Our typical RNA quantification pipeline
|
|
- Eileen McCormick
- 5 years ago
- Views:
Transcription
1 RNA-Seq primer
2 Our typical RNA quantification pipeline Upload your sequence data (fastq) Align to the ribosome (Bow>e) Align remaining reads to genome (TopHat) or transcriptome (RSEM) Make report of quality metrics Output ribosomal contamina>on metrics report Produce RNA- Seq report % aligned, % intergenic, % exonic, % UTR Produce IGV/UCSC friendly files Quan>fy transcriptome Call differen>ally expressed genes (if mul>ple samples) Produce a table with normalized expression values Report pairwise significant genes that are differen>ally expressed
3 Initial analysis
4 Summary I Data types, file formats and utilities Annotation: Genomic regions Genes Peaks Bedtools to manipulate them Alignment: Map reads BAM/SAM Samtools to manipulate them Aggregation: Summary files Wig (UCSC) TDF (IGV)
5 Summary II Data process Short read alignment (Bowtie, BWA) Making the genome searchable: Hashing/BW Seed an extend (hashing) vs suffix searches (BW) New aligners are mix Spliced aligners (TopHat, STAR, GSNAP) Map read fragments then strung them Choosing the fragment size Avoiding biases using information (junctions) Quantifying (RSEM/Cufflinks) Read/Isoform assignment Normalization procedures Differential expression (DESeq/EdgeR/Cufflinks)
6 Visualization tricks & Tips Viewing normalized data Downsampling reads to avoid crashes Gene lists Sessions
7 IGV: Integrative Genomics Viewer A desktop applica>on for the visualization and interac>ve explora>on of genomic data Microarrays Epigenomics RNA- Seq NGS alignments Compara:ve genomics
8 Visualizing read alignments with IGV RNASeq
9 Visualizing read alignments with IGV zooming out RNA Seq t K4me3 ChIP Seq PolII ChIPSeq t Cebeb ChIP Seq
10 Viewing several loci simulateneouly: Gene lists
11 Viewing several loci simultaneously: Gene lists
12 Lets create a list using our small dataset Use the following genes Fgf21 Bcat2 Rasip1 Naa60 Which are all within the dataset we selected.
13 Normalizing tracks You can use simple read depth normaliza>on for comparison of different tracks
14 Configure your alignment display Downsampling reads is cri>cal when loading the full alignments. When you are loading reads, downsampling ensures that regions with high coverage result in IGV running out of memory.
15 Saving sessions Sessions allows you to store a set of desired tracks along with any seyng you want
16 Todays topics Looking at ALL of your data
17 Comparing samples: Scatter plots Scatter plot RPKM Sample 2 RPKM Sample 1 RPKM
18 Raw counts/rpkms are NOT Gaussian Density distribution RPKM Density RPKM
19 ... they are more like Log-Gaussian Density distribution log RPKM Density LOG RPKM
20 And log counts/rpkm can be scatter-plotted Control 1e+05 1e+03 1e+01 1e+01 1e+03 Treat 1e+05
21 Which can also be looked at as an MA-Plot Log2 Fold Change (M) Log2 mean normalized counts (A) 30 40
22 Hierarchical clustering vector similarity? Gene Cond1 Cond2 Cond3 Cond4 g g g g Clustering is about similarity: Between two rows (specified by a distance func>on) Between two sets of rows (specified by the linkage method)
23 Common similarity approaches Distance between rows (or columns) Correlation: d(r,s) = (1- cor(r,s))/2 Euclidean: d(r,s) = sqrt(σ i (r i s i ) 2 ) Linkage: Distance betwee two sets (d(r,s)) Complete: Average: Single: G max {d(r, s),s2 S, r 2 R} { 2 2 } mean {d(r,{ s),s22 S, r 2 R} } min {d(r, s),s2 2 S, r 2 R} } Gene Cond1 Cond2 Cond3 Cond4 g g g g
24 The effect of the linkage method Complete linkage correlation Single linkage correlation g1 g2 g1 g2 Height g3 g4 Height g3 g4 Gene Cond1 Cond2 Cond3 Cond4 g g g g
25 Effect of the distance! Complete linkage correlation Complete linkage euclidean g1 g2 g1 g4 Height g3 g4 Height g2 g3 Gene Cond1 Cond2 Cond3 Cond4 g g g g
26 Playing with clustering #Define the toy matrix# ####################### m = rbind (c(2.5,5,7.5,10), c(0.2,0.5,0.8,1.1), c(0.2,0.3,0.4,11), c(2.5,8,8,9)) #Give column and row names# ########################### rownames(m) = c("g1","g2","g3","g4"); colnames(m) = c("c1","c2","c3","c4"); #Compute the correlation distance matrix# ######################################### submat.dist = as.dist( (1 - cor(t(m)) ) /2 ); #Plot clustering with the three main methods# ############################################# plot( hclust(submat.dist, method="complete",members=null), main="complete linkeage - correlation", sub="", xlab="", lwd=3); plot( hclust(submat.dist, method="average",members=null), main = "Average Linkeage - correlation", sub="", xlab="", lwd=3); plot( hclust(submat.dist, method="single",members=null), main = "Single Linkeage- correlation", sub="", xlab="", lwd=3); #Plot clustering with the three main methods, using the euclidean distance# ########################################################################### plot( hclust(dist(m), method="complete",members=null), main="complete linkeage - euclidean", sub="", xlab="", lwd=3); plot( hclust(dist(m), method="average",members=null), main = "Average Linkeage - euclidean", sub="", xlab="", lwd=3); plot( hclust(dist(m), method="single",members=null), main = "Single Linkeage - euclidean", sub="", xlab="", lwd=3);
Integrative Genomics Viewer. Prat Thiru
Integrative Genomics Viewer Prat Thiru 1 Overview User Interface Basics Browsing the Data Data Formats IGV Tools Demo Outline Based on ISMB 2010 Tutorial by Robinson and Thorvaldsdottir 2 Why IGV? IGV
More informationNGS Data Visualization and Exploration Using IGV
1 What is Galaxy Galaxy for Bioinformaticians Galaxy for Experimental Biologists Using Galaxy for NGS Analysis NGS Data Visualization and Exploration Using IGV 2 What is Galaxy Galaxy for Bioinformaticians
More informationSequence Analysis Pipeline
Sequence Analysis Pipeline Transcript fragments 1. PREPROCESSING 2. ASSEMBLY (today) Removal of contaminants, vector, adaptors, etc Put overlapping sequence together and calculate bigger sequences 3. Analysis/Annotation
More informationRNA-seq. Manpreet S. Katari
RNA-seq Manpreet S. Katari Evolution of Sequence Technology Normalizing the Data RPKM (Reads per Kilobase of exons per million reads) Score = R NT R = # of unique reads for the gene N = Size of the gene
More informationNGS Analysis Using Galaxy
NGS Analysis Using Galaxy Sequences and Alignment Format Galaxy overview and Interface Get;ng Data in Galaxy Analyzing Data in Galaxy Quality Control Mapping Data History and workflow Galaxy Exercises
More informationDr. Gabriela Salinas Dr. Orr Shomroni Kaamini Rhaithata
Analysis of RNA sequencing data sets using the Galaxy environment Dr. Gabriela Salinas Dr. Orr Shomroni Kaamini Rhaithata Microarray and Deep-sequencing core facility 30.10.2017 RNA-seq workflow I Hypothesis
More informationGalaxy Platform For NGS Data Analyses
Galaxy Platform For NGS Data Analyses Weihong Yan wyan@chem.ucla.edu Collaboratory Web Site http://qcb.ucla.edu/collaboratory Collaboratory Workshops Workshop Outline ü Day 1 UCLA galaxy and user account
More informationMaize genome sequence in FASTA format. Gene annotation file in gff format
Exercise 1. Using Tophat/Cufflinks to analyze RNAseq data. Step 1. One of CBSU BioHPC Lab workstations has been allocated for your workshop exercise. The allocations are listed on the workshop exercise
More informationRNA-Seq Analysis With the Tuxedo Suite
June 2016 RNA-Seq Analysis With the Tuxedo Suite Dena Leshkowitz Introduction In this exercise we will learn how to analyse RNA-Seq data using the Tuxedo Suite tools: Tophat, Cuffmerge, Cufflinks and Cuffdiff.
More informationAligners. J Fass 21 June 2017
Aligners J Fass 21 June 2017 Definitions Assembly: I ve found the shredded remains of an important document; put it back together! UC Davis Genome Center Bioinformatics Core J Fass Aligners 2017-06-21
More informationData Processing and Analysis in Systems Medicine. Milena Kraus Data Management for Digital Health Summer 2017
Milena Kraus Digital Health Summer Agenda Real-world Use Cases Oncology Nephrology Heart Insufficiency Additional Topics Data Management & Foundations Biology Recap Data Sources Data Formats Business Processes
More informationBGGN-213: FOUNDATIONS OF BIOINFORMATICS (Lecture 14)
BGGN-213: FOUNDATIONS OF BIOINFORMATICS (Lecture 14) Genome Informatics (Part 1) https://bioboot.github.io/bggn213_f17/lectures/#14 Dr. Barry Grant Nov 2017 Overview: The purpose of this lab session is
More informationDifferential gene expression analysis using RNA-seq
https://abc.med.cornell.edu/ Differential gene expression analysis using RNA-seq Applied Bioinformatics Core, September/October 2018 Friederike Dündar with Luce Skrabanek & Paul Zumbo Day 3: Counting reads
More informationTutorial: RNA-Seq Analysis Part II (Tracks): Non-Specific Matches, Mapping Modes and Expression measures
: RNA-Seq Analysis Part II (Tracks): Non-Specific Matches, Mapping Modes and February 24, 2014 Sample to Insight : RNA-Seq Analysis Part II (Tracks): Non-Specific Matches, Mapping Modes and : RNA-Seq Analysis
More informationChIP-seq hands-on practical using Galaxy
ChIP-seq hands-on practical using Galaxy In this exercise we will cover some of the basic NGS analysis steps for ChIP-seq using the Galaxy framework: Quality control Mapping of reads using Bowtie2 Peak-calling
More informationHow to store and visualize RNA-seq data
How to store and visualize RNA-seq data Gabriella Rustici Functional Genomics Group gabry@ebi.ac.uk EBI is an Outstation of the European Molecular Biology Laboratory. Talk summary How do we archive RNA-seq
More informationServices Performed. The following checklist confirms the steps of the RNA-Seq Service that were performed on your samples.
Services Performed The following checklist confirms the steps of the RNA-Seq Service that were performed on your samples. SERVICE Sample Received Sample Quality Evaluated Sample Prepared for Sequencing
More informationCLC Server. End User USER MANUAL
CLC Server End User USER MANUAL Manual for CLC Server 10.0.1 Windows, macos and Linux March 8, 2018 This software is for research purposes only. QIAGEN Aarhus Silkeborgvej 2 Prismet DK-8000 Aarhus C Denmark
More informationAnalysis of ChIP-seq data
Before we start: 1. Log into tak (step 0 on the exercises) 2. Go to your lab space and create a folder for the class (see separate hand out) 3. Connect to your lab space through the wihtdata network and
More informationColorado State University Bioinformatics Algorithms Assignment 6: Analysis of High- Throughput Biological Data Hamidreza Chitsaz, Ali Sharifi- Zarchi
Colorado State University Bioinformatics Algorithms Assignment 6: Analysis of High- Throughput Biological Data Hamidreza Chitsaz, Ali Sharifi- Zarchi Although a little- bit long, this is an easy exercise
More informationData: ftp://ftp.broad.mit.edu/pub/users/bhaas/rnaseq_workshop/rnaseq_workshop_dat a.tgz. Software:
A Tutorial: De novo RNA- Seq Assembly and Analysis Using Trinity and edger The following data and software resources are required for following the tutorial: Data: ftp://ftp.broad.mit.edu/pub/users/bhaas/rnaseq_workshop/rnaseq_workshop_dat
More informationEnsembl RNASeq Practical. Overview
Ensembl RNASeq Practical The aim of this practical session is to use BWA to align 2 lanes of Zebrafish paired end Illumina RNASeq reads to chromosome 12 of the zebrafish ZV9 assembly. We have restricted
More informationShort Read Sequencing Analysis Workshop
Short Read Sequencing Analysis Workshop Day 8: Introduc/on to RNA-seq Analysis In-class slides Day 7 Homework 1.) 14 GABPA ChIP-seq peaks 2.) Error: Dataset too large (> 100000). Rerun with larger maxsize
More informationGalaxy workshop at the Winter School Igor Makunin
Galaxy workshop at the Winter School 2016 Igor Makunin i.makunin@uq.edu.au Winter school, UQ, July 6, 2016 Plan Overview of the Genomics Virtual Lab Introduce Galaxy, a web based platform for analysis
More informationGene Expression Data Analysis. Qin Ma, Ph.D. December 10, 2017
1 Gene Expression Data Analysis Qin Ma, Ph.D. December 10, 2017 2 Bioinformatics Systems biology This interdisciplinary science is about providing computational support to studies on linking the behavior
More information11/8/2017 Trinity De novo Transcriptome Assembly Workshop trinityrnaseq/rnaseq_trinity_tuxedo_workshop Wiki GitHub
trinityrnaseq / RNASeq_Trinity_Tuxedo_Workshop Trinity De novo Transcriptome Assembly Workshop Brian Haas edited this page on Oct 17, 2015 14 revisions De novo RNA-Seq Assembly and Analysis Using Trinity
More informationDifferential Expression Analysis at PATRIC
Differential Expression Analysis at PATRIC The following step- by- step workflow is intended to help users learn how to upload their differential gene expression data to their private workspace using Expression
More informationSingle/paired-end RNAseq analysis with Galaxy
October 016 Single/paired-end RNAseq analysis with Galaxy Contents: 1. Introduction. Quality control 3. Alignment 4. Normalization and read counts 5. Workflow overview 6. Sample data set to test the paired-end
More informationGoal: Learn how to use various tool to extract information from RNAseq reads. 4.1 Mapping RNAseq Reads to a Genome Assembly
ESSENTIALS OF NEXT GENERATION SEQUENCING WORKSHOP 2014 UNIVERSITY OF KENTUCKY AGTC Class 4 RNAseq Goal: Learn how to use various tool to extract information from RNAseq reads. Input(s): magnaporthe_oryzae_70-15_8_supercontigs.fasta
More informationChIP-seq hands-on practical using Galaxy
ChIP-seq hands-on practical using Galaxy In this exercise we will cover some of the basic NGS analysis steps for ChIP-seq using the Galaxy framework: Quality control Mapping of reads using Bowtie2 Peak-calling
More information!"#$%&$'()#$*)+,-./).01"0#,23+3,303456"6,&((46,7$+-./&((468,
!"#$%&$'()#$*)+,-./).01"0#,23+3,303456"6,&((46,7$+-./&((468, 9"(1(02)1+(',:.;.4(*.',?9@A,!."2.4B.'#A,C(;.
More informationmrna-seq Basic processing Read mapping (shown here, but optional. May due if time allows) Gene expression estimation
mrna-seq Basic processing Read mapping (shown here, but optional. May due if time allows) Tophat Gene expression estimation cufflinks Confidence intervals Gene expression changes (separate use case) Sample
More informationOur data for today is a small subset of Saimaa ringed seal RNA sequencing data (RNA_seq_reads.fasta). Let s first see how many reads are there:
Practical Course in Genome Bioinformatics 19.2.2016 (CORRECTED 22.2.2016) Exercises - Day 5 http://ekhidna.biocenter.helsinki.fi/downloads/teaching/spring2016/ Answer the 5 questions (Q1-Q5) according
More informationIntroduction to Read Alignment. UCD Genome Center Bioinformatics Core Tuesday 15 September 2015
Introduction to Read Alignment UCD Genome Center Bioinformatics Core Tuesday 15 September 2015 From reads to molecules Why align? Individual A Individual B ATGATAGCATCGTCGGGTGTCTGCTCAATAATAGTGCCGTATCATGCTGGTGTTATAATCGCCGCATGACATGATCAATGG
More informationRNA-seq Data Analysis
Seyed Abolfazl Motahari RNA-seq Data Analysis Basics Next Generation Sequencing Biological Samples Data Cost Data Volume Big Data Analysis in Biology تحلیل داده ها کنترل سیستمهای بیولوژیکی تشخیص بیماریها
More informationIntroduction to Galaxy
Introduction to Galaxy Dr Jason Wong Prince of Wales Clinical School Introductory bioinformatics for human genomics workshop, UNSW Day 1 Thurs 28 th January 2016 Overview What is Galaxy? Description of
More informationAligners. J Fass 23 August 2017
Aligners J Fass 23 August 2017 Definitions Assembly: I ve found the shredded remains of an important document; put it back together! UC Davis Genome Center Bioinformatics Core J Fass Aligners 2017-08-23
More informationpanda Documentation Release 1.0 Daniel Vera
panda Documentation Release 1.0 Daniel Vera February 12, 2014 Contents 1 mat.make 3 1.1 Usage and option summary....................................... 3 1.2 Arguments................................................
More informationHigh-throughout sequencing and using short-read aligners. Simon Anders
High-throughout sequencing and using short-read aligners Simon Anders High-throughput sequencing (HTS) Sequencing millions of short DNA fragments in parallel. a.k.a.: next-generation sequencing (NGS) massively-parallel
More informationCyverse tutorial 1 Logging in to Cyverse and data management. Open an Internet browser window and navigate to the Cyverse discovery environment:
Cyverse tutorial 1 Logging in to Cyverse and data management Open an Internet browser window and navigate to the Cyverse discovery environment: https://de.cyverse.org/de/ Click Log in with your CyVerse
More informationSPAR outputs and report page
SPAR outputs and report page Landing results page (full view) Landing results / outputs page (top) Input files are listed Job id is shown Download all tables, figures, tracks as zip Percentage of reads
More informationExpander 7.2 Online Documentation
Expander 7.2 Online Documentation Introduction... 2 Starting EXPANDER... 2 Input Data... 3 Tabular Data File... 4 CEL Files... 6 Working on similarity data no associated expression data... 9 Working on
More informationAdvanced RNA-Seq 1.5. User manual for. Windows, Mac OS X and Linux. November 2, 2016 This software is for research purposes only.
User manual for Advanced RNA-Seq 1.5 Windows, Mac OS X and Linux November 2, 2016 This software is for research purposes only. QIAGEN Aarhus Silkeborgvej 2 Prismet DK-8000 Aarhus C Denmark Contents 1 Introduction
More informationMapping NGS reads for genomics studies
Mapping NGS reads for genomics studies Valencia, 28-30 Sep 2015 BIER Alejandro Alemán aaleman@cipf.es Genomics Data Analysis CIBERER Where are we? Fastq Sequence preprocessing Fastq Alignment BAM Visualization
More informationITMO Ecole de Bioinformatique Hands-on session: smallrna-seq N. Servant 21 rd November 2013
ITMO Ecole de Bioinformatique Hands-on session: smallrna-seq N. Servant 21 rd November 2013 1. Data and objectives We will use the data from GEO (GSE35368, Toedling, Servant et al. 2011). Two samples were
More informationNature Methods: doi: /nmeth Supplementary Figure 1
Supplementary Figure 1 Schematic representation of the Workflow window in Perseus All data matrices uploaded in the running session of Perseus and all processing steps are displayed in the order of execution.
More informationSupplementary Figure 1. Fast read-mapping algorithm of BrowserGenome.
Supplementary Figure 1 Fast read-mapping algorithm of BrowserGenome. (a) Indexing strategy: The genome sequence of interest is divided into non-overlapping 12-mers. A Hook table is generated that contains
More informationChIP-seq (NGS) Data Formats
ChIP-seq (NGS) Data Formats Biological samples Sequence reads SRA/SRF, FASTQ Quality control SAM/BAM/Pileup?? Mapping Assembly... DE Analysis Variant Detection Peak Calling...? Counts, RPKM VCF BED/narrowPeak/
More informationAnalyzing ChIP- Seq Data in Galaxy
Analyzing ChIP- Seq Data in Galaxy Lauren Mills RISS ABSTRACT Step- by- step guide to basic ChIP- Seq analysis using the Galaxy platform. Table of Contents Introduction... 3 Links to helpful information...
More informationde.nbi and its Galaxy interface for RNA-Seq
de.nbi and its Galaxy interface for RNA-Seq Jörg Fallmann Thanks to Björn Grüning (RBC-Freiburg) and Sarah Diehl (MPI-Freiburg) Institute for Bioinformatics University of Leipzig http://www.bioinf.uni-leipzig.de/
More informationGenomic Analysis with Genome Browsers.
Genomic Analysis with Genome Browsers http://barc.wi.mit.edu/hot_topics/ 1 Outline Genome browsers overview UCSC Genome Browser Navigating: View your list of regions in the browser Available tracks (eg.
More informationKisSplice. Identifying and Quantifying SNPs, indels and Alternative Splicing Events from RNA-seq data. 29th may 2013
Identifying and Quantifying SNPs, indels and Alternative Splicing Events from RNA-seq data 29th may 2013 Next Generation Sequencing A sequencing experiment now produces millions of short reads ( 100 nt)
More informationIntegrated Genome browser (IGB) installation
Integrated Genome browser (IGB) installation Navigate to the IGB download page http://bioviz.org/igb/download.html You will see three icons for download: The three icons correspond to different memory
More informationTP RNA-seq : Differential expression analysis
TP RNA-seq : Differential expression analysis Overview of RNA-seq analysis Fusion transcripts detection Differential expresssion Gene level RNA-seq Transcript level Transcripts and isoforms detection 2
More informationBioinformatics in next generation sequencing projects
Bioinformatics in next generation sequencing projects Rickard Sandberg Assistant Professor Department of Cell and Molecular Biology Karolinska Institutet March 2011 Once sequenced the problem becomes computational
More informationIntroduction to Cancer Genomics
Introduction to Cancer Genomics Gene expression data analysis part I David Gfeller Computational Cancer Biology Ludwig Center for Cancer research david.gfeller@unil.ch 1 Overview 1. Basic understanding
More informationHigh-throughput sequencing: Alignment and related topic. Simon Anders EMBL Heidelberg
High-throughput sequencing: Alignment and related topic Simon Anders EMBL Heidelberg Established platforms HTS Platforms Illumina HiSeq, ABI SOLiD, Roche 454 Newcomers: Benchtop machines 454 GS Junior,
More informationSequence Preprocessing: A perspective
Sequence Preprocessing: A perspective Dr. Matthew L. Settles Genome Center University of California, Davis settles@ucdavis.edu Why Preprocess reads We have found that aggressively cleaning and processing
More informationsrap: Simplified RNA-Seq Analysis Pipeline
srap: Simplified RNA-Seq Analysis Pipeline Charles Warden October 30, 2017 1 Introduction This package provides a pipeline for gene expression analysis. The normalization function is specific for RNA-Seq
More informationRNA-Seq in Galaxy: Tuxedo protocol. Igor Makunin, UQ RCC, QCIF
RNA-Seq in Galaxy: Tuxedo protocol Igor Makunin, UQ RCC, QCIF Acknowledgments Genomics Virtual Lab: gvl.org.au Galaxy for tutorials: galaxy-tut.genome.edu.au Galaxy Australia: galaxy-aust.genome.edu.au
More informationRead Mapping. Slides by Carl Kingsford
Read Mapping Slides by Carl Kingsford Bowtie Ultrafast and memory-efficient alignment of short DNA sequences to the human genome Ben Langmead, Cole Trapnell, Mihai Pop and Steven L Salzberg, Genome Biology
More informationCirc-Seq User Guide. A comprehensive bioinformatics workflow for circular RNA detection from transcriptome sequencing data
Circ-Seq User Guide A comprehensive bioinformatics workflow for circular RNA detection from transcriptome sequencing data 02/03/2016 Table of Contents Introduction... 2 Local Installation to your system...
More informationHigh-throughput sequencing: Alignment and related topic. Simon Anders EMBL Heidelberg
High-throughput sequencing: Alignment and related topic Simon Anders EMBL Heidelberg Established platforms HTS Platforms Illumina HiSeq, ABI SOLiD, Roche 454 Newcomers: Benchtop machines: Illumina MiSeq,
More informationBrowser Exercises - I. Alignments and Comparative genomics
Browser Exercises - I Alignments and Comparative genomics 1. Navigating to the Genome Browser (GBrowse) Note: For this exercise use http://www.tritrypdb.org a. Navigate to the Genome Browser (GBrowse)
More informationepigenomegateway.wustl.edu
Everything can be found at epigenomegateway.wustl.edu REFERENCES 1. Zhou X, et al., Nature Methods 8, 989-990 (2011) 2. Zhou X & Wang T, Current Protocols in Bioinformatics Unit 10.10 (2012) 3. Zhou X,
More informationExercise 1 Review. --outfiltermismatchnmax : max number of mismatch (Default 10) --outreadsunmapped fastx: output unmapped reads
Exercise 1 Review Setting parameters STAR --quantmode GeneCounts --genomedir genomedb -- runthreadn 2 --outfiltermismatchnmax 2 --readfilesin WTa.fastq.gz --readfilescommand zcat --outfilenameprefix WTa
More informationAligning reads: tools and theory
Aligning reads: tools and theory Genome Sequence read :LM-Mel-14neg :LM-Mel-42neg :LM-Mel-14neg :LM-Mel-14pos :LM-Mel-42neg :LM-Mel-14neg :LM-Mel-42neg :LM-Mel-14neg chrx: 152139280 152139290 152139300
More informationPart 1: How to use IGV to visualize variants
Using IGV to identify true somatic variants from the false variants http://www.broadinstitute.org/igv A FAQ, sample files and a user guide are available on IGV website If you use IGV in your publication:
More informationPackage EventPointer
Type Package Package EventPointer September 5, 2018 Title An effective identification of alternative splicing events using junction arrays and RNA-Seq data Version 1.4.0 Author Juan Pablo Romero, Ander
More informationShort Read Alignment. Mapping Reads to a Reference
Short Read Alignment Mapping Reads to a Reference Brandi Cantarel, Ph.D. & Daehwan Kim, Ph.D. BICF 05/2018 Introduction to Mapping Short Read Aligners DNA vs RNA Alignment Quality Pitfalls and Improvements
More informationIdentiyfing splice junctions from RNA-Seq data
Identiyfing splice junctions from RNA-Seq data Joseph K. Pickrell pickrell@uchicago.edu October 4, 2010 Contents 1 Motivation 2 2 Identification of potential junction-spanning reads 2 3 Calling splice
More informationChIP-seq practical: peak detection and peak annotation. Mali Salmon-Divon Remco Loos Myrto Kostadima
ChIP-seq practical: peak detection and peak annotation Mali Salmon-Divon Remco Loos Myrto Kostadima March 2012 Introduction The goal of this hands-on session is to perform some basic tasks in the analysis
More informationRNA-Seq analysis with Astrocyte Differential expression and transcriptome assembly
RNA-Seq analysis with Astrocyte Differential expression and transcriptome assembly Beibei Chen Ph.D BICF 9/28/2016 Agenda Launch Workflows using Astrocyte BICF Workflows BICF RNA-seq Workflow Experimental
More informationRNA Sequencing with TopHat and Cufflinks
RNA Sequencing with TopHat and Cufflinks Introduction 3 Run TopHat App 4 TopHat App Output 5 Run Cufflinks 18 Cufflinks App Output 20 RNAseq Methods 27 Technical Assistance ILLUMINA PROPRIETARY 15050962
More informationYou will be re-directed to the following result page.
ENCODE Element Browser Goal: to navigate the candidate DNA elements predicted by the ENCODE consortium, including gene expression, DNase I hypersensitive sites, TF binding sites, and candidate enhancers/promoters.
More informationGenome 373: Mapping Short Sequence Reads III. Doug Fowler
Genome 373: Mapping Short Sequence Reads III Doug Fowler What is Galaxy? Galaxy is a free, open source web platform for running all sorts of computational analyses including pretty much all of the sequencing-related
More informationIntegra(ve Genomics Viewer IGV. Tom Carroll MRC Clinical Sciences Centre
Integra(ve Genomics Viewer IGV Tom Carroll MRC Clinical Sciences Centre Introduc(on to IGV. What is IGV. How to run IGV. Naviga(ng IGV. The IGV user interface. Moving around genomes. Loading and visualising
More informationCategorized software tools: (this page is being updated and links will be restored ASAP. Click on one of the menu links for more information)
Categorized software tools: (this page is being updated and links will be restored ASAP. Click on one of the menu links for more information) 1 / 5 For array design, fabrication and maintaining a database
More informationNGS FASTQ file format
NGS FASTQ file format Line1: Begins with @ and followed by a sequence idenefier and opeonal descripeon Line2: Raw sequence leiers Line3: + Line4: Encodes the quality values for the sequence in Line2 (see
More informationUsing Galaxy: RNA-seq
Using Galaxy: RNA-seq Stanford University September 23, 2014 Jennifer Hillman-Jackson Galaxy Team Penn State University http://galaxyproject.org/ The Agenda Introduction RNA-seq Example - Data Prep: QC
More informationExercise 2: Browser-Based Annotation and RNA-Seq Data
Exercise 2: Browser-Based Annotation and RNA-Seq Data Jeremy Buhler July 24, 2018 This exercise continues your introduction to practical issues in comparative annotation. You ll be annotating genomic sequence
More informationDavid Crossman, Ph.D. UAB Heflin Center for Genomic Science. GCC2012 Wednesday, July 25, 2012
David Crossman, Ph.D. UAB Heflin Center for Genomic Science GCC2012 Wednesday, July 25, 2012 Galaxy Splash Page Colors Random Galaxy icons/colors Queued Running Completed Download/Save Failed Icons Display
More informationgenbart package Vignette Jacob Cardenas, Jacob Turner, and Derek Blankenship
genbart package Vignette Jacob Cardenas, Jacob Turner, and Derek Blankenship 2018-03-13 BART (Biostatistical Analysis Reporting Tool) is a user friendly, point and click, R shiny application. With the
More informationLong Read RNA-seq Mapper
UNIVERSITY OF ZAGREB FACULTY OF ELECTRICAL ENGENEERING AND COMPUTING MASTER THESIS no. 1005 Long Read RNA-seq Mapper Josip Marić Zagreb, February 2015. Table of Contents 1. Introduction... 1 2. RNA Sequencing...
More informationRNA- SeQC Documentation
RNA- SeQC Documentation Description: Author: Calculates metrics on aligned RNA-seq data. David S. DeLuca (Broad Institute), gp-help@broadinstitute.org Summary This module calculates standard RNA-seq related
More informationJunctionSeq Package User Manual
JunctionSeq Package User Manual Stephen Hartley National Human Genome Research Institute National Institutes of Health March 30, 2017 JunctionSeq v1.5.4 Contents 1 Overview 2 2 Requirements 3 2.1 Alignment.........................................
More informationExpander Online Documentation
Expander Online Documentation Table of Contents Introduction...1 Starting EXPANDER...2 Input Data...4 Preprocessing GE Data...8 Viewing Data Plots...12 Clustering GE Data...14 Biclustering GE Data...17
More informationScalable RNA Sequencing on Clusters of Multicore Processors
JOAQUÍN DOPAZO JOAQUÍN TARRAGA SERGIO BARRACHINA MARÍA ISABEL CASTILLO HÉCTOR MARTÍNEZ ENRIQUE S. QUINTANA ORTÍ IGNACIO MEDINA INTRODUCTION DNA Exon 0 Exon 1 Exon 2 Intron 0 Intron 1 Reads Sequencing RNA
More informationEasy visualization of the read coverage using the CoverageView package
Easy visualization of the read coverage using the CoverageView package Ernesto Lowy European Bioinformatics Institute EMBL June 13, 2018 > options(width=40) > library(coverageview) 1 Introduction This
More informationGenomic Files. University of Massachusetts Medical School. October, 2014
.. Genomic Files University of Massachusetts Medical School October, 2014 2 / 39. A Typical Deep-Sequencing Workflow Samples Fastq Files Fastq Files Sam / Bam Files Various files Deep Sequencing Further
More informationWorkshop 6: DNA Methylation Analysis using Bisulfite Sequencing. Fides D Lay UCLA QCB Fellow
Workshop 6: DNA Methylation Analysis using Bisulfite Sequencing Fides D Lay UCLA QCB Fellow lay.fides@gmail.com Workshop 6 Outline Day 1: Introduction to DNA methylation & WGBS Quick review of linux, Hoffman2
More informationEvaluate NimbleGen SeqCap RNA Target Enrichment Data
Roche Sequencing Technical Note November 2014 How To Evaluate NimbleGen SeqCap RNA Target Enrichment Data 1. OVERVIEW Analysis of NimbleGen SeqCap RNA target enrichment data generated using an Illumina
More informationExercises: Analysing RNA-Seq data
Exercises: Analysing RNA-Seq data Version 2018-03 Exercises: Analysing RNA-Seq data 2 Licence This manual is 2011-18, Simon Andrews, Laura Biggins. This manual is distributed under the creative commons
More informationProtocol: peak-calling for ChIP-seq data / segmentation analysis for histone modification data
Protocol: peak-calling for ChIP-seq data / segmentation analysis for histone modification data Table of Contents Protocol: peak-calling for ChIP-seq data / segmentation analysis for histone modification
More informationTECH NOTE Improving the Sensitivity of Ultra Low Input mrna Seq
TECH NOTE Improving the Sensitivity of Ultra Low Input mrna Seq SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Powered by SMART and LNA technologies: Locked nucleic acid technology significantly improves
More informationHelpful Galaxy screencasts are available at:
This user guide serves as a simplified, graphic version of the CloudMap paper for applicationoriented end-users. For more details, please see the CloudMap paper. Video versions of these user guides and
More informationJunctionSeq Package User Manual
JunctionSeq Package User Manual Stephen Hartley National Human Genome Research Institute National Institutes of Health February 16, 2016 JunctionSeq v1.1.3 Contents 1 Overview 2 2 Requirements 3 2.1 Alignment.........................................
More informationUseful software utilities for computational genomics. Shamith Samarajiwa CRUK Autumn School in Bioinformatics September 2017
Useful software utilities for computational genomics Shamith Samarajiwa CRUK Autumn School in Bioinformatics September 2017 Overview Search and download genomic datasets: GEOquery, GEOsearch and GEOmetadb,
More informationExpression Analysis with the Advanced RNA-Seq Plugin
Expression Analysis with the Advanced RNA-Seq Plugin May 24, 2016 Sample to Insight CLC bio, a QIAGEN Company Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 www.clcbio.com support-clcbio@qiagen.com
More informationGalaxy. Daniel Blankenberg The Galaxy Team
Galaxy Daniel Blankenberg The Galaxy Team http://galaxyproject.org Overview What is Galaxy? What you can do in Galaxy analysis interface, tools and datasources data libraries workflows visualization sharing
More information