MetaStorm: User Manual

Transcription

1 MetaStorm: User Manual User Account: First, either log in as a guest or login to your user account. If you login as a guest, you can visualize public MetaStorm projects, but can not run any analysis. To login to your account, just type your (user ID) and password. If you have not already registered for MetaStorm, you can create an account by filling in your name, , and organization as well as agreeing to the terms on the Request a new account page. Once you have done this, wait for an confirming your new account. Home Page: On the Home Page you can create new projects, upload new reference databases, browse other projects that have been submitted to MetaStorm, and see projects you have already created. Creating a new project: This lets you create new projects after entering a project name and description.

2 Reference customization: This interface will allow you to submit your own reference database. You will be able to use it during your metagenomics analysis. First you need to prepare the database to the required format. cmetan requires two files for setting up the database. Depending on the type of database (taxonomy or annotation), you need to provide a file that contains the taxonomy or the functions for each gene as follows: 1. Gene database ( Mandatory ). A fasta file where the header corresponds to the gene id e.g., >gene_0001 ACCTGAGGTCATACAGACATAGCACACAGATACAGATACAGATAGAC >gene_0002 ACCTGAGGTCATACAGACATAGCACACAGATACAGATACAGATAGAC >gene_0003 ACCTGAGGTCATACAGACATAGCACACAGATACAGATACAGATAGAC 2. Taxonomy link file: A tab delimited file containing the gene id and the full taxonomy (as in SILVA database) separated by ;. For instance: gene_001bacteria;proteobacteria;betaproteobateria;neisseriales;neisseriaceae;neiseria;neiseria Meningitidis gene_002bacteria;proteobacteria;betaproteobateria;neisseriales;neisseriaceae;neiseria;neiseria Meningitidis gene_003bacteria;proteobacteria;betaproteobateria;neisseriales;neisseriaceae;neiseria;neiseria Meningitidis 3. Functional link file: A tab delimited file similar to the taxonomy file, containing the function class or category. If a gene contains multiple functional associations, set up all of them using the _ separator as follows: gene_001 Transcription gene_002 Transcription_RNA Binding gene_003 DNA Repair In order to setup your new dataset you need to follow the next steps: 1. Click on Submit a reference dataset under the Reference customization box 2. Fill out the form with the required information: a. Dataset name: Type the name of your reference dataset b. Sequence type: Type if it is a gene or protein database. c. Description: IMPORTANT Insert the full description of the dataset 3. Click on register reference 4. Upload the files 5. Choose the corresponding file for each type (Sequences, Taxnomy, Function) 6. Click on process.

3 Browse Projects: This is a list of projects that have been analysed by MetaStorm. On projects that you have access to (your projects or ones that are public), there are links to the results of whichever pipelines have been run. My Projects: This interface lets you select one of your past projects to either remove or run through a pipeline. Clicking on one of the pipelines will take you to the Update Project screen for that project.

4 The first thing you will see here is the Samples page which lets you see and edit metadata about the samples that you have uploaded for this project. The Project page displays the name and description of your project, lets you share this project with other address, or make it public.

5 The Upload Raw Files page lets you upload new samples as gzipped fastq files (e.g. Sample1_R1.fastq.gz). The Setup Metadata page lets you add the samples and associated metadata to your project. There are instructions for this at the bottom of the page.

6 The Run Analysis page lets you start the analysis of your samples using the selected pipeline after selecting which reference databases you want to use.