect interaction between two proteins via unknown intermediate signal protein. Mechanism Direct 'Transcription regualtion': A change in gene expression levels by altering transcription rates regulated by transcription factors that physically bind to specific regulatory sequences of target genes. One of the direct interaction mechanisms in MetaCore. Mechanism Indirect 'Influence on expression': In MetaCore, change in expression level of a gene (target gene) caused by a protein or compound. One of the indirect interaction mechanisms in MetaCore. Metasearch Process for Transcription Targets Page 4
5 One can chose different combinations of these filters. It is dependent on what is being looked for. For example, if one wants high confidence downstream targets that are inhibited by your transcription factor of interest one would chose 'human' 'human specific' 'Inhibition' 'Transcription regulation' Step 5 - Example of 'Human' 'Human specific' 'Activation' 'Transcription regulation' Note the 'use high trust interactions only' box. This is an annotation stringency filter to observations in Metacore database. I leave it checked by default. Metasearch Process for Transcription Targets Page 5
6 Step 6 Select 'Network Objects' for Transcription Factor selection. A network object is a convention in Metacore to represent molecular entities. It allows mapping of multiple genes to a network for visualization. For example, NFkB is a transcription factor but it consists of the partnering of a number of protein gene products that come together in various ways. NFkB network object would encompass all of those, rather than just RELA for example. Picking the network object will capture more specific information rather than single genes by themselves. Metasearch Process for Transcription Targets Page 6
7 Step 7 Constrain TF 'Network Object' to 'Human' 'Human specific only' Again, 'Human specific only' keeps data strictly for human. Metasearch Process for Transcription Targets Page 7
8 Step 8 Select your Transcription Factor 'Network Object' Search box has autocomplete fucntions for what you are searching for proper matching. Metasearch Process for Transcription Targets Page 8
9 Step 9 Final search screen Metasearch Process for Transcription Targets Page 9
10 Step 10 Search Result Screeen Metasearch Process for Transcription Targets Page 10
11 Step 11 Export 1. Hit this to bring up the Export dialog window. Metasearch Process for Transcription Targets Page 11
12 Step 12 Select Export Options 1. Select this to get query results as they appear in search result screen. 2. Make sure to select all rows, as there is usually more than one page of results. Metasearch Process for Transcription Targets Page 12
13 Step 13 Final Output File Metasearch Process for Transcription Targets Page 13
Genome Browsers - The UCSC Genome Browser
Genome Browsers - The UCSC Genome Browser Background The UCSC Genome Browser is a well-curated site that provides users with a view of gene or sequence information in genomic context for a specific species,
More informationNetWalker Genomic Data Integration Platform. User Guide
NetWalker Genomic Data Integration Platform User Guide Table of Contents NetWalker Genomic Data Integration Platform... 0 General Object Structure and software layout... 1 1. NetWalker Interactome Knowledgebase...
More informationYou will be re-directed to the following result page.
ENCODE Element Browser Goal: to navigate the candidate DNA elements predicted by the ENCODE consortium, including gene expression, DNase I hypersensitive sites, TF binding sites, and candidate enhancers/promoters.
More informationFinding and Exporting Data. BioMart
September 2017 Finding and Exporting Data Not sure what tool to use to find and export data? BioMart is used to retrieve data for complex queries, involving a few or many genes or even complete genomes.
More informationBoolean Network Modeling
Boolean Network Modeling Bioinformatics: Sequence Analysis COMP 571 - Spring 2015 Luay Nakhleh, Rice University Gene Regulatory Networks Gene regulatory networks describe the molecules involved in gene
More informationVectorBase Web Apollo April Web Apollo 1
Web Apollo 1 Contents 1. Access points: Web Apollo, Genome Browser and BLAST 2. How to identify genes that need to be annotated? 3. Gene manual annotations 4. Metadata 1. Access points Web Apollo tool
More informationMin Wang. April, 2003
Development of a co-regulated gene expression analysis tool (CREAT) By Min Wang April, 2003 Project Documentation Description of CREAT CREAT (coordinated regulatory element analysis tool) are developed
More informationExercises. Biological Data Analysis Using InterMine workshop exercises with answers
Exercises Biological Data Analysis Using InterMine workshop exercises with answers Exercise1: Faceted Search Use HumanMine for this exercise 1. Search for one or more of the following using the keyword
More informationPathway Studio Quick Start Guide
Pathway Studio Quick Start Guide This Quick Start Guide is for users of the Pathway Studio 4.0 pathway analysis software. The Quick Start Guide demonstrates the key features of the software and provides
More informationTutorial: chloroplast genomes
Tutorial: chloroplast genomes Stacia Wyman Department of Computer Sciences Williams College Williamstown, MA 01267 March 10, 2005 ASSUMPTIONS: You are using Internet Explorer under OS X on the Mac. You
More informationINTRODUCTION TO BIOINFORMATICS
Molecular Biology-2019 1 INTRODUCTION TO BIOINFORMATICS In this section, we want to provide a simple introduction to using the web site of the National Center for Biotechnology Information NCBI) to obtain
More informationViTraM: VIsualization of TRAnscriptional Modules
ViTraM: VIsualization of TRAnscriptional Modules Version 2.0 October 1st, 2009 KULeuven, Belgium 1 Contents 1 INTRODUCTION AND INSTALLATION... 4 1.1 Introduction...4 1.2 Software structure...5 1.3 Requirements...5
More informationViTraM: VIsualization of TRAnscriptional Modules
ViTraM: VIsualization of TRAnscriptional Modules Version 1.0 June 1st, 2009 Hong Sun, Karen Lemmens, Tim Van den Bulcke, Kristof Engelen, Bart De Moor and Kathleen Marchal KULeuven, Belgium 1 Contents
More informationHymenopteraMine Documentation
HymenopteraMine Documentation Release 1.0 Aditi Tayal, Deepak Unni, Colin Diesh, Chris Elsik, Darren Hagen Apr 06, 2017 Contents 1 Welcome to HymenopteraMine 3 1.1 Overview of HymenopteraMine.....................................
More informationTutorial:OverRepresentation - OpenTutorials
Tutorial:OverRepresentation From OpenTutorials Slideshow OverRepresentation (about 12 minutes) (http://opentutorials.rbvi.ucsf.edu/index.php?title=tutorial:overrepresentation& ce_slide=true&ce_style=cytoscape)
More informationCS313 Exercise 4 Cover Page Fall 2017
CS313 Exercise 4 Cover Page Fall 2017 Due by the start of class on Thursday, October 12, 2017. Name(s): In the TIME column, please estimate the time you spent on the parts of this exercise. Please try
More informationbcnql: A Query Language for Biochemical Network Hong Yang, Rajshekhar Sunderraman, Hao Tian Computer Science Department Georgia State University
bcnql: A Query Language for Biochemical Network Hong Yang, Rajshekhar Sunderraman, Hao Tian Computer Science Department Georgia State University Introduction Outline Graph Data Model Query Language for
More informationThe genexplain platform. Workshop SW2: Pathway Analysis in Transcriptomics, Proteomics and Metabolomics
The genexplain platform Workshop SW2: Pathway Analysis in Transcriptomics, Proteomics and Metabolomics Saturday, March 17, 2012 2 genexplain GmbH Am Exer 10b D-38302 Wolfenbüttel Germany E-mail: olga.kel-margoulis@genexplain.com,
More informationAnnotating a single sequence
BioNumerics Tutorial: Annotating a single sequence 1 Aim The annotation application in BioNumerics has been designed for the annotation of coding regions on sequences. In this tutorial you will learn how
More informationWilson Leung 01/03/2018 An Introduction to NCBI BLAST. Prerequisites: Detecting and Interpreting Genetic Homology: Lecture Notes on Alignment
An Introduction to NCBI BLAST Prerequisites: Detecting and Interpreting Genetic Homology: Lecture Notes on Alignment Resources: The BLAST web server is available at https://blast.ncbi.nlm.nih.gov/blast.cgi
More informationContractual Approaches to Data Protection in Clinical Research Projects
Contractual Approaches to Data Protection in Clinical Research Projects EICAR, 24th Annual Conference Nürnberg, October 2016 Dr. jur. Marc Stauch Institute for Legal Informatics Leibniz Universität Hannover
More informationMachine Learning. Computational biology: Sequence alignment and profile HMMs
10-601 Machine Learning Computational biology: Sequence alignment and profile HMMs Central dogma DNA CCTGAGCCAACTATTGATGAA transcription mrna CCUGAGCCAACUAUUGAUGAA translation Protein PEPTIDE 2 Growth
More informationLocality-sensitive hashing and biological network alignment
Locality-sensitive hashing and biological network alignment Laura LeGault - University of Wisconsin, Madison 12 May 2008 Abstract Large biological networks contain much information about the functionality
More informationBovineMine Documentation
BovineMine Documentation Release 1.0 Deepak Unni, Aditi Tayal, Colin Diesh, Christine Elsik, Darren Hag Oct 06, 2017 Contents 1 Tutorial 3 1.1 Overview.................................................
More informationTutorial: How to use the Wheat TILLING database
Tutorial: How to use the Wheat TILLING database Last Updated: 9/7/16 1. Visit http://dubcovskylab.ucdavis.edu/wheat_blast to go to the BLAST page or click on the Wheat BLAST button on the homepage. 2.
More informationTutorial 4 BLAST Searching the CHO Genome
Tutorial 4 BLAST Searching the CHO Genome Accessing the CHO Genome BLAST Tool The CHO BLAST server can be accessed by clicking on the BLAST button on the home page or by selecting BLAST from the menu bar
More informationINTRODUCTION TO BIOINFORMATICS
Molecular Biology-2017 1 INTRODUCTION TO BIOINFORMATICS In this section, we want to provide a simple introduction to using the web site of the National Center for Biotechnology Information NCBI) to obtain
More informationTutorial for Windows and Macintosh SNP Hunting
Tutorial for Windows and Macintosh SNP Hunting 2017 Gene Codes Corporation Gene Codes Corporation 525 Avis Drive, Ann Arbor, MI 48108 USA 1.800.497.4939 (USA) +1.734.769.7249 (elsewhere) +1.734.769.7074
More informationefip online Help Document
efip online Help Document University of Delaware Computer and Information Sciences & Center for Bioinformatics and Computational Biology Newark, DE, USA December 2013 K K S I K K Table of Contents INTRODUCTION...
More informationCyKEGGParser User Manual
CyKEGGParser User Manual Table of Contents Introduction... 3 Development... 3 Citation... 3 License... 3 Getting started... 4 Pathway loading... 4 Laoding KEGG pathways from local KGML files... 4 Importing
More informationBioinformatics Hubs on the Web
Bioinformatics Hubs on the Web Take a class The Galter Library teaches a related class called Bioinformatics Hubs on the Web. See our Classes schedule for the next available offering. If this class is
More informationNetwork Analysis, Visualization, & Graphing TORonto (NAViGaTOR) User Documentation
Network Analysis, Visualization, & Graphing TORonto (NAViGaTOR) User Documentation Jurisica Lab, Ontario Cancer Institute http://ophid.utoronto.ca/navigator/ November 10, 2006 Contents 1 Introduction 2
More informationMetaCore Training Manual
MetaCore Training Manual Version 5.0 GeneGo, Inc. 500 Renaissance Dr., Ste. 106, St. Joseph, MI 49085 Phone: 888-59-314, 858 756 7996, 69-983-7869 or +447786150699 Fax: 69-983-7654 customersupport@genego.com
More informationNetwork analysis. Martina Kutmon Department of Bioinformatics Maastricht University
Network analysis Martina Kutmon Department of Bioinformatics Maastricht University What's gonna happen today? Network Analysis Introduction Quiz Hands-on session ConsensusPathDB interaction database Outline
More informationGene regulation. DNA is merely the blueprint Shared spatially (among all tissues) and temporally But cells manage to differentiate
Gene regulation DNA is merely the blueprint Shared spatially (among all tissues) and temporally But cells manage to differentiate Especially but not only during developmental stage And cells respond to
More informationTutorial 1: Exploring the UCSC Genome Browser
Last updated: May 12, 2011 Tutorial 1: Exploring the UCSC Genome Browser Open the homepage of the UCSC Genome Browser at: http://genome.ucsc.edu/ In the blue bar at the top, click on the Genomes link.
More informationPackage TDCor. October 26, 2015
Type Package Package TDCor October 26, 2015 Title Gene Network Inference from Time-Series Transcriptomic Data Version 0.1-2 Date 2015-10-05 Author Julien Lavenus Maintainer Mikael Lucas
More informationGetting Started with Multiseq
Getting Started with Multiseq Requirements MultiSeq must be correctly installed and configured before you can begin using it to analyze the evolution of protein structure. This section walks you through
More informationThe GENIA corpus Linguistic and Semantic Annotation of Biomedical Literature. Jin-Dong Kim Tsujii Laboratory, University of Tokyo
The GENIA corpus Linguistic and Semantic Annotation of Biomedical Literature Jin-Dong Kim Tsujii Laboratory, University of Tokyo Contents Ontology, Corpus and Annotation for IE Annotation and Information
More informationTutorial: Building up and querying databases
Tutorial: Building up and querying databases Objectives During this tutorial you will build a custom database on data retrieved from the BioMart portal. BioMart provides a data acquisition and mining platform,
More informationLecture 5. Functional Analysis with Blast2GO Enriched functions. Kegg Pathway Analysis Functional Similarities B2G-Far. FatiGO Babelomics.
Lecture 5 Functional Analysis with Blast2GO Enriched functions FatiGO Babelomics FatiScan Kegg Pathway Analysis Functional Similarities B2G-Far 1 Fisher's Exact Test One Gene List (A) The other list (B)
More informationExercises: Motif Searching
Exercises: Motif Searching Version 2019-02 Exercises: Motif Searching 2 Licence This manual is 2016-17, Simon Andrews. This manual is distributed under the creative commons Attribution-Non-Commercial-Share
More informationMetaStorm: User Manual
MetaStorm: User Manual User Account: First, either log in as a guest or login to your user account. If you login as a guest, you can visualize public MetaStorm projects, but can not run any analysis. To
More informationTutorial:Basic Expression Analysis in Cytoscape
Tutorial:Basic Expression Analysis in Cytoscape 1 Tutorial:Basic Expression Analysis in Cytoscape Slideshow Basic Expression Analysis in Cytoscape (30 min) [1] Handout Basic_Expression_Analysis_in_Cytoscape.pdf
More informationSEEK User Manual. Introduction
SEEK User Manual Introduction SEEK is a computational gene co-expression search engine. It utilizes a vast human gene expression compendium to deliver fast, integrative, cross-platform co-expression analyses.
More information7.36/7.91/20.390/20.490/6.802/6.874 PROBLEM SET 3. Gibbs Sampler, RNA secondary structure, Protein Structure with PyRosetta, Connections (25 Points)
7.36/7.91/20.390/20.490/6.802/6.874 PROBLEM SET 3. Gibbs Sampler, RNA secondary structure, Protein Structure with PyRosetta, Connections (25 Points) Due: Thursday, April 3 th at noon. Python Scripts All
More informationPackage rgreat. June 19, 2018
Type Package Title Client for GREAT Analysis Version 1.12.0 Date 2018-2-20 Author Zuguang Gu Maintainer Zuguang Gu Package rgreat June 19, 2018 Depends R (>= 3.1.2), GenomicRanges, IRanges,
More informationOpen PHACTS Explorer: Pharmacology by Enzyme Family
Open PHACTS Explorer: Pharmacology by Enzyme Family This document is a tutorial for using Open PHACTS Explorer (explorer.openphacts.org) to obtain pharmacological information for families of enzymes classified
More informationComparative Sequencing
Tutorial for Windows and Macintosh Comparative Sequencing 2017 Gene Codes Corporation Gene Codes Corporation 525 Avis Drive, Ann Arbor, MI 48108 USA 1.800.497.4939 (USA) +1.734.769.7249 (elsewhere) +1.734.769.7074
More informationSupplementary Figure 1. Fast read-mapping algorithm of BrowserGenome.
Supplementary Figure 1 Fast read-mapping algorithm of BrowserGenome. (a) Indexing strategy: The genome sequence of interest is divided into non-overlapping 12-mers. A Hook table is generated that contains
More informationEditing Pathway/Genome Databases
Editing Pathway/Genome Databases By Ron Caspi This presentation can be found at http://bioinformatics.ai.sri.com/ptools/tutorial/sessions/ 1 Pathway Tools in Editing Mode The database is separate from
More informationBioinformatics explained: BLAST. March 8, 2007
Bioinformatics Explained Bioinformatics explained: BLAST March 8, 2007 CLC bio Gustav Wieds Vej 10 8000 Aarhus C Denmark Telephone: +45 70 22 55 09 Fax: +45 70 22 55 19 www.clcbio.com info@clcbio.com Bioinformatics
More informationBILKENT UNIVERSITY. Bilkent Center for Bioinformatics
versiion 2.1 BILKENT UNIVERSITY Bilkent Center for Bioinformatics PATİKAweb User s Guide BILKENT UNIVERSITY - CENTER FOR BIOINFORMATICS PATIKAweb User s Guide PATIKAweb 2007 Bilkent University Center for
More informationRLIMS-P Website Help Document
RLIMS-P Website Help Document Table of Contents Introduction... 1 RLIMS-P architecture... 2 RLIMS-P interface... 2 Login...2 Input page...3 Results Page...4 Text Evidence/Curation Page...9 URL: http://annotation.dbi.udel.edu/text_mining/rlimsp2/
More informationWhat s New Essential Studio Reporting Edition
What s New Essential Studio Reporting Edition Table of Contents Essential XlsIO... 3 Essential PDF... 5 Essential DocIO... 6 Report Viewer for WPF... 7 Report Designer for WPF... 9 Essential RDLIO... 15
More informationCACAO Training. Jim Hu and Suzi Aleksander Spring 2016
CACAO Training Jim Hu and Suzi Aleksander Spring 2016 1 What is CACAO? Community Assessment of Community Annotation with Ontologies (CACAO) Annotation of gene function Competition Within a class Between
More informationSpecial course in Computer Science: Advanced Text Algorithms
Special course in Computer Science: Advanced Text Algorithms Lecture 6: Alignments Elena Czeizler and Ion Petre Department of IT, Abo Akademi Computational Biomodelling Laboratory http://www.users.abo.fi/ipetre/textalg
More informationIntroduction to Genome Browsers
Introduction to Genome Browsers Rolando Garcia-Milian, MLS, AHIP (Rolando.milian@ufl.edu) Department of Biomedical and Health Information Services Health Sciences Center Libraries, University of Florida
More informationPROVIEW PRACTICE SERIES GLOBAL USER GUIDE
PROVIEW PRACTICE SERIES GLOBAL USER GUIDE Thomson Reuters ProView is the premier ebook experience for professionals worldwide. ProView has an expanding list of titles across 17 countries, currently supports
More information@Note2 tutorial. Hugo Costa Ruben Rodrigues Miguel Rocha
@Note2 tutorial Hugo Costa (hcosta@silicolife.com) Ruben Rodrigues (pg25227@alunos.uminho.pt) Miguel Rocha (mrocha@di.uminho.pt) 23-01-2018 The document presents a typical workflow using @Note2 platform
More informationmpmorfsdb: A database of Molecular Recognition Features (MoRFs) in membrane proteins. Introduction
mpmorfsdb: A database of Molecular Recognition Features (MoRFs) in membrane proteins. Introduction Molecular Recognition Features (MoRFs) are short, intrinsically disordered regions in proteins that undergo
More informationRetina Workbench Users Guide
Retina Workbench Users Guide 1. Installing Retina Workbench 2. Launching Retina Workbench a. Starting Retina Workbench b. Registering for a new account c. Connecting to database 3. Expression data window
More information15-780: Graduate Artificial Intelligence. Computational biology: Sequence alignment and profile HMMs
5-78: Graduate rtificial Intelligence omputational biology: Sequence alignment and profile HMMs entral dogma DN GGGG transcription mrn UGGUUUGUG translation Protein PEPIDE 2 omparison of Different Organisms
More informationTAIR User guide. TAIR User Guide Version 1.0 1
TAIR User guide TAIR User Guide Version 1.0 1 Getting Started... 3 Browser compatibility and configuration.... 3 Additional Resources... 3 Finding help documents for TAIR tools... 3 Requesting Help....
More informationUser guide for GEM-TREND
User guide for GEM-TREND 1. Requirements for Using GEM-TREND GEM-TREND is implemented as a java applet which can be run in most common browsers and has been test with Internet Explorer 7.0, Internet Explorer
More informationGenViewer Tutorial / Manual
GenViewer Tutorial / Manual Table of Contents Importing Data Files... 2 Configuration File... 2 Primary Data... 4 Primary Data Format:... 4 Connectivity Data... 5 Module Declaration File Format... 5 Module
More informationKaPPA-View 4. Manual for Beginners. ver Kazusa DNA Research Institute. The Kazusa Plant Pathway Viewer, Version 4.0
KaPPA-View 4 The Kazusa Plant Pathway Viewer, Version 4.0 Manual for Beginners ver. 1.2 Kazusa DNA Research Institute Table of Contents Table of Contents 1. Introduction... 1 1-1. Overview of KaPPA-View4...
More informationThe CALBC RDF Triple store: retrieval over large literature content
The CALBC RDF Triple store: retrieval over large literature content Samuel Croset, Christoph Grabmüller, Chen Li, Silverstras Kavaliauskas, Dietrich Rebholz-Schuhmann croset@ebi.ac.uk 10 th December 2010,
More informationFunRich Tool Documentation
FunRich Tool Documentation Version 2.1.2 Shivakumar Keerthikumar, Mohashin Pathan, Johnson Agbinya and Suresh Mathivanan Mathivanan Lab http://www.mathivananlab.org La Trobe University LIMS1 Department
More informationUser Guide for DNAFORM Clone Search Engine
User Guide for DNAFORM Clone Search Engine Document Version: 3.0 Dated from: 1 October 2010 The document is the property of K.K. DNAFORM and may not be disclosed, distributed, or replicated without the
More informationStructure of biological networks. Presentation by Atanas Kamburov
Structure of biological networks Presentation by Atanas Kamburov Seminar Gute Ideen in der theoretischen Biologie / Systembiologie 08.05.2007 Overview Motivation Definitions Large-scale properties of cellular
More informationTutorial 1: Using Excel to find unique values in a list
Tutorial 1: Using Excel to find unique values in a list It is not uncommon to have a list of data that contains redundant values. Genes with multiple transcript isoforms is one example. If you are only
More informationHow to Work with a Substance Answer Set
How to Work with a Substance Answer Set Easily identify and isolate substances of interest Quickly retrieve relevant information from the world s largest, publicly available substance database. This guide
More informationGenomic Analysis with Genome Browsers.
Genomic Analysis with Genome Browsers http://barc.wi.mit.edu/hot_topics/ 1 Outline Genome browsers overview UCSC Genome Browser Navigating: View your list of regions in the browser Available tracks (eg.
More information<Partner Name> RSA ARCHER GRC Platform Implementation Guide. Global-Regulation International Law Search V. 1. <Partner Product>
RSA ARCHER GRC Platform Implementation Guide Global-Regulation Jeffrey Carlson, RSA Partner Engineering Last Modified: May 15 th, 2017 Solution Summary Global-Regulation.com
More informationSDCSB Cytoscape Workshop 12/4/2012 Keiichiro Ono
Cytoscape Basic Tutorial SDCSB Cytoscape Workshop 12/4/2012 Keiichiro Ono Navigating Cytoscape Navigating Cytoscape This section will introduce the Cytoscape user interface. First of all we will look at
More informationIPA: networks generation algorithm
IPA: networks generation algorithm Dr. Michael Shmoish Bioinformatics Knowledge Unit, Head The Lorry I. Lokey Interdisciplinary Center for Life Sciences and Engineering Technion Israel Institute of Technology
More informationTax Library - Single Computer Install
Tax Library - Single Computer Install Before You Install or Update Your Software One of the most important things to remember before you start updating OR reinstalling any computer software, is to turn
More informationLogging in to Checkpoint
Logging in to Checkpoint 1. Launch your browser and enter the Checkpoint address in the browser location bar: http://checkpoint.tr.com The Checkpoint Login screen appears. Note: Bookmark this page or add
More informationLogging in to Checkpoint
Logging in to Checkpoint 1. Launch your browser and enter the Checkpoint address in the browser location bar: http://checkpoint.tr.com The Checkpoint Login screen appears. NOTE: Bookmark this page or add
More informationIRanges and GenomicRanges An introduction
IRanges and GenomicRanges An introduction Kasper Daniel Hansen CSAMA, Brixen 2011 1 / 28 Why you should care IRanges and GRanges are data structures I use often to solve a variety of
More informationPowering Knowledge Discovery. Insights from big data with Linguamatics I2E
Powering Knowledge Discovery Insights from big data with Linguamatics I2E Gain actionable insights from unstructured data The world now generates an overwhelming amount of data, most of it written in natural
More informationTutorial: Using the SFLD and Cytoscape to Make Hypotheses About Enzyme Function for an Isoprenoid Synthase Superfamily Sequence
Tutorial: Using the SFLD and Cytoscape to Make Hypotheses About Enzyme Function for an Isoprenoid Synthase Superfamily Sequence Requirements: 1. A web browser 2. The cytoscape program (available for download
More informationCFinder The Community / Cluster Finding Program. Users' Guide
CFinder The Community / Cluster Finding Program Users' Guide Copyright (C) Department of Biological Physics, Eötvös University, Budapest, 2005 Contents 1. General information and license...3 2. Quick start...4
More informationHuber & Bulyk, BMC Bioinformatics MS ID , Additional Methods. Installation and Usage of MultiFinder, SequenceExtractor and BlockFilter
Installation and Usage of MultiFinder, SequenceExtractor and BlockFilter I. Introduction: MultiFinder is a tool designed to combine the results of multiple motif finders and analyze the resulting motifs
More informationHomology Modeling FABP
Homology Modeling FABP Homology modeling is a technique used to approximate the 3D structure of a protein when no experimentally determined structure exists. It operates under the principle that protein
More informationPICS: Probabilistic Inference for ChIP-Seq
PICS: Probabilistic Inference for ChIP-Seq Xuekui Zhang * and Raphael Gottardo, Arnaud Droit and Renan Sauteraud April 30, 2018 A step-by-step guide in the analysis of ChIP-Seq data using the PICS package
More informationMouse Atlas DiscoverySpace Tutorial
Mouse Atlas DiscoverySpace Tutorial Example 1: Foregut vs. Hindgut 1. Find all the tags that are exclusive to the Foregut (SM107) and not in Hindgut (SM112).. pg 2 2. Identify Tags that are up regulated
More informationDREM. Dynamic Regulatory Events Miner (v1.0.9b) User Manual
DREM Dynamic Regulatory Events Miner (v1.0.9b) User Manual Jason Ernst (jernst@cs.cmu.edu) Ziv Bar-Joseph Machine Learning Department School of Computer Science Carnegie Mellon University Contents 1 Introduction
More informationGeneious 5.6 Quickstart Manual. Biomatters Ltd
Geneious 5.6 Quickstart Manual Biomatters Ltd October 15, 2012 2 Introduction This quickstart manual will guide you through the features of Geneious 5.6 s interface and help you orient yourself. You should
More informationTour Guide for Windows and Macintosh
Tour Guide for Windows and Macintosh 2011 Gene Codes Corporation Gene Codes Corporation 775 Technology Drive, Suite 100A, Ann Arbor, MI 48108 USA phone 1.800.497.4939 or 1.734.769.7249 (fax) 1.734.769.7074
More informationHow to store and visualize RNA-seq data
How to store and visualize RNA-seq data Gabriella Rustici Functional Genomics Group gabry@ebi.ac.uk EBI is an Outstation of the European Molecular Biology Laboratory. Talk summary How do we archive RNA-seq
More informationDrosophila protein network generation in Cytoscape, v1.0
Drosophila protein network generation in Cytoscape, v1.0 If you have any questions or comments please e-mail me: till.andlauer@fu-berlin.de Of course itʼs especially important to inform me about any errors
More informationData Curation Profile Human Genomics
Data Curation Profile Human Genomics Profile Author Profile Author Institution Name Contact J. Carlson N. Brown Purdue University J. Carlson, jrcarlso@purdue.edu Date of Creation October 27, 2009 Date
More informationSupplementary Material. Cell type-specific termination of transcription by transposable element sequences
Supplementary Material Cell type-specific termination of transcription by transposable element sequences Andrew B. Conley and I. King Jordan Controls for TTS identification using PET A series of controls
More informationBrowser Exercises - I. Alignments and Comparative genomics
Browser Exercises - I Alignments and Comparative genomics 1. Navigating to the Genome Browser (GBrowse) Note: For this exercise use http://www.tritrypdb.org a. Navigate to the Genome Browser (GBrowse)
More informationA quick review. Which molecular processes/functions are involved in a certain phenotype (e.g., disease, stress response, etc.)
Gene expression profiling A quick review Which molecular processes/functions are involved in a certain phenotype (e.g., disease, stress response, etc.) The Gene Ontology (GO) Project Provides shared vocabulary/annotation
More informationMicrosoft Access 2010
Microsoft Access 2010 Chapter 2 Querying a Database Objectives Create queries using Design view Include fields in the design grid Use text and numeric data in criteria Save a query and use the saved query
More informationTwine User Guide. version 5/17/ Joseph Pearson, Ph.D. Stephen Crews Lab.
Twine User Guide version 5/17/2013 http://labs.bio.unc.edu/crews/twine/ Joseph Pearson, Ph.D. Stephen Crews Lab http://www.unc.edu/~crews/ Copyright 2013 The University of North Carolina at Chapel Hill
More informationUseful software utilities for computational genomics. Shamith Samarajiwa CRUK Autumn School in Bioinformatics September 2017
Useful software utilities for computational genomics Shamith Samarajiwa CRUK Autumn School in Bioinformatics September 2017 Overview Search and download genomic datasets: GEOquery, GEOsearch and GEOmetadb,
More information