Our typical RNA quantification pipeline

Size: px
Start display at page:

Download "Our typical RNA quantification pipeline"

Transcription

1 RNA-Seq primer

2 Our typical RNA quantification pipeline Upload your sequence data (fastq) Align to the ribosome (Bow>e) Align remaining reads to genome (TopHat) or transcriptome (RSEM) Make report of quality metrics Output ribosomal contamina>on metrics report Produce RNA- Seq report % aligned, % intergenic, % exonic, % UTR Produce IGV/UCSC friendly files Quan>fy transcriptome Call differen>ally expressed genes (if mul>ple samples) Produce a table with normalized expression values Report pairwise significant genes that are differen>ally expressed

3 Initial analysis

4 Summary I Data types, file formats and utilities Annotation: Genomic regions Genes Peaks Bedtools to manipulate them Alignment: Map reads BAM/SAM Samtools to manipulate them Aggregation: Summary files Wig (UCSC) TDF (IGV)

5 Summary II Data process Short read alignment (Bowtie, BWA) Making the genome searchable: Hashing/BW Seed an extend (hashing) vs suffix searches (BW) New aligners are mix Spliced aligners (TopHat, STAR, GSNAP) Map read fragments then strung them Choosing the fragment size Avoiding biases using information (junctions) Quantifying (RSEM/Cufflinks) Read/Isoform assignment Normalization procedures Differential expression (DESeq/EdgeR/Cufflinks)

6 Visualization tricks & Tips Viewing normalized data Downsampling reads to avoid crashes Gene lists Sessions

7 IGV: Integrative Genomics Viewer A desktop applica>on for the visualization and interac>ve explora>on of genomic data Microarrays Epigenomics RNA- Seq NGS alignments Compara:ve genomics

8 Visualizing read alignments with IGV RNASeq

9 Visualizing read alignments with IGV zooming out RNA Seq t K4me3 ChIP Seq PolII ChIPSeq t Cebeb ChIP Seq

10 Viewing several loci simulateneouly: Gene lists

11 Viewing several loci simultaneously: Gene lists

12 Lets create a list using our small dataset Use the following genes Fgf21 Bcat2 Rasip1 Naa60 Which are all within the dataset we selected.

13 Normalizing tracks You can use simple read depth normaliza>on for comparison of different tracks

14 Configure your alignment display Downsampling reads is cri>cal when loading the full alignments. When you are loading reads, downsampling ensures that regions with high coverage result in IGV running out of memory.

15 Saving sessions Sessions allows you to store a set of desired tracks along with any seyng you want

16 Todays topics Looking at ALL of your data

17 Comparing samples: Scatter plots Scatter plot RPKM Sample 2 RPKM Sample 1 RPKM

18 Raw counts/rpkms are NOT Gaussian Density distribution RPKM Density RPKM

19 ... they are more like Log-Gaussian Density distribution log RPKM Density LOG RPKM

20 And log counts/rpkm can be scatter-plotted Control 1e+05 1e+03 1e+01 1e+01 1e+03 Treat 1e+05

21 Which can also be looked at as an MA-Plot Log2 Fold Change (M) Log2 mean normalized counts (A) 30 40

22 Hierarchical clustering vector similarity? Gene Cond1 Cond2 Cond3 Cond4 g g g g Clustering is about similarity: Between two rows (specified by a distance func>on) Between two sets of rows (specified by the linkage method)

23 Common similarity approaches Distance between rows (or columns) Correlation: d(r,s) = (1- cor(r,s))/2 Euclidean: d(r,s) = sqrt(σ i (r i s i ) 2 ) Linkage: Distance betwee two sets (d(r,s)) Complete: Average: Single: G max {d(r, s),s2 S, r 2 R} { 2 2 } mean {d(r,{ s),s22 S, r 2 R} } min {d(r, s),s2 2 S, r 2 R} } Gene Cond1 Cond2 Cond3 Cond4 g g g g

24 The effect of the linkage method Complete linkage correlation Single linkage correlation g1 g2 g1 g2 Height g3 g4 Height g3 g4 Gene Cond1 Cond2 Cond3 Cond4 g g g g

25 Effect of the distance! Complete linkage correlation Complete linkage euclidean g1 g2 g1 g4 Height g3 g4 Height g2 g3 Gene Cond1 Cond2 Cond3 Cond4 g g g g

26 Playing with clustering #Define the toy matrix# ####################### m = rbind (c(2.5,5,7.5,10), c(0.2,0.5,0.8,1.1), c(0.2,0.3,0.4,11), c(2.5,8,8,9)) #Give column and row names# ########################### rownames(m) = c("g1","g2","g3","g4"); colnames(m) = c("c1","c2","c3","c4"); #Compute the correlation distance matrix# ######################################### submat.dist = as.dist( (1 - cor(t(m)) ) /2 ); #Plot clustering with the three main methods# ############################################# plot( hclust(submat.dist, method="complete",members=null), main="complete linkeage - correlation", sub="", xlab="", lwd=3); plot( hclust(submat.dist, method="average",members=null), main = "Average Linkeage - correlation", sub="", xlab="", lwd=3); plot( hclust(submat.dist, method="single",members=null), main = "Single Linkeage- correlation", sub="", xlab="", lwd=3); #Plot clustering with the three main methods, using the euclidean distance# ########################################################################### plot( hclust(dist(m), method="complete",members=null), main="complete linkeage - euclidean", sub="", xlab="", lwd=3); plot( hclust(dist(m), method="average",members=null), main = "Average Linkeage - euclidean", sub="", xlab="", lwd=3); plot( hclust(dist(m), method="single",members=null), main = "Single Linkeage - euclidean", sub="", xlab="", lwd=3);

Integrative Genomics Viewer. Prat Thiru

Integrative Genomics Viewer. Prat Thiru Integrative Genomics Viewer Prat Thiru 1 Overview User Interface Basics Browsing the Data Data Formats IGV Tools Demo Outline Based on ISMB 2010 Tutorial by Robinson and Thorvaldsdottir 2 Why IGV? IGV

More information

NGS Data Visualization and Exploration Using IGV

NGS Data Visualization and Exploration Using IGV 1 What is Galaxy Galaxy for Bioinformaticians Galaxy for Experimental Biologists Using Galaxy for NGS Analysis NGS Data Visualization and Exploration Using IGV 2 What is Galaxy Galaxy for Bioinformaticians

More information

Sequence Analysis Pipeline

Sequence Analysis Pipeline Sequence Analysis Pipeline Transcript fragments 1. PREPROCESSING 2. ASSEMBLY (today) Removal of contaminants, vector, adaptors, etc Put overlapping sequence together and calculate bigger sequences 3. Analysis/Annotation

More information

RNA-seq. Manpreet S. Katari

RNA-seq. Manpreet S. Katari RNA-seq Manpreet S. Katari Evolution of Sequence Technology Normalizing the Data RPKM (Reads per Kilobase of exons per million reads) Score = R NT R = # of unique reads for the gene N = Size of the gene

More information

NGS Analysis Using Galaxy

NGS Analysis Using Galaxy NGS Analysis Using Galaxy Sequences and Alignment Format Galaxy overview and Interface Get;ng Data in Galaxy Analyzing Data in Galaxy Quality Control Mapping Data History and workflow Galaxy Exercises

More information

Dr. Gabriela Salinas Dr. Orr Shomroni Kaamini Rhaithata

Dr. Gabriela Salinas Dr. Orr Shomroni Kaamini Rhaithata Analysis of RNA sequencing data sets using the Galaxy environment Dr. Gabriela Salinas Dr. Orr Shomroni Kaamini Rhaithata Microarray and Deep-sequencing core facility 30.10.2017 RNA-seq workflow I Hypothesis

More information

Galaxy Platform For NGS Data Analyses

Galaxy Platform For NGS Data Analyses Galaxy Platform For NGS Data Analyses Weihong Yan wyan@chem.ucla.edu Collaboratory Web Site http://qcb.ucla.edu/collaboratory Collaboratory Workshops Workshop Outline ü Day 1 UCLA galaxy and user account

More information

Maize genome sequence in FASTA format. Gene annotation file in gff format

Maize genome sequence in FASTA format. Gene annotation file in gff format Exercise 1. Using Tophat/Cufflinks to analyze RNAseq data. Step 1. One of CBSU BioHPC Lab workstations has been allocated for your workshop exercise. The allocations are listed on the workshop exercise

More information

RNA-Seq Analysis With the Tuxedo Suite

RNA-Seq Analysis With the Tuxedo Suite June 2016 RNA-Seq Analysis With the Tuxedo Suite Dena Leshkowitz Introduction In this exercise we will learn how to analyse RNA-Seq data using the Tuxedo Suite tools: Tophat, Cuffmerge, Cufflinks and Cuffdiff.

More information

Aligners. J Fass 21 June 2017

Aligners. J Fass 21 June 2017 Aligners J Fass 21 June 2017 Definitions Assembly: I ve found the shredded remains of an important document; put it back together! UC Davis Genome Center Bioinformatics Core J Fass Aligners 2017-06-21

More information

Data Processing and Analysis in Systems Medicine. Milena Kraus Data Management for Digital Health Summer 2017

Data Processing and Analysis in Systems Medicine. Milena Kraus Data Management for Digital Health Summer 2017 Milena Kraus Digital Health Summer Agenda Real-world Use Cases Oncology Nephrology Heart Insufficiency Additional Topics Data Management & Foundations Biology Recap Data Sources Data Formats Business Processes

More information

BGGN-213: FOUNDATIONS OF BIOINFORMATICS (Lecture 14)

BGGN-213: FOUNDATIONS OF BIOINFORMATICS (Lecture 14) BGGN-213: FOUNDATIONS OF BIOINFORMATICS (Lecture 14) Genome Informatics (Part 1) https://bioboot.github.io/bggn213_f17/lectures/#14 Dr. Barry Grant Nov 2017 Overview: The purpose of this lab session is

More information

Differential gene expression analysis using RNA-seq

Differential gene expression analysis using RNA-seq https://abc.med.cornell.edu/ Differential gene expression analysis using RNA-seq Applied Bioinformatics Core, September/October 2018 Friederike Dündar with Luce Skrabanek & Paul Zumbo Day 3: Counting reads

More information

Tutorial: RNA-Seq Analysis Part II (Tracks): Non-Specific Matches, Mapping Modes and Expression measures

Tutorial: RNA-Seq Analysis Part II (Tracks): Non-Specific Matches, Mapping Modes and Expression measures : RNA-Seq Analysis Part II (Tracks): Non-Specific Matches, Mapping Modes and February 24, 2014 Sample to Insight : RNA-Seq Analysis Part II (Tracks): Non-Specific Matches, Mapping Modes and : RNA-Seq Analysis

More information

ChIP-seq hands-on practical using Galaxy

ChIP-seq hands-on practical using Galaxy ChIP-seq hands-on practical using Galaxy In this exercise we will cover some of the basic NGS analysis steps for ChIP-seq using the Galaxy framework: Quality control Mapping of reads using Bowtie2 Peak-calling

More information

How to store and visualize RNA-seq data

How to store and visualize RNA-seq data How to store and visualize RNA-seq data Gabriella Rustici Functional Genomics Group gabry@ebi.ac.uk EBI is an Outstation of the European Molecular Biology Laboratory. Talk summary How do we archive RNA-seq

More information

Services Performed. The following checklist confirms the steps of the RNA-Seq Service that were performed on your samples.

Services Performed. The following checklist confirms the steps of the RNA-Seq Service that were performed on your samples. Services Performed The following checklist confirms the steps of the RNA-Seq Service that were performed on your samples. SERVICE Sample Received Sample Quality Evaluated Sample Prepared for Sequencing

More information

CLC Server. End User USER MANUAL

CLC Server. End User USER MANUAL CLC Server End User USER MANUAL Manual for CLC Server 10.0.1 Windows, macos and Linux March 8, 2018 This software is for research purposes only. QIAGEN Aarhus Silkeborgvej 2 Prismet DK-8000 Aarhus C Denmark

More information

Analysis of ChIP-seq data

Analysis of ChIP-seq data Before we start: 1. Log into tak (step 0 on the exercises) 2. Go to your lab space and create a folder for the class (see separate hand out) 3. Connect to your lab space through the wihtdata network and

More information

Colorado State University Bioinformatics Algorithms Assignment 6: Analysis of High- Throughput Biological Data Hamidreza Chitsaz, Ali Sharifi- Zarchi

Colorado State University Bioinformatics Algorithms Assignment 6: Analysis of High- Throughput Biological Data Hamidreza Chitsaz, Ali Sharifi- Zarchi Colorado State University Bioinformatics Algorithms Assignment 6: Analysis of High- Throughput Biological Data Hamidreza Chitsaz, Ali Sharifi- Zarchi Although a little- bit long, this is an easy exercise

More information

Data: ftp://ftp.broad.mit.edu/pub/users/bhaas/rnaseq_workshop/rnaseq_workshop_dat a.tgz. Software:

Data: ftp://ftp.broad.mit.edu/pub/users/bhaas/rnaseq_workshop/rnaseq_workshop_dat a.tgz. Software: A Tutorial: De novo RNA- Seq Assembly and Analysis Using Trinity and edger The following data and software resources are required for following the tutorial: Data: ftp://ftp.broad.mit.edu/pub/users/bhaas/rnaseq_workshop/rnaseq_workshop_dat

More information

Ensembl RNASeq Practical. Overview

Ensembl RNASeq Practical. Overview Ensembl RNASeq Practical The aim of this practical session is to use BWA to align 2 lanes of Zebrafish paired end Illumina RNASeq reads to chromosome 12 of the zebrafish ZV9 assembly. We have restricted

More information

Short Read Sequencing Analysis Workshop

Short Read Sequencing Analysis Workshop Short Read Sequencing Analysis Workshop Day 8: Introduc/on to RNA-seq Analysis In-class slides Day 7 Homework 1.) 14 GABPA ChIP-seq peaks 2.) Error: Dataset too large (> 100000). Rerun with larger maxsize

More information

Galaxy workshop at the Winter School Igor Makunin

Galaxy workshop at the Winter School Igor Makunin Galaxy workshop at the Winter School 2016 Igor Makunin i.makunin@uq.edu.au Winter school, UQ, July 6, 2016 Plan Overview of the Genomics Virtual Lab Introduce Galaxy, a web based platform for analysis

More information

Gene Expression Data Analysis. Qin Ma, Ph.D. December 10, 2017

Gene Expression Data Analysis. Qin Ma, Ph.D. December 10, 2017 1 Gene Expression Data Analysis Qin Ma, Ph.D. December 10, 2017 2 Bioinformatics Systems biology This interdisciplinary science is about providing computational support to studies on linking the behavior

More information

11/8/2017 Trinity De novo Transcriptome Assembly Workshop trinityrnaseq/rnaseq_trinity_tuxedo_workshop Wiki GitHub

11/8/2017 Trinity De novo Transcriptome Assembly Workshop trinityrnaseq/rnaseq_trinity_tuxedo_workshop Wiki GitHub trinityrnaseq / RNASeq_Trinity_Tuxedo_Workshop Trinity De novo Transcriptome Assembly Workshop Brian Haas edited this page on Oct 17, 2015 14 revisions De novo RNA-Seq Assembly and Analysis Using Trinity

More information

Differential Expression Analysis at PATRIC

Differential Expression Analysis at PATRIC Differential Expression Analysis at PATRIC The following step- by- step workflow is intended to help users learn how to upload their differential gene expression data to their private workspace using Expression

More information

Single/paired-end RNAseq analysis with Galaxy

Single/paired-end RNAseq analysis with Galaxy October 016 Single/paired-end RNAseq analysis with Galaxy Contents: 1. Introduction. Quality control 3. Alignment 4. Normalization and read counts 5. Workflow overview 6. Sample data set to test the paired-end

More information

Goal: Learn how to use various tool to extract information from RNAseq reads. 4.1 Mapping RNAseq Reads to a Genome Assembly

Goal: Learn how to use various tool to extract information from RNAseq reads. 4.1 Mapping RNAseq Reads to a Genome Assembly ESSENTIALS OF NEXT GENERATION SEQUENCING WORKSHOP 2014 UNIVERSITY OF KENTUCKY AGTC Class 4 RNAseq Goal: Learn how to use various tool to extract information from RNAseq reads. Input(s): magnaporthe_oryzae_70-15_8_supercontigs.fasta

More information

ChIP-seq hands-on practical using Galaxy

ChIP-seq hands-on practical using Galaxy ChIP-seq hands-on practical using Galaxy In this exercise we will cover some of the basic NGS analysis steps for ChIP-seq using the Galaxy framework: Quality control Mapping of reads using Bowtie2 Peak-calling

More information

!"#$%&$'()#$*)+,-./).01"0#,23+3,303456"6,&((46,7$+-./&((468,

!#$%&$'()#$*)+,-./).010#,23+3,3034566,&((46,7$+-./&((468, !"#$%&$'()#$*)+,-./).01"0#,23+3,303456"6,&((46,7$+-./&((468, 9"(1(02)1+(',:.;.4(*.',?9@A,!."2.4B.'#A,C(;.

More information

mrna-seq Basic processing Read mapping (shown here, but optional. May due if time allows) Gene expression estimation

mrna-seq Basic processing Read mapping (shown here, but optional. May due if time allows) Gene expression estimation mrna-seq Basic processing Read mapping (shown here, but optional. May due if time allows) Tophat Gene expression estimation cufflinks Confidence intervals Gene expression changes (separate use case) Sample

More information

Our data for today is a small subset of Saimaa ringed seal RNA sequencing data (RNA_seq_reads.fasta). Let s first see how many reads are there:

Our data for today is a small subset of Saimaa ringed seal RNA sequencing data (RNA_seq_reads.fasta). Let s first see how many reads are there: Practical Course in Genome Bioinformatics 19.2.2016 (CORRECTED 22.2.2016) Exercises - Day 5 http://ekhidna.biocenter.helsinki.fi/downloads/teaching/spring2016/ Answer the 5 questions (Q1-Q5) according

More information

Introduction to Read Alignment. UCD Genome Center Bioinformatics Core Tuesday 15 September 2015

Introduction to Read Alignment. UCD Genome Center Bioinformatics Core Tuesday 15 September 2015 Introduction to Read Alignment UCD Genome Center Bioinformatics Core Tuesday 15 September 2015 From reads to molecules Why align? Individual A Individual B ATGATAGCATCGTCGGGTGTCTGCTCAATAATAGTGCCGTATCATGCTGGTGTTATAATCGCCGCATGACATGATCAATGG

More information

RNA-seq Data Analysis

RNA-seq Data Analysis Seyed Abolfazl Motahari RNA-seq Data Analysis Basics Next Generation Sequencing Biological Samples Data Cost Data Volume Big Data Analysis in Biology تحلیل داده ها کنترل سیستمهای بیولوژیکی تشخیص بیماریها

More information

Introduction to Galaxy

Introduction to Galaxy Introduction to Galaxy Dr Jason Wong Prince of Wales Clinical School Introductory bioinformatics for human genomics workshop, UNSW Day 1 Thurs 28 th January 2016 Overview What is Galaxy? Description of

More information

Aligners. J Fass 23 August 2017

Aligners. J Fass 23 August 2017 Aligners J Fass 23 August 2017 Definitions Assembly: I ve found the shredded remains of an important document; put it back together! UC Davis Genome Center Bioinformatics Core J Fass Aligners 2017-08-23

More information

panda Documentation Release 1.0 Daniel Vera

panda Documentation Release 1.0 Daniel Vera panda Documentation Release 1.0 Daniel Vera February 12, 2014 Contents 1 mat.make 3 1.1 Usage and option summary....................................... 3 1.2 Arguments................................................

More information

High-throughout sequencing and using short-read aligners. Simon Anders

High-throughout sequencing and using short-read aligners. Simon Anders High-throughout sequencing and using short-read aligners Simon Anders High-throughput sequencing (HTS) Sequencing millions of short DNA fragments in parallel. a.k.a.: next-generation sequencing (NGS) massively-parallel

More information

Cyverse tutorial 1 Logging in to Cyverse and data management. Open an Internet browser window and navigate to the Cyverse discovery environment:

Cyverse tutorial 1 Logging in to Cyverse and data management. Open an Internet browser window and navigate to the Cyverse discovery environment: Cyverse tutorial 1 Logging in to Cyverse and data management Open an Internet browser window and navigate to the Cyverse discovery environment: https://de.cyverse.org/de/ Click Log in with your CyVerse

More information

SPAR outputs and report page

SPAR outputs and report page SPAR outputs and report page Landing results page (full view) Landing results / outputs page (top) Input files are listed Job id is shown Download all tables, figures, tracks as zip Percentage of reads

More information

Expander 7.2 Online Documentation

Expander 7.2 Online Documentation Expander 7.2 Online Documentation Introduction... 2 Starting EXPANDER... 2 Input Data... 3 Tabular Data File... 4 CEL Files... 6 Working on similarity data no associated expression data... 9 Working on

More information

Advanced RNA-Seq 1.5. User manual for. Windows, Mac OS X and Linux. November 2, 2016 This software is for research purposes only.

Advanced RNA-Seq 1.5. User manual for. Windows, Mac OS X and Linux. November 2, 2016 This software is for research purposes only. User manual for Advanced RNA-Seq 1.5 Windows, Mac OS X and Linux November 2, 2016 This software is for research purposes only. QIAGEN Aarhus Silkeborgvej 2 Prismet DK-8000 Aarhus C Denmark Contents 1 Introduction

More information

Mapping NGS reads for genomics studies

Mapping NGS reads for genomics studies Mapping NGS reads for genomics studies Valencia, 28-30 Sep 2015 BIER Alejandro Alemán aaleman@cipf.es Genomics Data Analysis CIBERER Where are we? Fastq Sequence preprocessing Fastq Alignment BAM Visualization

More information

ITMO Ecole de Bioinformatique Hands-on session: smallrna-seq N. Servant 21 rd November 2013

ITMO Ecole de Bioinformatique Hands-on session: smallrna-seq N. Servant 21 rd November 2013 ITMO Ecole de Bioinformatique Hands-on session: smallrna-seq N. Servant 21 rd November 2013 1. Data and objectives We will use the data from GEO (GSE35368, Toedling, Servant et al. 2011). Two samples were

More information

Nature Methods: doi: /nmeth Supplementary Figure 1

Nature Methods: doi: /nmeth Supplementary Figure 1 Supplementary Figure 1 Schematic representation of the Workflow window in Perseus All data matrices uploaded in the running session of Perseus and all processing steps are displayed in the order of execution.

More information

Supplementary Figure 1. Fast read-mapping algorithm of BrowserGenome.

Supplementary Figure 1. Fast read-mapping algorithm of BrowserGenome. Supplementary Figure 1 Fast read-mapping algorithm of BrowserGenome. (a) Indexing strategy: The genome sequence of interest is divided into non-overlapping 12-mers. A Hook table is generated that contains

More information

ChIP-seq (NGS) Data Formats

ChIP-seq (NGS) Data Formats ChIP-seq (NGS) Data Formats Biological samples Sequence reads SRA/SRF, FASTQ Quality control SAM/BAM/Pileup?? Mapping Assembly... DE Analysis Variant Detection Peak Calling...? Counts, RPKM VCF BED/narrowPeak/

More information

Analyzing ChIP- Seq Data in Galaxy

Analyzing ChIP- Seq Data in Galaxy Analyzing ChIP- Seq Data in Galaxy Lauren Mills RISS ABSTRACT Step- by- step guide to basic ChIP- Seq analysis using the Galaxy platform. Table of Contents Introduction... 3 Links to helpful information...

More information

de.nbi and its Galaxy interface for RNA-Seq

de.nbi and its Galaxy interface for RNA-Seq de.nbi and its Galaxy interface for RNA-Seq Jörg Fallmann Thanks to Björn Grüning (RBC-Freiburg) and Sarah Diehl (MPI-Freiburg) Institute for Bioinformatics University of Leipzig http://www.bioinf.uni-leipzig.de/

More information

Genomic Analysis with Genome Browsers.

Genomic Analysis with Genome Browsers. Genomic Analysis with Genome Browsers http://barc.wi.mit.edu/hot_topics/ 1 Outline Genome browsers overview UCSC Genome Browser Navigating: View your list of regions in the browser Available tracks (eg.

More information

KisSplice. Identifying and Quantifying SNPs, indels and Alternative Splicing Events from RNA-seq data. 29th may 2013

KisSplice. Identifying and Quantifying SNPs, indels and Alternative Splicing Events from RNA-seq data. 29th may 2013 Identifying and Quantifying SNPs, indels and Alternative Splicing Events from RNA-seq data 29th may 2013 Next Generation Sequencing A sequencing experiment now produces millions of short reads ( 100 nt)

More information

Integrated Genome browser (IGB) installation

Integrated Genome browser (IGB) installation Integrated Genome browser (IGB) installation Navigate to the IGB download page http://bioviz.org/igb/download.html You will see three icons for download: The three icons correspond to different memory

More information

TP RNA-seq : Differential expression analysis

TP RNA-seq : Differential expression analysis TP RNA-seq : Differential expression analysis Overview of RNA-seq analysis Fusion transcripts detection Differential expresssion Gene level RNA-seq Transcript level Transcripts and isoforms detection 2

More information

Bioinformatics in next generation sequencing projects

Bioinformatics in next generation sequencing projects Bioinformatics in next generation sequencing projects Rickard Sandberg Assistant Professor Department of Cell and Molecular Biology Karolinska Institutet March 2011 Once sequenced the problem becomes computational

More information

Introduction to Cancer Genomics

Introduction to Cancer Genomics Introduction to Cancer Genomics Gene expression data analysis part I David Gfeller Computational Cancer Biology Ludwig Center for Cancer research david.gfeller@unil.ch 1 Overview 1. Basic understanding

More information

High-throughput sequencing: Alignment and related topic. Simon Anders EMBL Heidelberg

High-throughput sequencing: Alignment and related topic. Simon Anders EMBL Heidelberg High-throughput sequencing: Alignment and related topic Simon Anders EMBL Heidelberg Established platforms HTS Platforms Illumina HiSeq, ABI SOLiD, Roche 454 Newcomers: Benchtop machines 454 GS Junior,

More information

Sequence Preprocessing: A perspective

Sequence Preprocessing: A perspective Sequence Preprocessing: A perspective Dr. Matthew L. Settles Genome Center University of California, Davis settles@ucdavis.edu Why Preprocess reads We have found that aggressively cleaning and processing

More information

srap: Simplified RNA-Seq Analysis Pipeline

srap: Simplified RNA-Seq Analysis Pipeline srap: Simplified RNA-Seq Analysis Pipeline Charles Warden October 30, 2017 1 Introduction This package provides a pipeline for gene expression analysis. The normalization function is specific for RNA-Seq

More information

RNA-Seq in Galaxy: Tuxedo protocol. Igor Makunin, UQ RCC, QCIF

RNA-Seq in Galaxy: Tuxedo protocol. Igor Makunin, UQ RCC, QCIF RNA-Seq in Galaxy: Tuxedo protocol Igor Makunin, UQ RCC, QCIF Acknowledgments Genomics Virtual Lab: gvl.org.au Galaxy for tutorials: galaxy-tut.genome.edu.au Galaxy Australia: galaxy-aust.genome.edu.au

More information

Read Mapping. Slides by Carl Kingsford

Read Mapping. Slides by Carl Kingsford Read Mapping Slides by Carl Kingsford Bowtie Ultrafast and memory-efficient alignment of short DNA sequences to the human genome Ben Langmead, Cole Trapnell, Mihai Pop and Steven L Salzberg, Genome Biology

More information

Circ-Seq User Guide. A comprehensive bioinformatics workflow for circular RNA detection from transcriptome sequencing data

Circ-Seq User Guide. A comprehensive bioinformatics workflow for circular RNA detection from transcriptome sequencing data Circ-Seq User Guide A comprehensive bioinformatics workflow for circular RNA detection from transcriptome sequencing data 02/03/2016 Table of Contents Introduction... 2 Local Installation to your system...

More information

High-throughput sequencing: Alignment and related topic. Simon Anders EMBL Heidelberg

High-throughput sequencing: Alignment and related topic. Simon Anders EMBL Heidelberg High-throughput sequencing: Alignment and related topic Simon Anders EMBL Heidelberg Established platforms HTS Platforms Illumina HiSeq, ABI SOLiD, Roche 454 Newcomers: Benchtop machines: Illumina MiSeq,

More information

Browser Exercises - I. Alignments and Comparative genomics

Browser Exercises - I. Alignments and Comparative genomics Browser Exercises - I Alignments and Comparative genomics 1. Navigating to the Genome Browser (GBrowse) Note: For this exercise use http://www.tritrypdb.org a. Navigate to the Genome Browser (GBrowse)

More information

epigenomegateway.wustl.edu

epigenomegateway.wustl.edu Everything can be found at epigenomegateway.wustl.edu REFERENCES 1. Zhou X, et al., Nature Methods 8, 989-990 (2011) 2. Zhou X & Wang T, Current Protocols in Bioinformatics Unit 10.10 (2012) 3. Zhou X,

More information

Exercise 1 Review. --outfiltermismatchnmax : max number of mismatch (Default 10) --outreadsunmapped fastx: output unmapped reads

Exercise 1 Review. --outfiltermismatchnmax : max number of mismatch (Default 10) --outreadsunmapped fastx: output unmapped reads Exercise 1 Review Setting parameters STAR --quantmode GeneCounts --genomedir genomedb -- runthreadn 2 --outfiltermismatchnmax 2 --readfilesin WTa.fastq.gz --readfilescommand zcat --outfilenameprefix WTa

More information

Aligning reads: tools and theory

Aligning reads: tools and theory Aligning reads: tools and theory Genome Sequence read :LM-Mel-14neg :LM-Mel-42neg :LM-Mel-14neg :LM-Mel-14pos :LM-Mel-42neg :LM-Mel-14neg :LM-Mel-42neg :LM-Mel-14neg chrx: 152139280 152139290 152139300

More information

Part 1: How to use IGV to visualize variants

Part 1: How to use IGV to visualize variants Using IGV to identify true somatic variants from the false variants http://www.broadinstitute.org/igv A FAQ, sample files and a user guide are available on IGV website If you use IGV in your publication:

More information

Package EventPointer

Package EventPointer Type Package Package EventPointer September 5, 2018 Title An effective identification of alternative splicing events using junction arrays and RNA-Seq data Version 1.4.0 Author Juan Pablo Romero, Ander

More information

Short Read Alignment. Mapping Reads to a Reference

Short Read Alignment. Mapping Reads to a Reference Short Read Alignment Mapping Reads to a Reference Brandi Cantarel, Ph.D. & Daehwan Kim, Ph.D. BICF 05/2018 Introduction to Mapping Short Read Aligners DNA vs RNA Alignment Quality Pitfalls and Improvements

More information

Identiyfing splice junctions from RNA-Seq data

Identiyfing splice junctions from RNA-Seq data Identiyfing splice junctions from RNA-Seq data Joseph K. Pickrell pickrell@uchicago.edu October 4, 2010 Contents 1 Motivation 2 2 Identification of potential junction-spanning reads 2 3 Calling splice

More information

ChIP-seq practical: peak detection and peak annotation. Mali Salmon-Divon Remco Loos Myrto Kostadima

ChIP-seq practical: peak detection and peak annotation. Mali Salmon-Divon Remco Loos Myrto Kostadima ChIP-seq practical: peak detection and peak annotation Mali Salmon-Divon Remco Loos Myrto Kostadima March 2012 Introduction The goal of this hands-on session is to perform some basic tasks in the analysis

More information

RNA-Seq analysis with Astrocyte Differential expression and transcriptome assembly

RNA-Seq analysis with Astrocyte Differential expression and transcriptome assembly RNA-Seq analysis with Astrocyte Differential expression and transcriptome assembly Beibei Chen Ph.D BICF 9/28/2016 Agenda Launch Workflows using Astrocyte BICF Workflows BICF RNA-seq Workflow Experimental

More information

RNA Sequencing with TopHat and Cufflinks

RNA Sequencing with TopHat and Cufflinks RNA Sequencing with TopHat and Cufflinks Introduction 3 Run TopHat App 4 TopHat App Output 5 Run Cufflinks 18 Cufflinks App Output 20 RNAseq Methods 27 Technical Assistance ILLUMINA PROPRIETARY 15050962

More information

You will be re-directed to the following result page.

You will be re-directed to the following result page. ENCODE Element Browser Goal: to navigate the candidate DNA elements predicted by the ENCODE consortium, including gene expression, DNase I hypersensitive sites, TF binding sites, and candidate enhancers/promoters.

More information

Genome 373: Mapping Short Sequence Reads III. Doug Fowler

Genome 373: Mapping Short Sequence Reads III. Doug Fowler Genome 373: Mapping Short Sequence Reads III Doug Fowler What is Galaxy? Galaxy is a free, open source web platform for running all sorts of computational analyses including pretty much all of the sequencing-related

More information

Integra(ve Genomics Viewer IGV. Tom Carroll MRC Clinical Sciences Centre

Integra(ve Genomics Viewer IGV. Tom Carroll MRC Clinical Sciences Centre Integra(ve Genomics Viewer IGV Tom Carroll MRC Clinical Sciences Centre Introduc(on to IGV. What is IGV. How to run IGV. Naviga(ng IGV. The IGV user interface. Moving around genomes. Loading and visualising

More information

Categorized software tools: (this page is being updated and links will be restored ASAP. Click on one of the menu links for more information)

Categorized software tools: (this page is being updated and links will be restored ASAP. Click on one of the menu links for more information) Categorized software tools: (this page is being updated and links will be restored ASAP. Click on one of the menu links for more information) 1 / 5 For array design, fabrication and maintaining a database

More information

NGS FASTQ file format

NGS FASTQ file format NGS FASTQ file format Line1: Begins with @ and followed by a sequence idenefier and opeonal descripeon Line2: Raw sequence leiers Line3: + Line4: Encodes the quality values for the sequence in Line2 (see

More information

Using Galaxy: RNA-seq

Using Galaxy: RNA-seq Using Galaxy: RNA-seq Stanford University September 23, 2014 Jennifer Hillman-Jackson Galaxy Team Penn State University http://galaxyproject.org/ The Agenda Introduction RNA-seq Example - Data Prep: QC

More information

Exercise 2: Browser-Based Annotation and RNA-Seq Data

Exercise 2: Browser-Based Annotation and RNA-Seq Data Exercise 2: Browser-Based Annotation and RNA-Seq Data Jeremy Buhler July 24, 2018 This exercise continues your introduction to practical issues in comparative annotation. You ll be annotating genomic sequence

More information

David Crossman, Ph.D. UAB Heflin Center for Genomic Science. GCC2012 Wednesday, July 25, 2012

David Crossman, Ph.D. UAB Heflin Center for Genomic Science. GCC2012 Wednesday, July 25, 2012 David Crossman, Ph.D. UAB Heflin Center for Genomic Science GCC2012 Wednesday, July 25, 2012 Galaxy Splash Page Colors Random Galaxy icons/colors Queued Running Completed Download/Save Failed Icons Display

More information

genbart package Vignette Jacob Cardenas, Jacob Turner, and Derek Blankenship

genbart package Vignette Jacob Cardenas, Jacob Turner, and Derek Blankenship genbart package Vignette Jacob Cardenas, Jacob Turner, and Derek Blankenship 2018-03-13 BART (Biostatistical Analysis Reporting Tool) is a user friendly, point and click, R shiny application. With the

More information

Long Read RNA-seq Mapper

Long Read RNA-seq Mapper UNIVERSITY OF ZAGREB FACULTY OF ELECTRICAL ENGENEERING AND COMPUTING MASTER THESIS no. 1005 Long Read RNA-seq Mapper Josip Marić Zagreb, February 2015. Table of Contents 1. Introduction... 1 2. RNA Sequencing...

More information

RNA- SeQC Documentation

RNA- SeQC Documentation RNA- SeQC Documentation Description: Author: Calculates metrics on aligned RNA-seq data. David S. DeLuca (Broad Institute), gp-help@broadinstitute.org Summary This module calculates standard RNA-seq related

More information

JunctionSeq Package User Manual

JunctionSeq Package User Manual JunctionSeq Package User Manual Stephen Hartley National Human Genome Research Institute National Institutes of Health March 30, 2017 JunctionSeq v1.5.4 Contents 1 Overview 2 2 Requirements 3 2.1 Alignment.........................................

More information

Expander Online Documentation

Expander Online Documentation Expander Online Documentation Table of Contents Introduction...1 Starting EXPANDER...2 Input Data...4 Preprocessing GE Data...8 Viewing Data Plots...12 Clustering GE Data...14 Biclustering GE Data...17

More information

Scalable RNA Sequencing on Clusters of Multicore Processors

Scalable RNA Sequencing on Clusters of Multicore Processors JOAQUÍN DOPAZO JOAQUÍN TARRAGA SERGIO BARRACHINA MARÍA ISABEL CASTILLO HÉCTOR MARTÍNEZ ENRIQUE S. QUINTANA ORTÍ IGNACIO MEDINA INTRODUCTION DNA Exon 0 Exon 1 Exon 2 Intron 0 Intron 1 Reads Sequencing RNA

More information

Easy visualization of the read coverage using the CoverageView package

Easy visualization of the read coverage using the CoverageView package Easy visualization of the read coverage using the CoverageView package Ernesto Lowy European Bioinformatics Institute EMBL June 13, 2018 > options(width=40) > library(coverageview) 1 Introduction This

More information

Genomic Files. University of Massachusetts Medical School. October, 2014

Genomic Files. University of Massachusetts Medical School. October, 2014 .. Genomic Files University of Massachusetts Medical School October, 2014 2 / 39. A Typical Deep-Sequencing Workflow Samples Fastq Files Fastq Files Sam / Bam Files Various files Deep Sequencing Further

More information

Workshop 6: DNA Methylation Analysis using Bisulfite Sequencing. Fides D Lay UCLA QCB Fellow

Workshop 6: DNA Methylation Analysis using Bisulfite Sequencing. Fides D Lay UCLA QCB Fellow Workshop 6: DNA Methylation Analysis using Bisulfite Sequencing Fides D Lay UCLA QCB Fellow lay.fides@gmail.com Workshop 6 Outline Day 1: Introduction to DNA methylation & WGBS Quick review of linux, Hoffman2

More information

Evaluate NimbleGen SeqCap RNA Target Enrichment Data

Evaluate NimbleGen SeqCap RNA Target Enrichment Data Roche Sequencing Technical Note November 2014 How To Evaluate NimbleGen SeqCap RNA Target Enrichment Data 1. OVERVIEW Analysis of NimbleGen SeqCap RNA target enrichment data generated using an Illumina

More information

Exercises: Analysing RNA-Seq data

Exercises: Analysing RNA-Seq data Exercises: Analysing RNA-Seq data Version 2018-03 Exercises: Analysing RNA-Seq data 2 Licence This manual is 2011-18, Simon Andrews, Laura Biggins. This manual is distributed under the creative commons

More information

Protocol: peak-calling for ChIP-seq data / segmentation analysis for histone modification data

Protocol: peak-calling for ChIP-seq data / segmentation analysis for histone modification data Protocol: peak-calling for ChIP-seq data / segmentation analysis for histone modification data Table of Contents Protocol: peak-calling for ChIP-seq data / segmentation analysis for histone modification

More information

TECH NOTE Improving the Sensitivity of Ultra Low Input mrna Seq

TECH NOTE Improving the Sensitivity of Ultra Low Input mrna Seq TECH NOTE Improving the Sensitivity of Ultra Low Input mrna Seq SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Powered by SMART and LNA technologies: Locked nucleic acid technology significantly improves

More information

Helpful Galaxy screencasts are available at:

Helpful Galaxy screencasts are available at: This user guide serves as a simplified, graphic version of the CloudMap paper for applicationoriented end-users. For more details, please see the CloudMap paper. Video versions of these user guides and

More information

JunctionSeq Package User Manual

JunctionSeq Package User Manual JunctionSeq Package User Manual Stephen Hartley National Human Genome Research Institute National Institutes of Health February 16, 2016 JunctionSeq v1.1.3 Contents 1 Overview 2 2 Requirements 3 2.1 Alignment.........................................

More information

Useful software utilities for computational genomics. Shamith Samarajiwa CRUK Autumn School in Bioinformatics September 2017

Useful software utilities for computational genomics. Shamith Samarajiwa CRUK Autumn School in Bioinformatics September 2017 Useful software utilities for computational genomics Shamith Samarajiwa CRUK Autumn School in Bioinformatics September 2017 Overview Search and download genomic datasets: GEOquery, GEOsearch and GEOmetadb,

More information

Expression Analysis with the Advanced RNA-Seq Plugin

Expression Analysis with the Advanced RNA-Seq Plugin Expression Analysis with the Advanced RNA-Seq Plugin May 24, 2016 Sample to Insight CLC bio, a QIAGEN Company Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 www.clcbio.com support-clcbio@qiagen.com

More information

Galaxy. Daniel Blankenberg The Galaxy Team

Galaxy. Daniel Blankenberg The Galaxy Team Galaxy Daniel Blankenberg The Galaxy Team http://galaxyproject.org Overview What is Galaxy? What you can do in Galaxy analysis interface, tools and datasources data libraries workflows visualization sharing

More information