SRM UNIVERSITY DEPARTMENT OF BIOINFORMATICS
|
|
- Leo Owens
- 5 years ago
- Views:
Transcription
1 LIST OF EXPERIMENTS 1. Basic UNIX Commands 2. Working with vi editor 3. Working with emacs editors 4. Advanced UNIX Utilities 5. Creating a Bioinformatics directory 6. Simple Perl Program (Operators) 7. Use of <STDIN> 8. Chop and Chomp Operators 9. Control Structures: a) If If else statements b) While statement c) foreach and Until Loops 10. Subroutines, Subroutines using array and special variables 11. Random Number Generation 12. Simple programs using File Functions 13. Hash Traversal Functions 14. Command Line Arguments 15. Setuid / setgid Perl Scripts 16. Creating a static HTML file by a Perl Program 1
2 EX.NO: 1 DATE: BASIC UNIX COMMANDS AIM: To execute all the basic commands in UNIX PROCEDURE: Open Terminal and execute all the following Basic UNIX commands: Command name : mkdir Descripti on : Creating a directory Options Example : Nil : >mkdir directory name O utput : /home/username/directoryname Command name : cd Description : change directory Options : cd.. move one level down cd/ to go to the root directory cd~ to go to the home directory cd../.. move two levels up Example : >cd directory O utput : /home/username/directory Command name Description Options Example Output : ls : listing contents of the directory : ls l listing the contents of the file in list fashion ls lc listing the contents of the file in column of fashion ls t listing the contents of directory according to time ls x listing the contents of directory in rows ls m listing the contents of directory separated by commas ls R recursively displaying the files and directories : >ls sequences : analysis assembly 2
3 Command name Description Example O ptions Command name Descripti on Options Exampl e O utput : mv : moving or renaming a file or a directory : mv*.seq/user.sequences all files with.seq extensions are moved to user directory mv i94h10.seq ignores the case mv94{h,h}10.seq it is used to rename the file : >mvac txt94h10.seq : 94H10.seq : cp : copying a file : Nil : >cp Ac(4H10.seq{,.bak} : Adds extension.bak to all sequence files Command name : head and tail Descriptio n : used to display top few or bottom few lines of a line Options : Nil Example : >head 94H10.seq >tail 94H10.seq Output : It displays the first and last ten lines of 94H10.seq Command name : cat Descripti on : create, view and append or change the contents of a file Options : Nil Example : cat>new Output : a new file is created Command name : rm and rmdir Descripti on : removing a file or a directory Options : nil Example Output : rm r seq x : removes all files starting with seq(recursive deletion) 3
4 Command name : find Descript ion : searching a particular file or a directory Options : nil Example : find. name seqchr* O utput : finds all the files starting with seqchr* as a part of it Command name : more Descript ion : displays the contents of the file Options : nil Example : more 94H10.seq Output : prints contents of the file 94H10.seq Command name : chmod Descrip tion : used to change the permissions of a file Options : nil Example : chmod 777 file.txt O utput : gives read, write and execute permissions to user, group and world Command name : ps Descriptio n : process tracking (to find how many processes are running) Options : nil Example : >ps Output : PID TTY TIME COMMAND Command name : kill Description : used to stop the process Options : nil Exampl e : >file.txt O utput : it the stops the processes of file.txt Command name Description : tar : related files are grouped together 4
5 NAME : Bhupendra Khandelwal REG NO : Options : tar cvffile1.tar tar tvf tar xvf tar cvf Example : tar cvf*.seq Output : archive seq files in the current directory MISCELLANEOUS COMMANDS: Command name : gzip/compress and gunzip/uncompress Description : gzip file is compressed to size smaller than compress. Compress used to compress file but size greater than that obtained by gzip. Uncompress used to uncompress file but size smaller than that obtained by gunzip. Options : nil Example : >gzip test. tar >compress test.tar Output : test.tar.gz Test.tar.z RESULT: The Basic UNIX Commands were thus executed and the output as noted. 5
6 EX.NO: 2 DATE: AIM: To study the various UNIX commands Vi EDITOR COMMANDS PROCEDURE: Open Terminal and open vi editor. Try out the following commands: Sav ing and Quitting: :q quit without saving :q! quit without saving even changes are made :w save and continue editing :wq save and quit :zz write file only if changes were made and quit :x same function as zz Moving around text: h move cursor one character left i move cursor one character right k move cursor up one line j move cursor down one line G move to end of file H move to top line visible on screen L move to last line visible on screen M move to middle line visible on screen w move forward word by word b move backward word by word W move forward one word ignoring punctuation e move end of word O move to beginning of line $ move to end of file 6
7 NA ME : Bhupendra Khandelwal REG NO : Changing, Deleting, and Substituting text cc change a single line C change text from cursor to end of line x delete cw change a single word, single character under cursor X delete single character before cursor dw delete a word d{ } delete upto next paragraph dd delete current line D delete from cursor to end of line dl delete upto last line of screen dg delete to end of line j join two lines rx replace one character with x R override characters s substitute a character S substitute a line u undo last change U restore current line Scrollin g and Indenting Text: <ctrl>f scroll forward one window <ctrl>b scroll back one window > > shift current line forward one indent width < < shift current line back one indent width Finding and Searching for text: fx find first occurrence of character x ahead of cursor Fx find first occurrence of x behind cursor Cutting and Pasting: Y copy correct manual p put deleted text after or below cursor P put deleted text before or after cursor RESULT: The vi editor commands were successfully executed and the output was noted. 7
8 EX.NO: 3 DATE: EMACS EDITOR COMMANDS AIM: To study the various commands in emacs editor PROCEDURE: 1. Open Terminal and create an emacs file using the command, #emacs <filename> 2. Insert text using the emacs editor 3. Perform the following operations using the various emacs editor commands and note the output ESSENTIAL EMACS COMMANDS: Ctrl + A: Move to the beginning of the line Ctrl + E: Move to the end of the line Ctrl + S: Start search text Ctrl + d: Delete single character in a line Ctrl + K: Delete entire line upto cursor Delete: Delete character before cursor Ctrl + _: Undo last action Ctrl + X/ Ctrl + S: Save current file and exit Ctrl + X/ Ctrl + C: Exit emacs without saving Home: Go to the beginning of the document End: Go to the end of the document 8
9 MISCELLANEOUS EMACS COMMANDS: Ctrl + P: Move to the previous line Ctrl + N: Move to the next line Ctrl + F: Move forward one character Ctrl + B: Move backwards one character Ctrl + V: Scroll down one page Esc V: Scroll up one page Esc F: Move ahead word by word Esc B: Move backward word by word Esc A: Move to the beginning of the sentence Esc E: Move to the end of the sentence The commands were executed on emacs editor and changes were observed. RESULT: The basic emacs editor commands were successfully executed and the output was noted. 9
10 EX.NO: 4 DATE: ADVANCED UNIX UTILITIES AIM: To study the syntax and usage of various UNIX utilities such as grep and uniq. PROCEDURE: Open Terminal and perform the advanced commands (Utilities) described below: 1. grep Utility name : grep Description : global search for regular expressions Options : searches given keywords and prints files containing it Example : >grep v ase genes.txt! more Output : all lines that do not carry the string ase are printed out with the v option 2. wc Utility name : wc Description : gives number of lines, words and characters in a file Options : wc 1 gives number of lines wc w gives the number of words wc c gives the number of characters Example : >wc mydetails.txt Output : uniq Utility name : uniq Description : deletes the repeted text in a file Options : uniq c gives the text along with the number of times they are present Example : >uniq test.txt 10
11 Output : This Is Some Repeated Text 4. sort Utility name: Description : used for sorting the contents of a file Options : sort r to sort in descending sort f ignores case separator sort t ignores files separator sort M orders based on month Example : >sort test.txt Output : Is Some Repeated Text This 5. awk Utility n ame : awk Description : helps to print contents of file based on given conditions Options : nil Example : >cat>test.txt 1 one a 2 two b 3 three c >awk {print $1} test.txt 11
12 Output : RESULT: The advanced UNIX Utility commands were successfully executed. 12
13 EX.NO: 5 DATE: CREATING A BIOINFORMATICS DIRECTORY AIM: To create a Bioinformatics Directory Structure to study the basic UNIX commands. Structure: Root Home Sequences Assembly Analysis Human Mouse Rice Human Mouse Rice Ch22 Chr22 Chr5 Chr22 Chr22 Chr5 Chr10 Chr10 Chr4 Chr10 Chr10 Chr4 Chr5 Chr5 13 Chr5 Chr5
14 PROCEDURE : COMMANDS: 1. Open terminal (Shell) 2. Create a Bioinformatics Directory using the following commands to make files and folders in the main directory $ mkdir sequences $ cd sequences $ mkdir assembly $ cd assembly $ mkdir human $ mkdir mouse $ mkdir rice $ cd human $ mkdir chr22 $ cd chr22 $ mkdir chr10 $ cd chr10 $ mkdir chr5 $ cd chr5 $ cd.. $ cd.. $ cd.. $ cd mouse $ mkdir chr22 $ cd chr22 $ mkdir chr10 $ cd chr10 $ mkdir chr5 $ cd chr5 $ cd..\.. $ cd.. $ cd rice $ mkdir chr5 14
15 $ cd chr5 $ mkdir chr4 $ cd..\.. $ cd.. $ cd analysis $ mkdir human $ mkdir mouse $ mkdir rice $ cd human $ mkdir chr22 $ cd chr22 $ mkdir chr10 $ mkdir chr5 $ cd chr5 $ cd.. $ cd.. $ cd.. $ cd mouse $ mkdir chr22 $ cd chr22 $ mkdir chr10 $ cd chr10 $ mkdir chr5 $ cd chr5 $ cd..\.. $ cd.. $ cd rice $ mkdir chr5 $ cd chr5 $ mkdir chr4 $ cd~ RESULT: The Bioinformatics directory was successfully created using various UNIX Commands. 15
16 EX.NO: 6 DATE: SIMPLE PERL PROGRAM AIM: To illustrate the basic structure of Perl program. PROCEDURE: PROGRAM: 1. Open Terminal, create a file using VI Editor and type in the program with.pl as extension 2. Compile and execute using #perl <filename.pl> command and note the output $aminoacid="methionine"; $protein="lysin"; print "aminoacid=$aminoacid\n"; print"protein= $protein\n"; $msg="welcome to perl programming for bioinformatics"; print "$msg\n"; RESULT: A simple perl program using print function was successfully executed 16
17 SIMPLE SCALAR PROGRAM AIM: To illustrate the simple scalar function of Perl program PROCEDURE: PROGRAM: 1. Open Terminal, create a file using VI Editor and type in the program with.pl as extension 2. Compile and execute using #perl <filename.pl> command and note the output $a=15, $b=5; $c=$a+$b; $d=$a*$b; $e=$a/$b; print "a is=$a\n"; print"b=$b\n"; print"the sum of two no.:$ c\n"; print"the multiplication:$ d\n"; print"the division:$e\n"; RESULT: The simple perl program that uses scalar was successfully executed and the output was saved 17
18 EXP. NO: 7 DATE: PERL SCRIPT USING <STDIN> AIM: To illustrate the use of <STDIN> PROCEDURE: 1. Open Terminal, create a file using VI Editor and type in the program with.pl as extension 2. Compile and execute using #perl <filename.pl> command and note the output PROGRAM: print "Enter any number: "; $a=<stdin>; print "Enter another number: "; $b=<stdin>; $c=$a+$b; print "Addition of the numbers is: $c \n"; RESULT: The perl script that uses a <STDIN> Standard Input from user was successfully executed 18
19 EX.NO: 8 DATE: CHOP and CHOMP OPERATORS AIM: To illustrate two scalar variables one with \n character and other with only characters. PROCEDURE: PROGRAM: 1. Open Terminal, create a file using VI Editor and type in the program with.pl as extension 2. Compile and execute using #perl <filename.pl> command and note the output $enzyme="ribonuclease\n"; chomp($enzyme); print"the gene after chomp function is :$enzyme\n"; $enzyme2= Helicase ; chop($enzyme2); print "the gene after chop operator is :$enzyme2\n"; print "Enter an enzyme name: ; $enzyme1=<stdin>; chomp($enzyme1); print "The entered gene after chomp function is:$enzyme1\n\n"; RESULT: The perl program that illustrates the Chop and Chomp operators was successfully executed 19
20 EX.NO: 9(a) DATE: AIM: To illustrate the if statement PROCEDURE: PERL CONTROL STATEMENTS IF STATEMENT 1. Open Terminal, create a file using VI Editor and type in the program with.pl as extension 2. Compile and execute using #perl <filename.pl> command and note the output PROGRAM: print "Ente r a number below 10: "; $a=<stdin>; if( $a<10){ print "You entered correctly! \n"; } if( $a>=10){ print "You entered it wrong! \n"; } RESULT: The perl program that illustrated the if statement was successfully executed 20
21 IF ELSE STATEMENT AIM: To illustrate the use of if else statement. PROCEDURE: 1. Open Terminal, create a file using VI Editor and type in the program with.pl as extension 2. Compile and execute using #perl <filename.pl> command and note the output PROGRAM: print Enter a number below 10: ; $a=<stdin>; if( $a<10){ print You entered correctly! \n ; } else{ print You entered it wrong! \n ; } RESULT: The perl program that illustrates the if else statement was successfully executed 21
22 EX.NO: 9(b) DATE: AIM: To illustrate the use of WHILE loop. PROCEDURE: PROGRAM: WHILE LOOP 1. Open Terminal, create a file using VI Editor and type in the program with.pl as extension 2. Compile and execute using #perl <filename.pl> command and note the output print "Program to print first 10 natural numbers \n"; $i=1; while($i<=10){ print "$i \n"; $i++; } RESULT: The perl program that illustrates the while loop was successfully executed 22
23 DO WHILE LOOP AIM: To illustrate the use of DO WHILE loop. PROCEDURE: PROGRAM: 1. Open Terminal, create a file using VI Editor and type in the program with.pl as extension 2. Compile and execute using #perl <filename.pl> command and note the output print "Program to print first 10 natural numbers \n"; $i=1; do{ print "$i \n"; $i++; } while($i<=10); RESULT: The perl program that illustrates the do while statement was successfully executed 23
24 EX.NO: 9(c) DATE: AIM: To illustrate the use of FOREACH LOOP. PROCEDURE: PROGRAM: FOREACH LOOP 1. Open Terminal, create a file using VI Editor and type in the program with.pl as extension 2. Compile and execute using #perl <filename.pl> command and note the Rahul Rehan); $count=1; foreach $names(@names){ print "$count $names \n"; $count++; } RESULT: The perl program that illustrates the foreach loop was successfully executed BI0313 / Perl Programming Laboratory 24
25 UNTIL AIM: To illustrate the UNTIL Loop PROCEDURE: PROGRAM: 1. Open Terminal, create a file using VI Editor and type in the program with.pl as extension 2. Compile and execute using #perl <filename.pl> command and note the output print "Program to print first 10 natural numbers \n"; $i=1; until( $i>10){ print "$i \n"; $i++; } RESULT: The perl program that illustrates the Until Loop was successfully executed 25
26 EX.NO: 10 DATE: SUBROUTINES AIM: To study and execute subroutines (sub programs) that is called in the main program # Any variable created outside a subroutine is Global and can be accessed inside subroutines. PROCEDURE: 1. Open Terminal and type the program in vi editor using subrout.pl command. 2. Execute the program and note the output. PROGRAM: print Enter degrees in Farenheit :\n ; $degf = <STDIN>; Chop($degf); print Celsius(); sub print celsius{ $degc = ($degf 32)*(5/9); print $degf degree farenheit is $degc degree celsius\n ; } 26
27 Subroutine using array and special variables PROGRAM: print "Enter any 5 numbers : \n"; $_= = split(); print "The sum is ",&sum_arr(@nums), "\n"; sub sum_arr{ my(@val) my(@sum) = 0; foreach $i(@val){ $sum = $sum + $i; } return ($sum); } RESULT: The programs that showed Subroutines and the use of arrays and special variables in subroutines was successfully executed and the output was saved 27
28 EX.NO: 11 DATE: RANDOM NUMBER GENERATION AIM: To generate a random integer/number using the rand() function. PROCEDURE: Open Terminal and type the program in vi editor, using vi rand.pl command. Execute and run to obtain a random number, use Ranges and obtain integers. Run by using perl rand.pl command, PROGRAM: Random number between 0 and 1 : use strict; use warnings; my $my_rand_num = rand(); print $my_rand_num. \n ; Range of numbers: use strict; use warnings; my $range = 100; $rand_num = rand($range); print $rand_num. \n ; 28
29 A random integer with a range: use strict; use warnings; my $range = 50; my $min = 100; my $rand_num = int(rand($range)) + $min; print $rand_num. \n ; RESULT: The perl program that illustrates the rand() function to generate random numbers was successfully executed 29
30 EX.NO: 12 DATE: PERL PROGRAMMING using FILE FUNCTIONS AIM: To study and execute a Perl program that uses functions to open and edit files. PROCEDURE: 1. Open Terminal and type the program in vi editor using file.pl command. 2. Execute the program Perl file.pl and note the output. PROGRAM: $path = "G:\Documents\123.seq"; open(handle, $path) or die "Error opening $path : $!"; $path = <HANDLE>; $a = ($path = ~tr/a//); $t = ($path = ~tr/t//); $g = ($path = ~tr/g//); $c = ($path = ~tr/c//); print "A is $a"; print "T is $t"; print "G is $g"; print "C is $c"; $total = $a + $t +$g +$c; print "Total number of nucleotides is $total \n"; 30
31 $gc = ((($g + $c)/ $total) *100); print GC content is :$gc \n ; close(handle); Formatting output with printf %.1f: To get one digit after the decimal (long float). ln program, printf GC content is :%.1f%\n,$gc; RESULT: The perl program that uses the functions such as open to view and edit files was successfully executed and the output was noted 31
32 EX.NO: 13 DATE: HASH TRAVERSAL FUNCTIONS Hashes are denoted by % AIM: To study and execute programs that shows the hash functions. PROCEDURE: 3. Open Terminal and type the program in vi editor using hashes.pl command. 4. Execute the program and note the output. PROGRAM: To traverse the hash and extract elements: print"program to print contents of a hash\n"; %coins=("quarter",25,"dime",10,"nickel",5); print"contents of the hash are:", %coins; Printing elements based on their key: print Program to print elements based on the key ; %coins = ( Quarter, 25, Dime, 10, Nickel, 5); foreach $key(%coins){ print {$key} \n ; } 32
33 To print the hash size: print Program to print hash size\n ; %coins = ( Quarter, 25, Dime, 10, Nickel, 5); print The hash size is :, scalar keys %coins; To add element to the hash: %coins = ("Quarter", 25, "Dime", 10, "Nickel", 5); print "Contents of the hash: ", %coins; $coins {"Penny"} = 1; print "\nafter addition: ",%coins; 33
34 To remove element from hash: %coins = ("Quarter", 25, "Dime", 10, "Nickel", 5); print "Contents of the hash: ", %coins; delete ($coins {"Quarter"}); print "\nafter deletion: ",%coins; To sort elements in the hash: %coins = ("Quarter", 25, "Dime", 10, "Nickel", 5); foreach $key (sort keys %coins){ print "{$key} \n"; } RESULT: All the perl programs that illustrated the hash traversal functions was successfully executed 34
35 EX.NO: 14 DATE: COMMAND LINE ARGUMENTS AIM: To study and execute the command line arguments using $#ARGV. PROCEDURE: 1. Open Terminal and type the program in vi editor. 2. Execute the program and note the output. PROGRAM: $numargs = $#ARGV + 1; print Thanks! You gave me $numargs command line arguments \n ; foreach $argnum(0..$#argv){ print $ARGV [$argnum] \n ; } RESULT: The perl program that illustrates Command line arguments was successfully executed. 35
36 EX.NO: 15 DATE: STDUID/STDGID PERL SCRIPTS AIM: To study and execute the stduid/stdgid file permissions using perl PROCEDURE: 1. Open terminal and type the program in a text editor, save with.pl extension 2. Execute and run the chmod file permissions command to obtain the output The long form of ls, ls l shows the stduid/stdgid programs by listing an s instead of /x When the stduid bit is turned on using the command chmod u+s stduid.pl, the privileges of the process are set to that of the owner/user of the file When the stdgid bit is turned on using the command chmod g+s stdgid.pl, the privileges of the process are set to that of the group of the file PROGRAM: print Welcome! This program sets file permissions \n ; In the TERMINAL: #ls l rw r r stduid.pl rw r r stdgid.pl #chmod a+x stduid.pl #ls l rwsr sr x stduid.pl #chmod g+x stdgid.pl #ls l rwsr sr x stdgid.pl 36
37 RESULT: The perl program that illustrates STDUID/STDGID perl scripts was successfully executed 37
38 EX.NO: 16 DATE: CREATING A STATIC HTML FILE AIM: To create and view the contents of a static html file using Perl programming. PROCEDURE: Open Terminal and type the program in vi editor using vi html.pl command. This creates a.html file in the root directory and can be viewed using a standard browser. Execute to create and run to view the html page. PROGRAM: Use Fentl; # The Module used for operations on file handles and i/o device handles, to read, extend attributes and control blocking etc. print Content type : text/html ; sysopen (HTML, myhtml.html, O_RDWR/O_EXCL/O_CREAT,0755); printf HTML <html>\n ; printf HTML <head>\n ; printf HTML <title>my Home Page!</title>\n ; printf HTML </head>\n ; printf HTML <body>\n ; printf HTML <palign = center >This is an HTML page</p> ; printf HTML </body>\n ; printf HTML </html>\n ; close (HTML); 38
39 Html file in the root has been created. Open: /root/myhtml.html file RESULT: A static HTML file using perl programming was successfully created. 39
Lecture # 2 Introduction to UNIX (Part 2)
CS390 UNIX Programming Spring 2009 Page 1 Lecture # 2 Introduction to UNIX (Part 2) UNIX is case sensitive (lowercase, lowercase, lowercase) Logging in (Terminal Method) Two basic techniques: 1. Network
More informationIntroduction p. 1 Who Should Read This Book? p. 1 What You Need to Know Before Reading This Book p. 2 How This Book Is Organized p.
Introduction p. 1 Who Should Read This Book? p. 1 What You Need to Know Before Reading This Book p. 2 How This Book Is Organized p. 2 Conventions Used in This Book p. 2 Introduction to UNIX p. 5 An Overview
More informationEssential Unix (and Linux) for the Oracle DBA. Revision no.: PPT/2K403/02
Essential Unix (and Linux) for the Oracle DBA Revision no.: PPT/2K403/02 Architecture of UNIX Systems 2 UNIX System Structure 3 Operating system interacts directly with Hardware Provides common services
More informationMills HPC Tutorial Series. Linux Basics I
Mills HPC Tutorial Series Linux Basics I Objectives Command Line Window Anatomy Command Structure Command Examples Help Files and Directories Permissions Wildcards and Home (~) Redirection and Pipe Create
More informationUNIX Quick Reference
UNIX Quick Reference This card represents a brief summary of some of the more frequently used UNIX commands that all users should be at least somewhat familiar with. Some commands listed have much more
More informationBasic UNIX Commands BASIC UNIX COMMANDS. 1. cat command. This command is used to create a file in unix. Syntax: $ cat filename
Basic UNIX Commands BASIC UNIX COMMANDS 1. cat This is used to create a file in unix. $ cat >filename This is also used for displaying contents in a file. $ cat filename 2. ls It displays the list of files
More informationBasic UNIX Commands BASIC UNIX COMMANDS. 1. cat command. This command is used to create a file in unix. Syntax: $ cat filename
Basic UNIX Commands BASIC UNIX COMMANDS 1. cat command This command is used to create a file in unix. $ cat >filename This command is also used for displaying contents in a file. $ cat filename 2. ls command
More informationComputer Systems and Architecture
Computer Systems and Architecture Stephen Pauwels Computer Systems Academic Year 2018-2019 Overview of the Semester UNIX Introductie Regular Expressions Scripting Data Representation Integers, Fixed point,
More informationIntroduction. File System. Note. Achtung!
3 Unix Shell 1: Introduction Lab Objective: Explore the basics of the Unix Shell. Understand how to navigate and manipulate file directories. Introduce the Vim text editor for easy writing and editing
More informationComputer Systems and Architecture
Computer Systems and Architecture Introduction to UNIX Stephen Pauwels University of Antwerp October 2, 2015 Outline What is Unix? Getting started Streams Exercises UNIX Operating system Servers, desktops,
More informationIntroduction to Linux Environment. Yun-Wen Chen
Introduction to Linux Environment Yun-Wen Chen 1 The Text (Command) Mode in Linux Environment 2 The Main Operating Systems We May Meet 1. Windows 2. Mac 3. Linux (Unix) 3 Windows Command Mode and DOS Type
More informationIntroduction to UNIX command-line
Introduction to UNIX command-line Boyce Thompson Institute March 17, 2015 Lukas Mueller & Noe Fernandez Class Content Terminal file system navigation Wildcards, shortcuts and special characters File permissions
More informationLinux Shell Script. J. K. Mandal
Linux Shell Script J. K. Mandal Professor, Department of Computer Science & Engineering, Faculty of Engineering, Technology & Management University of Kalyani Kalyani, Nadia, West Bengal E-mail: jkmandal@klyuniv.ac.in,
More informationIntroduction to Linux (Part II) BUPT/QMUL 2018/03/21
Introduction to Linux (Part II) BUPT/QMUL 2018/03/21 Contents 10. vi 11. Other commands 12. Developing tools 2 10. Editor - vi Text editor Insert mode Override mode Use sub-commands Tradition tools and
More informationIntroduction to UNIX command-line II
Introduction to UNIX command-line II Boyce Thompson Institute 2017 Prashant Hosmani Class Content Terminal file system navigation Wildcards, shortcuts and special characters File permissions Compression
More informationRead the relevant material in Sobell! If you want to follow along with the examples that follow, and you do, open a Linux terminal.
Warnings 1 First of all, these notes will cover only a small subset of the available commands and utilities, and will cover most of those in a shallow fashion. Read the relevant material in Sobell! If
More informationUnix as a Platform Exercises. Course Code: OS-01-UNXPLAT
Unix as a Platform Exercises Course Code: OS-01-UNXPLAT Working with Unix 1. Use the on-line manual page to determine the option for cat, which causes nonprintable characters to be displayed. Run the command
More informationUnix/Linux Basics. Cpt S 223, Fall 2007 Copyright: Washington State University
Unix/Linux Basics 1 Some basics to remember Everything is case sensitive Eg., you can have two different files of the same name but different case in the same folder Console-driven (same as terminal )
More informationWhen talking about how to launch commands and other things that is to be typed into the terminal, the following syntax is used:
Linux Tutorial How to read the examples When talking about how to launch commands and other things that is to be typed into the terminal, the following syntax is used: $ application file.txt
More information1) Introduc,on to unix command line and perl. Ma5 Webster IMBIM, BMC
1) Introduc,on to unix command line and perl Ma5 Webster IMBIM, BMC ma5hew.webster@imbim.uu.se Perl course details course book Learning Perl (6 ed.) lectures cover chapters morning lectures + aiernoon
More informationCSE Linux VM. For Microsoft Windows. Based on opensuse Leap 42.2
CSE Linux VM For Microsoft Windows Based on opensuse Leap 42.2 Dr. K. M. Flurchick February 2, 2017 Contents 1 Introduction 1 2 Requirements 1 3 Procedure 1 4 Usage 3 4.1 Start/Stop.................................................
More informationIntroduction to UNIX. Logging in. Basic System Architecture 10/7/10. most systems have graphical login on Linux machines
Introduction to UNIX Logging in Basic system architecture Getting help Intro to shell (tcsh) Basic UNIX File Maintenance Intro to emacs I/O Redirection Shell scripts Logging in most systems have graphical
More informationUnix Introduction to UNIX
Unix Introduction to UNIX Get Started Introduction The UNIX operating system Set of programs that act as a link between the computer and the user. Developed in 1969 by a group of AT&T employees Various
More informationTable of contents. Our goal. Notes. Notes. Notes. Summer June 29, Our goal is to see how we can use Unix as a tool for developing programs
Summer 2010 Department of Computer Science and Engineering York University Toronto June 29, 2010 1 / 36 Table of contents 1 2 3 4 2 / 36 Our goal Our goal is to see how we can use Unix as a tool for developing
More informationWhere can UNIX be used? Getting to the terminal. Where are you? most important/useful commands & examples. Real Unix computers
Where can UNIX be used? Introduction to Unix: most important/useful commands & examples Bingbing Yuan Jan. 19, 2010 Real Unix computers tak, the Whitehead h Scientific Linux server Apply for an account
More informationhttp://xkcd.com/208/ 1. Review of pipes 2. Regular expressions 3. sed 4. awk 5. Editing Files 6. Shell loops 7. Shell scripts cat seqs.fa >0! TGCAGGTATATCTATTAGCAGGTTTAATTTTGCCTGCACTTGGTTGGGTACATTATTTTAAGTGTATTTGACAAG!
More informationPerl and R Scripting for Biologists
Perl and R Scripting for Biologists Lukas Mueller PLBR 4092 Course overview Linux basics (today) Linux advanced (Aure, next week) Why Linux? Free open source operating system based on UNIX specifications
More informationUnix L555. Dept. of Linguistics, Indiana University Fall Unix. Unix. Directories. Files. Useful Commands. Permissions. tar.
L555 Dept. of Linguistics, Indiana University Fall 2010 1 / 21 What is? is an operating system, like DOS or Windows developed in 1969 by Bell Labs works well for single computers as well as for servers
More informationUseful Unix Commands Cheat Sheet
Useful Unix Commands Cheat Sheet The Chinese University of Hong Kong SIGSC Training (Fall 2016) FILE AND DIRECTORY pwd Return path to current directory. ls List directories and files here. ls dir List
More informationCMPT 300. Operating Systems. Brief Intro to UNIX and C
CMPT 300 Operating Systems Brief Intro to UNIX and C Outline Welcome Review Questions UNIX basics and Vi editor Using SSH to remote access Lab2(4214) Compiling a C Program Makefile Basic C/C++ programming
More informationShell. SSE2034: System Software Experiment 3, Fall 2018, Jinkyu Jeong
Shell Prof. Jinkyu Jeong (Jinkyu@skku.edu) TA -- Minwoo Ahn (minwoo.ahn@csl.skku.edu) TA -- Donghyun Kim (donghyun.kim@csl.skku.edu) Computer Systems Laboratory Sungkyunkwan University http://csl.skku.edu
More informationLinux environment. Graphical interface X-window + window manager. Text interface terminal + shell
Linux environment Graphical interface X-window + window manager Text interface terminal + shell ctrl-z put running command to background (come back via command fg) Terminal basics Two basic shells - slightly
More informationsottotitolo A.A. 2016/17 Federico Reghenzani, Alessandro Barenghi
Titolo presentazione Piattaforme Software per la Rete sottotitolo BASH Scripting Milano, XX mese 20XX A.A. 2016/17, Alessandro Barenghi Outline 1) Introduction to BASH 2) Helper commands 3) Control Flow
More informationStatistics 202A - vi Tutorial
Statistics 202A - vi Tutorial Ryan Rosario October 16, 2007 vi is by far my favorite editor. The material for this handout came from http://www.eng.hawaii.edu/tutor/vi.html and credit is given to them.
More informationFREEENGINEER.ORG. 1 of 6 11/5/15 8:31 PM. Learn UNIX in 10 minutes. Version 1.3. Preface
FREEENGINEER.ORG Learn UNIX in 10 minutes. Version 1.3 Preface This is something that I had given out to students (CAD user training) in years past. The purpose was to have on one page the basics commands
More informationIntroduction to Linux. Roman Cheplyaka
Introduction to Linux Roman Cheplyaka Generic commands, files, directories What am I running? ngsuser@ubuntu:~$ cat /etc/lsb-release DISTRIB_ID=Ubuntu DISTRIB_RELEASE=16.04 DISTRIB_CODENAME=xenial DISTRIB_DESCRIPTION="Ubuntu
More informationBasic Linux Commands. Srihari Kalgi M.Tech, CSE (KReSIT), IIT Bombay. May 5, 2009
Basic Linux Commands Srihari Kalgi M.Tech, CSE (KReSIT), IIT Bombay May 5, 2009 General Purpose utilities Linux File System File Handling Commands Compressing and Archiving Files Simple Filters General
More informationStd: XI CHAPTER-3 LINUX
Commands: General format: Command Option Argument Command: ls - Lists the contents of a file. Option: Begins with minus sign (-) ls a Lists including the hidden files. Argument refers to the name of a
More informationScripting Languages Course 1. Diana Trandabăț
Scripting Languages Course 1 Diana Trandabăț Master in Computational Linguistics - 1 st year 2017-2018 Today s lecture Introduction to scripting languages What is a script? What is a scripting language
More informationQUESTION BANK ON UNIX & SHELL PROGRAMMING-502 (CORE PAPER-2)
BANK ON & SHELL PROGRAMMING-502 (CORE PAPER-2) TOPIC 1: VI-EDITOR MARKS YEAR 1. Explain set command of vi editor 2 2011oct 2. Explain the modes of vi editor. 7 2013mar/ 2013 oct 3. Explain vi editor 5
More informationBok, Jong Soon
Using VI Editor Bok, Jong Soon javaexpert@nate.com www.javaexpert.co.kr Linux Text Editors - Gedit Lab 1 : Installation Gedit Plugins Installation Gedit Plugins (1/3) 1. $ sudo apt-get install y gedit-plugins
More informationBasic Linux (Bash) Commands
Basic Linux (Bash) Commands Hint: Run commands in the emacs shell (emacs -nw, then M-x shell) instead of the terminal. It eases searching for and revising commands and navigating and copying-and-pasting
More informationUsing UNIX. -rwxr--r-- 1 root sys Sep 5 14:15 good_program
Using UNIX. UNIX is mainly a command line interface. This means that you write the commands you want executed. In the beginning that will seem inferior to windows point-and-click, but in the long run the
More informationFirst of all, these notes will cover only a small subset of the available commands and utilities, and will cover most of those in a shallow fashion.
Warnings 1 First of all, these notes will cover only a small subset of the available commands and utilities, and will cover most of those in a shallow fashion. Read the relevant material in Sobell! If
More informationUsing the Unix system. UNIX Introduction
Using the Unix system Navigating the Unix file system Editing with emacs Compiling with gcc UNIX Introduction The UNIX operating system is made up of three parts: the kernel, the shell and the programs
More informationFirst of all, these notes will cover only a small subset of the available commands and utilities, and will cover most of those in a shallow fashion.
Warnings 1 First of all, these notes will cover only a small subset of the available commands and utilities, and will cover most of those in a shallow fashion. Read the relevant material in Sobell! If
More informationSome useful UNIX Commands written down by Razor for newbies to get a start in UNIX
Some useful UNIX Commands written down by Razor for newbies to get a start in UNIX 15th Jan. 2000 / 3:55 am Part 1: Working with files and rights ------------------------------------- cp
More informationSet 1 MCQ Which command is used to sort the lines of data in a file in reverse order A) sort B) sh C) st D) sort -r
1. Which symbol will be used with grep command to match the pattern pat at the beginning of a line? A) ^pat B) $pat C) pat$ D) pat^ 2. Which command is used to sort the lines of data in a file in reverse
More informationAC109/AT109 UNIX & SHELL PROGRAMMING DEC 2014
Q.2 a. Explain the principal components: Kernel and Shell, of the UNIX operating system. Refer Page No. 22 from Textbook b. Explain absolute and relative pathnames with the help of examples. Refer Page
More informationacmteam/unix.pdf How to manage your account (user ID, password, shell); How to compile C, C++, and Java programs;
Note: you can find this file under: http://www.cs.queensu.ca/ acmteam/unix.pdf Introduction to Unix Tutorial In this tutorial, you will learn: How to manage your account (user ID, password, shell); Navigating
More informationGetting Started. Running Utilities. Shells. Special Characters. Special Characters. Chapter 2 Unix Utilities for non-programmers
Chapter 2 Unix Utilities for non-programmers Graham Glass and King Ables, UNIX for Programmers and Users, Third Edition, Pearson Prentice Hall, 2003. Original Notes by Raj Sunderraman Converted to presentation
More informationPractical Linux examples: Exercises
Practical Linux examples: Exercises 1. Login (ssh) to the machine that you are assigned for this workshop (assigned machines: https://cbsu.tc.cornell.edu/ww/machines.aspx?i=87 ). Prepare working directory,
More informationUtilities. September 8, 2015
Utilities September 8, 2015 Useful ideas Listing files and display text and binary files Copy, move, and remove files Search, sort, print, compare files Using pipes Compression and archiving Your fellow
More informationUnix Essentials. BaRC Hot Topics Bioinformatics and Research Computing Whitehead Institute October 12 th
Unix Essentials BaRC Hot Topics Bioinformatics and Research Computing Whitehead Institute October 12 th 2016 http://barc.wi.mit.edu/hot_topics/ 1 Outline Unix overview Logging in to tak Directory structure
More informationProgram Development Tools. Lexical Analyzers. Lexical Analysis Terms. Attributes for Tokens
Program Development Tools lex makefiles vi and gvim ctags source level debugging diff and cmp Lexical Analyzers A lexical analyzer reads in a stream of characters as input and produces a sequence of symbols
More informationIntroduction to Linux Organizing Files
Introduction to Linux Organizing Files Computational Science and Engineering North Carolina A&T State University Instructor: Dr. K. M. Flurchick Email: kmflurch@ncat.edu Arranging, Organizing, Packing
More informationhttp://xkcd.com/208/ 1. Review of pipes 2. Regular expressions 3. sed 4. Editing Files 5. Shell loops 6. Shell scripts cat seqs.fa >0! TGCAGGTATATCTATTAGCAGGTTTAATTTTGCCTGCACTTGGTTGGGTACATTATTTTAAGTGTATTTGACAAG!
More informationCS4350 Unix Programming. Outline
Outline Unix Management Files and file systems Structure of Unix Commands Command help (man) Log on (terminal vs. graphical) System information (utility) File and directory structure (path) Permission
More informationContents. xxvii. Preface
Preface xxvii Chapter 1: Welcome to Linux 1 The GNU Linux Connection 2 The History of GNU Linux 2 The Code Is Free 4 Have Fun! 5 The Heritage of Linux: UNIX 5 What Is So Good About Linux? 6 Why Linux Is
More informationCSCI 2132 Software Development. Lecture 5: File Permissions
CSCI 2132 Software Development Lecture 5: File Permissions Instructor: Vlado Keselj Faculty of Computer Science Dalhousie University 14-Sep-2018 (5) CSCI 2132 1 Files and Directories Pathnames Previous
More informationfor more :-
JNTU ONLINE EXAMINATIONS [Mid 1 - UNIX] 1. C programmers in the unix environment has complete access to the entire system call library as well as the a. static library functions b. dynamic library functions
More informationFirst of all, these notes will cover only a small subset of the available commands and utilities, and will cover most of those in a shallow fashion.
Warnings Linux Commands 1 First of all, these notes will cover only a small subset of the available commands and utilities, and will cover most of those in a shallow fashion. Read the relevant material
More informationIntroduction to Unix The Windows User perspective. Wes Frisby Kyle Horne Todd Johansen
Introduction to Unix The Windows User perspective Wes Frisby Kyle Horne Todd Johansen What is Unix? Portable, multi-tasking, and multi-user operating system Software development environment Hardware independent
More informationIntroduction to UNIX Command Line
Introduction to UNIX Command Line Files and directories Some useful commands (echo, cat, grep, find, diff, tar) Redirection Pipes Variables Background processes Remote connections (e.g. ssh, curl) Scripts
More informationUnix Tools / Command Line
Unix Tools / Command Line An Intro 1 Basic Commands / Utilities I expect you already know most of these: ls list directories common options: -l, -F, -a mkdir, rmdir make or remove a directory mv move/rename
More informationCloud Computing and Unix: An Introduction. Dr. Sophie Shaw University of Aberdeen, UK
Cloud Computing and Unix: An Introduction Dr. Sophie Shaw University of Aberdeen, UK s.shaw@abdn.ac.uk Aberdeen London Exeter What We re Going To Do Why Unix? Cloud Computing Connecting to AWS Introduction
More informationChapter-3. Introduction to Unix: Fundamental Commands
Chapter-3 Introduction to Unix: Fundamental Commands What You Will Learn The fundamental commands of the Unix operating system. Everything told for Unix here is applicable to the Linux operating system
More informationCloud Computing and Unix: An Introduction. Dr. Sophie Shaw University of Aberdeen, UK
Cloud Computing and Unix: An Introduction Dr. Sophie Shaw University of Aberdeen, UK s.shaw@abdn.ac.uk Aberdeen London Exeter What We re Going To Do Why Unix? Cloud Computing Connecting to AWS Introduction
More informationGetting your department account
02/11/2013 11:35 AM Getting your department account The instructions are at Creating a CS account 02/11/2013 11:36 AM Getting help Vijay Adusumalli will be in the CS majors lab in the basement of the Love
More informationShell Programming Systems Skills in C and Unix
Shell Programming 15-123 Systems Skills in C and Unix The Shell A command line interpreter that provides the interface to Unix OS. What Shell are we on? echo $SHELL Most unix systems have Bourne shell
More informationOutline. Structure of a UNIX command
Outline Structure of Unix Commands Command help (man) Log on (terminal vs. graphical) System information (utility) File and directory structure (path) Permission (owner, group, rwx) File and directory
More informationEmbedded Linux Systems. Bin Li Assistant Professor Dept. of Electrical, Computer and Biomedical Engineering University of Rhode Island
Embedded Linux Systems Bin Li Assistant Professor Dept. of Electrical, Computer and Biomedical Engineering University of Rhode Island Generic Embedded Systems Structure User Sensors ADC microcontroller
More informationIBM AIX Basic Operations V5.
IBM 000-190 AIX Basic Operations V5 http://killexams.com/exam-detail/000-190 QUESTION: 122 Which of the following options describes the rm -i command? A. It removes and reports the file names it removes.
More informationThe Unix Shell & Shell Scripts
The Unix Shell & Shell Scripts You should do steps 1 to 7 before going to the lab. Use the Linux system you installed in the previous lab. In the lab do step 8, the TA may give you additional exercises
More informationA Brief Introduction to the Linux Shell for Data Science
A Brief Introduction to the Linux Shell for Data Science Aris Anagnostopoulos 1 Introduction Here we will see a brief introduction of the Linux command line or shell as it is called. Linux is a Unix-like
More informationThe Linux Command Line & Shell Scripting
The Linux Command Line & Shell Scripting [web] [email] portal.biohpc.swmed.edu biohpc-help@utsouthwestern.edu 1 Updated for 2017-11-18 Study Resources : A Free Book 500+ pages * Some of the materials covered
More informationComputer Programming Lecture 3 이윤진서울대학교
Computer Programming Lecture 3 이윤진서울대학교 2007.12.27. 27 Slide Credits 엄현상교수님 서울대학교컴퓨터공학부 Computer Programming, g, 2007 봄학기 Editors 순서 Editors vi emacs Q&A Editors Vi (VIsual) Text Editor Interactive Computer
More informationVIP Quick Reference Card
VIP Quick Reference Card Loading VIP (Based on VIP 3.5 in GNU Emacs 18) Just type M-x vip-mode followed by RET VIP Modes VIP has three modes: emacs mode, vi mode and insert mode. Mode line tells you which
More informationLOG ON TO LINUX AND LOG OFF
EXPNO:1A LOG ON TO LINUX AND LOG OFF AIM: To know how to logon to Linux and logoff. PROCEDURE: Logon: To logon to the Linux system, we have to enter the correct username and password details, when asked,
More informationWeek Overview. Unix file system File types and file naming Basic file system commands: pwd,cd,ls,mkdir,rmdir,mv,cp,rm man pages
ULI101 Week 02 Week Overview Unix file system File types and file naming Basic file system commands: pwd,cd,ls,mkdir,rmdir,mv,cp,rm man pages Text editing Common file utilities: cat,more,less,touch,file,find
More informationUNIX Shell Programming
$!... 5:13 $$ and $!... 5:13.profile File... 7:4 /etc/bashrc... 10:13 /etc/profile... 10:12 /etc/profile File... 7:5 ~/.bash_login... 10:15 ~/.bash_logout... 10:18 ~/.bash_profile... 10:14 ~/.bashrc...
More informationVI Commands Cheat Sheets
VI Commands Cheat Sheets Before doing anything to a document, type the following command followed by a carriage return: :set showmode GOOD PRACTICE NOTE ESPECIALLY FOR BEGINNERS: WHEN USING VI, HIT [ESC]
More informationGetting started with Hugs on Linux
Getting started with Hugs on Linux COM1022 Functional Programming Techniques Dr Hans Georg Schaathun University of Surrey Autumn 2009 Week 7 Dr Hans Georg Schaathun Getting started with Hugs on Linux Autumn
More informationAppendix B WORKSHOP. SYS-ED/ Computer Education Techniques, Inc.
Appendix B WORKSHOP SYS-ED/ Computer Education Techniques, Inc. 1 Introduction There are no workshops for this chapter. The instructor will provide demonstrations and examples. SYS-ED/COMPUTER EDUCATION
More informationIntroduction to Unix: Fundamental Commands
Introduction to Unix: Fundamental Commands Ricky Patterson UVA Library Based on slides from Turgut Yilmaz Istanbul Teknik University 1 What We Will Learn The fundamental commands of the Unix operating
More informationVERY SHORT INTRODUCTION TO UNIX
VERY SHORT INTRODUCTION TO UNIX Tore Samuelsson, Nov 2009. An operating system (OS) is an interface between hardware and user which is responsible for the management and coordination of activities and
More informationIntroduction to remote command line Linux. Research Computing Team University of Birmingham
Introduction to remote command line Linux Research Computing Team University of Birmingham Linux/UNIX/BSD/OSX/what? v All different v UNIX is the oldest, mostly now commercial only in large environments
More informationUnix as a Platform Exercises + Solutions. Course Code: OS 01 UNXPLAT
Unix as a Platform Exercises + Solutions Course Code: OS 01 UNXPLAT Working with Unix Most if not all of these will require some investigation in the man pages. That's the idea, to get them used to looking
More informationBIOINFORMATICS POST-DIPLOMA PROGRAM SUBJECT OUTLINE Subject Title: OPERATING SYSTEMS AND PROJECT MANAGEMENT Subject Code: BIF713 Subject Description:
BIOINFORMATICS POST-DIPLOMA PROGRAM SUBJECT OUTLINE Subject Title: OPERATING SYSTEMS AND PROJECT MANAGEMENT Subject Code: BIF713 Subject Description: This course provides Bioinformatics students with the
More informationUNIX Commands. Ex: $ pwd $/tmp $cd/home/sales, this will change the directory from /tmp to /home/sales.
UNIX Commands ls: File name and directory names are displayed using the ls command. This will display all the files and the directories which are present under that directory. $ls -l -rwxr-xr-x 1 sales
More informationIntroduction: What is Unix?
Introduction Introduction: What is Unix? An operating system Developed at AT&T Bell Labs in the 1960 s Command Line Interpreter GUIs (Window systems) are now available Introduction: Unix vs. Linux Unix
More informationWeek 2 Lecture 3. Unix
Lecture 3 Unix Terminal and Shell 2 Terminal Prompt Command Argument Result 3 Shell Intro A system program that allows a user to execute: shell functions (e.g., ls -la) other programs (e.g., eclipse) shell
More informationUnix File System. Learning command-line navigation of the file system is essential for efficient system usage
ULI101 Week 02 Week Overview Unix file system File types and file naming Basic file system commands: pwd,cd,ls,mkdir,rmdir,mv,cp,rm man pages Text editing Common file utilities: cat,more,less,touch,file,find
More informationThe Unix Shell. Pipes and Filters
The Unix Shell Copyright Software Carpentry 2010 This work is licensed under the Creative Commons Attribution License See http://software-carpentry.org/license.html for more information. shell shell pwd
More informationTHE HONG KONG POLYTECHNIC UNIVERSITY Department of Electronic and Information Engineering
THE HONG KONG POLYTECHNIC UNIVERSITY Department of Electronic and Information Engineering ENG224 Information Technology Part I: Computers and the Internet Laboratory 2 Linux Shell Commands and vi Editor
More informationUNIX. Basic UNIX Command
UNIX Basic UNIX Command Command List ls mkdir mv chmod groupadd hostname kill head top compress/ uncompress pwd Cat find chown useradd id ioscan pdf sar cd more grep chgrp passwd mount dmesg netstat tar
More informationUNIX ASSIGNMENT 1 TYBCA (Sem:V)
UNIX ASSIGNMENT 1 TYBCA (Sem:V) Given Date: 06-08-2015 1. Explain the difference between the following thru example ln & paste tee & (pipeline) 2. What is the difference between the following commands
More informationUNIX Basics. UNIX Basics CIS 218 Oakton Community College
UNIX Basics UNIX Basics CIS 218 Oakton Community College History UNIX was invented in 1969 at AT&T Bell Labs Ken Thompson and Dennis Ritchie are credited as the original architects and developers of C.
More informationUnix/Linux Primer. Taras V. Pogorelov and Mike Hallock School of Chemical Sciences, University of Illinois
Unix/Linux Primer Taras V. Pogorelov and Mike Hallock School of Chemical Sciences, University of Illinois August 25, 2017 This primer is designed to introduce basic UNIX/Linux concepts and commands. No
More informationLinux/Cygwin Practice Computer Architecture
Linux/Cygwin Practice 2010 Computer Architecture Linux Login Use ssh client applications to connect (Port : 22) SSH Clients zterm ( http://www.brainz.co.kr/products/products4_2.php ) Putty ( http://kldp.net/frs/download.php/3411/hangulputty-0.58.h2.exe
More information