CBSU/3CPG/CVG Joint Workshop Series Reference genome based sequence variation detection
|
|
- Laura McBride
- 6 years ago
- Views:
Transcription
1 CBSU/3CPG/CVG Joint Workshop Series Reference genome based sequence variation detection Computational Biology Service Unit (CBSU) Cornell Center for Comparative and Population Genomics (3CPG) Center for Vertebrate Genomics (CVG)
2 Two different data analysis strategies Assembly Alignment
3 De novo Assembly ACGAGCAACACGGTACCTA ACGGTACCTAAACCGG TACCTAAACCGGA TACCTAAACCGGACCCGGAAAGAC ACGAGCAACACGGTAGCTA ACGGTAGCTAAACCGG TAGCTAAACCGGA TAGCTAAACCGGACCCGGAAAGAC...ACGAGCAACACGGTACCTAAACCGGACCCGGAAAGAC......ACGAGCAACACGGTAGCTAAACCGGACCCGGAAAGAC...
4 De novo Assembly...ACGAGCAACACGGTACCTAAACCGGACCCGGAAAGAC......ACGAGCAACACGGTAGCTAAACCGGACCCGGAAAGAC... ACGAGCAACACGGTACCTA ACGGTACCTAAACCGG TACCTAAACCGGA TACCTAAACCGGACCCGGAAAGAC ACGAGCAACACGGTAGCTA ACGGTAGCTAAACCGG TAGCTAAACCGGA TAGCTAAACCGGACCCGGAAAGAC...ACGAGCAACACGGTACCTAAACCGGACCCGGAAAGAC......ACGAGCAACACGGTAGCTAAACCGGACCCGGAAAGAC...
5 Reference Alignment ACGAGCAACACGGTACCTA ACGGTACCTAAACCGG TACCTAAACCGGA TACCTAAACCGGACCCGGAAAGAC TAGCTAAACCGGA ACGGTAGCTAAACCGG ACGAGCAACACGGTAGCTA TAGCTAAACCGGACCCGGAAAGAC
6 Reference Alignment Reference Genome C ACGAGCAACACGGTACCTA ACGGTACCTAAACCGG TACCTAAACCGGA TACCTAAACCGGACCCGGAAAGAC ACGAGCAACACGGTAGCTA ACGGTAGCTAAACCGG TAGCTAAACCGGA TAGCTAAACCGGACCCGGAAAGAC TAGCTAAACCGGA ACGAGCAACACGGTACCTA ACGGTAGCTAAACCGG ACGGTACCTAAACCGG TACCTAAACCGGA ACGAGCAACACGGTAGCTA TACCTAAACCGGACCCGGAAAGAC TAGCTAAACCGGACCCGGAAAGAC
7 With limited number of individuals, whole genome/exome sequencing do not always reveal the causative mutations Chr Position Ref Coverage Depth Genotypes Gene chr C T() C() T() chr G C() G() C() chr G A() G() A() chr A M(AC) A() A() chr G G() R(GA) G() chr C Y(CT) Y(CT) C() chr G G() K(GT) K(GT) chr G G() R(GA) G() chr C C() Y(CT) Y(CT) chr A A() R(AG) R(AG) chr C C() M(CA) M(CA) chr T T() Y(TC) Y(TC) chr A A() M(AC) M(AC) chr A A() R(AG) A() chr A A() R(AG) R(AG) chr A R(AG) A() R(AG) chr T Y(TC) Y(TC) T() chr C T() Y(TC) T() chr G A() G() A() chr A C() A() C() chr T C() Y(CT) C() chr A G(KT) R(GA) G() chr G C(SG) G() G() chr G T(KG) G() T() chr T G(KT) T() G() chr C A() C() A() chr A G(RA) A() G()
8 With limited number of individuals, whole genome/exome sequencing do not always reveal the causative mutations Chr Position Ref Coverage Depth Genotypes Gene chr C T() C() T() chr G C() G() C() chr G A() G() A() chr A M(AC) A() A() chr G G() R(GA) G() chr C Y(CT) Y(CT) C() chr G G() K(GT) K(GT) chr G G() R(GA) G() chr C C() Y(CT) Y(CT) chr A A() R(AG) R(AG) chr C C() M(CA) M(CA) chr T T() Y(TC) Y(TC) chr A A() M(AC) M(AC) chr A A() R(AG) A() chr A A() R(AG) R(AG) chr A R(AG) A() R(AG) chr T Y(TC) Y(TC) T() chr C T() Y(TC) T() chr G A() G() A() chr A C() A() C() chr T C() Y(CT) C() chr A G(KT) R(GA) G() chr G C(SG) G() G() chr G T(KG) G() T() chr T G(KT) T() G() chr C A() C() A() chr A G(RA) A() G() Sequence a mapping population
9 Reference genome based sequence variation detection Step 1: Alignment FASTQ files Step 2: Call SNP/INDELs SAM/BAM files VCF file
10 Reference genome based sequence variation detection Step 3: Filter SNP/INDELs Step 4: Annotate SNP/INDELs
11 Reference genome based sequence variation detection Step 1: Alignment BWA Li H. and Durbin R. (2009) Bioinformatics, 25: Step 2: Call SNP/INDELs SAMtools or GATK + Picard Li H. et al. Bioinformatics, 25, Broad Institute
12 Reference genome based sequence variation detection Step 3: Filtering GATK Write your own code Step 4: Annotation Annovar
13 Standard file formats FASTQ SAM/BAM VCF
14 FASTQ ACCTTGTTGAGAAACAGGAGGTGTTGTTCTTCAAAG +20F75AAXX:5:1:335:1565 GGAAGCAACAGCTAATACATGAATGGATATCGATCG +20F75AAXX:5:1:466:1056 GCCCAACAAAGACCGGTCACCAAAGACAGATGATTC +20F75AAXX:5:1:256:1724 ]][]][]][[[[]L[[[[][[[Z[[[[[S[[ZW[[[
15 SAM file: HWI EAS83_20F7TAAXX:1:1: 379: M * 0 0 HWI EAS83_20F7TAAXX:1:1: 582:80 4 * 0 0 * * 0 0 AGAAAACT GCAAAGCA CGAGTCTA GCAGATAC h?dhhhld POhhhhhh hhhhhhhh hhhhhhhh hhhh XT:A:U NM:i:2 X0:i:1 X1:i:0 XM:i:2 XO:i:0 XG:i:0 MD:Z:2C32 G0 CCTT GCACCCTTT VbINbYZh_ AACTCGGG huhqhd\^ HWI CTAACTATC hfhhhhhhh EAS83_20F7TAAXX:1:1: TTGCTTCAC hhhhhhhh 98: M * 0 0 C hh XT:A:U NM:i:1 X0:i:1 X1:i:0 XM:i:1 XO:i:0 XG:i:0 MD:Z:33G2 ATGGCTGC hfhhhhahh CTCGCAGA `hhavheha ATCGAAAG hqkhkqa_ TTAGTGCC IIPPF@DhE HWI EAS83_20F7TAAXX:1:1: 169: M * 0 0 GCAC AAAACCAT ATCTGCTG GAAACTCT GCTTCCAC AAGC V CDhKDBhD hfagghmh ahhhhphh hhhhhhhh hhhh XT:A:U NM:i:2 X0:i:1 X1:i:0 XM:i:2 XO:i:0 XG:i:0 MD:Z:0T0C 34 Information encoded in SAM file Sequence (forward strand of the reference genome) Quality score Alignment information (position, strand, mismatches, gap) Ambigous alignments Paired end information Read group
16 BAM is a compressed SAM file BAM file is several times smaller than SAM; BAM file can be indexed and queried; Most software operates directly on BAM; BAM format can potentially replace fastq format.
17 VCF file variant call format ##fileformat=vcfv4.0 ##filedate= ##source=myimputationprogramv3.1 ##reference=1000genomespilot NCBI36 ##phasing=partial ##INFO=<ID=NS,Number=1,Type=Integer,Description="Number of Samples With Data"> ##INFO=<ID=DP,Number=1,Type=Integer,Description="Total Depth"> ##INFO=<ID=AF,Number=.,Type=Float,Description="Allele Frequency"> ##INFO=<ID=AA,Number=1,Type=String,Description="Ancestral Allele"> ##INFO=<ID=DB,Number=0,Type=Flag,Description="dbSNP membership, build 129"> ##INFO=<ID=H2,Number=0,Type=Flag,Description="HapMap2 membership"> ##FILTER=<ID=q10,Description="Quality below 10"> ##FILTER=<ID=s50,Description="Less than 50% of samples have data"> ##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype"> ##FORMAT=<ID=GQ,Number=1,Type=Integer,Description="Genotype Quality"> ##FORMAT=<ID=DP,Number=1,Type=Integer,Description="Read Depth"> ##FORMAT=<ID=HQ,Number=2,Type=Integer,Description="Haplotype Quality"> #CHROM POS ID REF ALT QUAL FILTER INFO FORMAT NA00001 NA00002 NA rs G A 29 PASS NS=3;DP=14;AF=0.5;DB;H2 GT:GQ:DP:HQ 0 0:48:1:51,51 1 0:48:8:51,51 1/1:43:5:., T A 3 q10 NS=3;DP=11;AF=0.017 GT:GQ:DP:HQ 0 0:49:3:58,50 0 1:3:5:65,3 0/0:41: rs A G,T 67 PASS NS=2;DP=10;AF=0.333,0.667;AA=T;DB GT:GQ:DP:HQ 1 2:21:6:23,27 2 1:2:0:18,2 2/2:35: T. 47 PASS NS=3;DP=13;AA=T GT:GQ:DP:HQ 0 0:54:7:56,60 0 0:48:4:51,51 0/0:61: microsat1 GTCT G,GTACT 50 PASS NS=3;DP=9;AA=G GT:GQ:DP 0/1:35:4 0/2:17:2 1/1:40:3
18 Alignment with BWA Commonly used parameters: Alignment step (aln): n: maximum number of edit distance (default 0.04) o: maximum number of gap opens (default 1) Write SAM file step (samse or sampe): n maximum number of alignments to report
19 Converting SAM to BAM Index BAM Samtools: Picard: view; index SamFormatConverter; BuildBamIndex *** If you want to use Broad GATK software to call SNPs, do not use SAMtools, always use Picard for processing SAM and BAM files.
20 BAM file can be visualized with IGV software
21 Clean up the BAM file Mark possible PCR duplicates Base quality score recalibration Local realignment around indels
22 Clean up the BAM file Mark possible PCR duplicates ** For sequence reads with exact same sequence, only one copy is kept. Base quality score recalibration Local realignment around indels
23 Clean up the BAM file Mark possible PCR duplicates Base quality score recalibration Phred quality score: 20 > 1% error rate. Illumina quality score: 0 to 62, need to be calibrated to reflect error rate. Local realignment around indels
24 Clean up the BAM file Mark possible PCR duplicates Base quality score recalibration Local realignment around indels
25 Multi sample SNP and INDEL calling Use Unified Genotyper (GATK) or mpileup (SAMtools) to call SNP and INDEL from multiple samples. Set the variants calling threshold Emission threshold: Q10 (>10x) Q3(<10x) Confidence threshold: Q30(>10x) Q4(<10x)
26 Filtering Read depth (DP) Allele frequency (AF) Number of samples with data (NS)
27 SAMtools GATK/Picard SAM > BAM Flag possible PCR duplicates Quality score calibration INDEL realignment * Call variants on multiple samples Filtering ** * SAMtools mpileup has built in realignment tool ** Limited filtering function. Poor documentation.
28 GATK Documentation:
29 SAMtools Variants Calling Documentation:
30 Practical aspects 1. Experimental Design. 2. Computational Resource at Cornell.
31 Whole genome sequencing vs Targeted sequencing Target enrichment by array or in solution based capturing technology. (e.g. Exome sequencing).
32 Whole genome sequencing vs Genotyping by Sequencing (GBS) ApeK I site Line 1 Line 2 Line 3 Ed Buckler Lab ( overview)
33 Advantage of GBS over whole genome sequencing 1. Reduced cost by multiplexing; 2. Possible to map markers that are not on the reference genome;
34 To identify causative mutations in a mutant strain, it is necessary to use both sequencing and genetic linkage analysis.
35 Mapping and Mutation Identification of the Pooled F2 population * * X F1 * F2 * ***
36 Using SHOREmap for mapping and mutation identification SHOREmap Schneeberger K et al (2009) Nat Methods.6(8):550 1.
37 Alternative approach: test for enrichment of new mutations Zuryn et al. (2010) A Strategy for Direct Mapping and Identification of Mutations by Whole Genome Sequencing. Genetics 186:
38 Computational Resource at Cornell CBSU / 3CPG BioHPC Laboratory (625 Rhodes Hall) Office Hour: 1:00 to 3:00 PM every Monday. cbsu@cornell.edu to get an BioHPC lab account.
39 Training workshops Linux for Biologists Programming workshop (PERL)
From fastq to vcf. NGG 2016 / Evolutionary Genomics Ari Löytynoja /
From fastq to vcf Overview of resequencing analysis samples fastq fastq fastq fastq mapping bam bam bam bam variant calling samples 18917 C A 0/0 0/0 0/0 0/0 18969 G T 0/0 0/0 0/0 0/0 19022 G T 0/1 1/1
More informationAnalysing re-sequencing samples. Malin Larsson WABI / SciLifeLab
Analysing re-sequencing samples Malin Larsson Malin.larsson@scilifelab.se WABI / SciLifeLab Re-sequencing Reference genome assembly...gtgcgtagactgctagatcgaaga...! Re-sequencing IND 1! GTAGACT! AGATCGG!
More informationAnalysing re-sequencing samples. Anna Johansson WABI / SciLifeLab
Analysing re-sequencing samples Anna Johansson Anna.johansson@scilifelab.se WABI / SciLifeLab Re-sequencing Reference genome assembly...gtgcgtagactgctagatcgaaga... Re-sequencing IND 1 GTAGACT AGATCGG GCGTAGT
More informationBriefly: Bioinformatics File Formats. J Fass September 2018
Briefly: Bioinformatics File Formats J Fass September 2018 Overview ASCII Text Sequence Fasta, Fastq ~Annotation TSV, CSV, BED, GFF, GTF, VCF, SAM Binary (Data, Compressed, Executable) Data HDF5 BAM /
More informationNext Generation Sequence Alignment on the BRC Cluster. Steve Newhouse 22 July 2010
Next Generation Sequence Alignment on the BRC Cluster Steve Newhouse 22 July 2010 Overview Practical guide to processing next generation sequencing data on the cluster No details on the inner workings
More informationINTRODUCTION AUX FORMATS DE FICHIERS
INTRODUCTION AUX FORMATS DE FICHIERS Plan. Formats de séquences brutes.. Format fasta.2. Format fastq 2. Formats d alignements 2.. Format SAM 2.2. Format BAM 4. Format «Variant Calling» 4.. Format Varscan
More informationSweeD 3.0. Pavlos Pavlidis & Nikolaos Alachiotis
1 SweeD 3.0 Pavlos Pavlidis & Nikolaos Alachiotis Contents 1 Introduction 1 2 The Site Frequency Spectrum (SFS) pattern of selective sweeps 3 2.1 The selective sweep model as implemented by Nielsen et
More informationTCGA Variant Call Format (VCF) 1.0 Specification
TCGA Variant Call Format (VCF) 1.0 Specification Document Information Specification for TCGA Variant Call Format (VCF) Version 1.0 1 About TCGA VCF specification 2 TCGA-specific customizations 3 File format
More informationNGS Data Analysis. Roberto Preste
NGS Data Analysis Roberto Preste 1 Useful info http://bit.ly/2r1y2dr Contacts: roberto.preste@gmail.com Slides: http://bit.ly/ngs-data 2 NGS data analysis Overview 3 NGS Data Analysis: the basic idea http://bit.ly/2r1y2dr
More informationWelcome to MAPHiTS (Mapping Analysis Pipeline for High-Throughput Sequences) tutorial page.
Welcome to MAPHiTS (Mapping Analysis Pipeline for High-Throughput Sequences) tutorial page. In this page you will learn to use the tools of the MAPHiTS suite. A little advice before starting : rename your
More informationSAM and VCF formats. UCD Genome Center Bioinformatics Core Tuesday 14 June 2016
SAM and VCF formats UCD Genome Center Bioinformatics Core Tuesday 14 June 2016 File Format: SAM / BAM / CRAM! NEW http://samtools.sourceforge.net/ - deprecated! http://www.htslib.org/ - SAMtools 1.0 and
More informationSupplementary Information. Detecting and annotating genetic variations using the HugeSeq pipeline
Supplementary Information Detecting and annotating genetic variations using the HugeSeq pipeline Hugo Y. K. Lam 1,#, Cuiping Pan 1, Michael J. Clark 1, Phil Lacroute 1, Rui Chen 1, Rajini Haraksingh 1,
More informationRead Mapping and Variant Calling
Read Mapping and Variant Calling Whole Genome Resequencing Sequencing mul:ple individuals from the same species Reference genome is already available Discover varia:ons in the genomes between and within
More informationExome sequencing. Jong Kyoung Kim
Exome sequencing Jong Kyoung Kim Genome Analysis Toolkit The GATK is the industry standard for identifying SNPs and indels in germline DNA and RNAseq data. Its scope is now expanding to include somatic
More informationSAMtools. SAM BAM. mapping. BAM sort & indexing (ex: IGV) SNP call
SAMtools http://samtools.sourceforge.net/ SAM/BAM mapping BAM SAM BAM BAM sort & indexing (ex: IGV) mapping SNP call SAMtools NGS Program: samtools (Tools for alignments in the SAM format) Version: 0.1.19
More informationMapping NGS reads for genomics studies
Mapping NGS reads for genomics studies Valencia, 28-30 Sep 2015 BIER Alejandro Alemán aaleman@cipf.es Genomics Data Analysis CIBERER Where are we? Fastq Sequence preprocessing Fastq Alignment BAM Visualization
More informationHigh-throughput sequencing: Alignment and related topic. Simon Anders EMBL Heidelberg
High-throughput sequencing: Alignment and related topic Simon Anders EMBL Heidelberg Established platforms HTS Platforms Illumina HiSeq, ABI SOLiD, Roche 454 Newcomers: Benchtop machines: Illumina MiSeq,
More informationHigh-throughput sequencing: Alignment and related topic. Simon Anders EMBL Heidelberg
High-throughput sequencing: Alignment and related topic Simon Anders EMBL Heidelberg Established platforms HTS Platforms Illumina HiSeq, ABI SOLiD, Roche 454 Newcomers: Benchtop machines 454 GS Junior,
More informationAgroMarker Finder manual (1.1)
AgroMarker Finder manual (1.1) 1. Introduction 2. Installation 3. How to run? 4. How to use? 5. Java program for calculating of restriction enzyme sites (TaqαI). 1. Introduction AgroMarker Finder (AMF)is
More informationVariation among genomes
Variation among genomes Comparing genomes The reference genome http://www.ncbi.nlm.nih.gov/nuccore/26556996 Arabidopsis thaliana, a model plant Col-0 variety is from Landsberg, Germany Ler is a mutant
More informationVariant calling using SAMtools
Variant calling using SAMtools Calling variants - a trivial use of an Interactive Session We are going to conduct the variant calling exercises in an interactive idev session just so you can get a feel
More informationelprep: a high- performance tool for preparing SAM/BAM files for variant calling Charlo<e Herzeel (Imec) Pascal Costanza (Intel) July 2014
elprep: a high- performance tool for preparing SAM/BAM files for variant calling Charlo
More informationPractical exercises Day 2. Variant Calling
Practical exercises Day 2 Variant Calling Samtools mpileup Variant calling with samtools mpileup + bcftools Variant calling with HaplotypeCaller (GATK Best Practices) Genotype GVCFs Hard Filtering Variant
More informationRNAseq analysis: SNP calling. BTI bioinformatics course, spring 2013
RNAseq analysis: SNP calling BTI bioinformatics course, spring 2013 RNAseq overview RNAseq overview Choose technology 454 Illumina SOLiD 3 rd generation (Ion Torrent, PacBio) Library types Single reads
More informationNGS Sequence data. Jason Stajich. UC Riverside. jason.stajich[at]ucr.edu. twitter:hyphaltip stajichlab
NGS Sequence data Jason Stajich UC Riverside jason.stajich[at]ucr.edu twitter:hyphaltip stajichlab Lecture available at http://github.com/hyphaltip/cshl_2012_ngs 1/58 NGS sequence data Quality control
More informationBioinformatics in next generation sequencing projects
Bioinformatics in next generation sequencing projects Rickard Sandberg Assistant Professor Department of Cell and Molecular Biology Karolinska Institutet March 2011 Once sequenced the problem becomes computational
More informationHigh-throughout sequencing and using short-read aligners. Simon Anders
High-throughout sequencing and using short-read aligners Simon Anders High-throughput sequencing (HTS) Sequencing millions of short DNA fragments in parallel. a.k.a.: next-generation sequencing (NGS) massively-parallel
More informationCalling variants in diploid or multiploid genomes
Calling variants in diploid or multiploid genomes Diploid genomes The initial steps in calling variants for diploid or multi-ploid organisms with NGS data are the same as what we've already seen: 1. 2.
More informationReads Alignment and Variant Calling
Reads Alignment and Variant Calling CB2-201 Computational Biology and Bioinformatics February 22, 2016 Emidio Capriotti http://biofold.org/ Institute for Mathematical Modeling of Biological Systems Department
More informationNA12878 Platinum Genome GENALICE MAP Analysis Report
NA12878 Platinum Genome GENALICE MAP Analysis Report Bas Tolhuis, PhD Jan-Jaap Wesselink, PhD GENALICE B.V. INDEX EXECUTIVE SUMMARY...4 1. MATERIALS & METHODS...5 1.1 SEQUENCE DATA...5 1.2 WORKFLOWS......5
More informationREPORT. NA12878 Platinum Genome. GENALICE MAP Analysis Report. Bas Tolhuis, PhD GENALICE B.V.
REPORT NA12878 Platinum Genome GENALICE MAP Analysis Report Bas Tolhuis, PhD GENALICE B.V. INDEX EXECUTIVE SUMMARY...4 1. MATERIALS & METHODS...5 1.1 SEQUENCE DATA...5 1.2 WORKFLOWS......5 1.3 ACCURACY
More informationRPGC Manual. You will also need python 2.7 or above to run our home-brew python scripts.
Introduction Here we present a new approach for producing de novo whole genome sequences--recombinant population genome construction (RPGC)--that solves many of the problems encountered in standard genome
More informationHandling sam and vcf data, quality control
Handling sam and vcf data, quality control We continue with the earlier analyses and get some new data: cd ~/session_3 wget http://wasabiapp.org/vbox/data/session_4/file3.tgz tar xzf file3.tgz wget http://wasabiapp.org/vbox/data/session_4/file4.tgz
More informationRNA-seq. Manpreet S. Katari
RNA-seq Manpreet S. Katari Evolution of Sequence Technology Normalizing the Data RPKM (Reads per Kilobase of exons per million reads) Score = R NT R = # of unique reads for the gene N = Size of the gene
More informationOverview and Implementation of the GBS Pipeline. Qi Sun Computational Biology Service Unit Cornell University
Overview and Implementation of the GBS Pipeline Qi Sun Computational Biology Service Unit Cornell University Overview of the Data Analysis Strategy Genotyping by Sequencing (GBS) ApeKI site (GCWGC) ( )
More informationOverview and Implementation of the GBS Pipeline. Qi Sun Computational Biology Service Unit Cornell University
Overview and Implementation of the GBS Pipeline Qi Sun Computational Biology Service Unit Cornell University Overview of the Data Analysis Strategy Genotyping by Sequencing (GBS) ApeKI site (GCWGC) ( )
More informationMPG NGS workshop I: Quality assessment of SNP calls
MPG NGS workshop I: Quality assessment of SNP calls Kiran V Garimella (kiran@broadinstitute.org) Genome Sequencing and Analysis Medical and Population Genetics February 4, 2010 SNP calling workflow Filesize*
More informationMIRING: Minimum Information for Reporting Immunogenomic NGS Genotyping. Data Standards Hackathon for NGS HACKATHON 1.0 Bethesda, MD September
MIRING: Minimum Information for Reporting Immunogenomic NGS Genotyping Data Standards Hackathon for NGS HACKATHON 1.0 Bethesda, MD September 27 2014 Static Dynamic Static Minimum Information for Reporting
More informationGalaxy workshop at the Winter School Igor Makunin
Galaxy workshop at the Winter School 2016 Igor Makunin i.makunin@uq.edu.au Winter school, UQ, July 6, 2016 Plan Overview of the Genomics Virtual Lab Introduce Galaxy, a web based platform for analysis
More informationPRACTICAL SESSION 5 GOTCLOUD ALIGNMENT WITH BWA JAN 7 TH, 2014 STOM 2014 WORKSHOP HYUN MIN KANG UNIVERSITY OF MICHIGAN, ANN ARBOR
PRACTICAL SESSION 5 GOTCLOUD ALIGNMENT WITH BWA JAN 7 TH, 2014 STOM 2014 WORKSHOP HYUN MIN KANG UNIVERSITY OF MICHIGAN, ANN ARBOR GOAL OF THIS SESSION Assuming that The audiences know how to perform GWAS
More informationGenomics. Nolan C. Kane
Genomics Nolan C. Kane Nolan.Kane@Colorado.edu Course info http://nkane.weebly.com/genomics.html Emails let me know if you are not getting them! Email me at nolan.kane@colorado.edu Office hours by appointment
More informationDNA Sequencing analysis on Artemis
DNA Sequencing analysis on Artemis Mapping and Variant Calling Tracy Chew Senior Research Bioinformatics Technical Officer Rosemarie Sadsad Informatics Services Lead Hayim Dar Informatics Technical Officer
More informationPreparation of alignments for variant calling with GATK: exercise instructions for BioHPC Lab computers
Preparation of alignments for variant calling with GATK: exercise instructions for BioHPC Lab computers Data used in the exercise We will use D. melanogaster WGS paired-end Illumina data with NCBI accessions
More informationSequence Mapping and Assembly
Practical Introduction Sequence Mapping and Assembly December 8, 2014 Mary Kate Wing University of Michigan Center for Statistical Genetics Goals of This Session Learn basics of sequence data file formats
More informationFile Formats: SAM, BAM, and CRAM. UCD Genome Center Bioinformatics Core Tuesday 15 September 2015
File Formats: SAM, BAM, and CRAM UCD Genome Center Bioinformatics Core Tuesday 15 September 2015 / BAM / CRAM NEW! http://samtools.sourceforge.net/ - deprecated! http://www.htslib.org/ - SAMtools 1.0 and
More informationGalaxy Platform For NGS Data Analyses
Galaxy Platform For NGS Data Analyses Weihong Yan wyan@chem.ucla.edu Collaboratory Web Site http://qcb.ucla.edu/collaboratory Collaboratory Workshops Workshop Outline ü Day 1 UCLA galaxy and user account
More informationAnalysis of ChIP-seq data
Before we start: 1. Log into tak (step 0 on the exercises) 2. Go to your lab space and create a folder for the class (see separate hand out) 3. Connect to your lab space through the wihtdata network and
More informationHelpful Galaxy screencasts are available at:
This user guide serves as a simplified, graphic version of the CloudMap paper for applicationoriented end-users. For more details, please see the CloudMap paper. Video versions of these user guides and
More informationChIP-seq (NGS) Data Formats
ChIP-seq (NGS) Data Formats Biological samples Sequence reads SRA/SRF, FASTQ Quality control SAM/BAM/Pileup?? Mapping Assembly... DE Analysis Variant Detection Peak Calling...? Counts, RPKM VCF BED/narrowPeak/
More informationmageri Documentation Release Mikhail Shugay
mageri Documentation Release 1.0.0 Mikhail Shugay May 08, 2017 Contents 1 Terminology 3 2 Table of contents 5 2.1 Installation and running......................................... 5 2.2 Input...................................................
More informationNGS Data Visualization and Exploration Using IGV
1 What is Galaxy Galaxy for Bioinformaticians Galaxy for Experimental Biologists Using Galaxy for NGS Analysis NGS Data Visualization and Exploration Using IGV 2 What is Galaxy Galaxy for Bioinformaticians
More informationDindel User Guide, version 1.0
Dindel User Guide, version 1.0 Kees Albers University of Cambridge, Wellcome Trust Sanger Institute caa@sanger.ac.uk October 26, 2010 Contents 1 Introduction 2 2 Requirements 2 3 Optional input 3 4 Dindel
More informationWM2 Bioinformatics. ExomeSeq data analysis part 1. Dietmar Rieder
WM2 Bioinformatics ExomeSeq data analysis part 1 Dietmar Rieder RAW data Use putty to logon to cluster.i med.ac.at In your home directory make directory to store raw data $ mkdir 00_RAW Copy raw fastq
More informationUnder the Hood of Alignment Algorithms for NGS Researchers
Under the Hood of Alignment Algorithms for NGS Researchers April 16, 2014 Gabe Rudy VP of Product Development Golden Helix Questions during the presentation Use the Questions pane in your GoToWebinar window
More informationThe software comes with 2 installers: (1) SureCall installer (2) GenAligners (contains BWA, BWA- MEM).
Release Notes Agilent SureCall 4.0 Product Number G4980AA SureCall Client 6-month named license supports installation of one client and server (to host the SureCall database) on one machine. For additional
More informationNGS Analysis Using Galaxy
NGS Analysis Using Galaxy Sequences and Alignment Format Galaxy overview and Interface Get;ng Data in Galaxy Analyzing Data in Galaxy Quality Control Mapping Data History and workflow Galaxy Exercises
More informationDecrypting your genome data privately in the cloud
Decrypting your genome data privately in the cloud Marc Sitges Data Manager@Made of Genes @madeofgenes The Human Genome 3.200 M (x2) Base pairs (bp) ~20.000 genes (~30%) (Exons ~1%) The Human Genome Project
More informationBioinformatics Framework
Persona: A High-Performance Bioinformatics Framework Stuart Byma 1, Sam Whitlock 1, Laura Flueratoru 2, Ethan Tseng 3, Christos Kozyrakis 4, Edouard Bugnion 1, James Larus 1 EPFL 1, U. Polytehnica of Bucharest
More informationFalcon Accelerated Genomics Data Analysis Solutions. User Guide
Falcon Accelerated Genomics Data Analysis Solutions User Guide Falcon Computing Solutions, Inc. Version 1.0 3/30/2018 Table of Contents Introduction... 3 System Requirements and Installation... 4 Software
More informationMaize genome sequence in FASTA format. Gene annotation file in gff format
Exercise 1. Using Tophat/Cufflinks to analyze RNAseq data. Step 1. One of CBSU BioHPC Lab workstations has been allocated for your workshop exercise. The allocations are listed on the workshop exercise
More information3. Installation Download Cpipe and Run Install Script Create an Analysis Profile Create a Batch... 7
Cpipe User Guide 1. Introduction - What is Cpipe?... 3 2. Design Background... 3 2.1. Analysis Pipeline Implementation (Cpipe)... 4 2.2. Use of a Bioinformatics Pipeline Toolkit (Bpipe)... 4 2.3. Individual
More informationGBS Bioinformatics Pipeline(s) Overview
GBS Bioinformatics Pipeline(s) Overview Getting from sequence files to genotypes. Pipeline Coding: Ed Buckler Jeff Glaubitz James Harriman Presentation: Terry Casstevens With supporting information from
More informationMiSeq Reporter Amplicon DS Workflow Guide
MiSeq Reporter Amplicon DS Workflow Guide For Research Use Only. Not for use in diagnostic procedures. Introduction 3 Amplicon DS Workflow Overview 4 Optional Settings for the Amplicon DS Workflow 7 Analysis
More informationMinimum Information for Reporting Immunogenomic NGS Genotyping (MIRING)
Minimum Information for Reporting Immunogenomic NGS Genotyping (MIRING) Reporting guideline statement for HLA and KIR genotyping data generated via Next Generation Sequencing (NGS) technologies and analysis
More informationMiSeq Reporter TruSight Tumor 15 Workflow Guide
MiSeq Reporter TruSight Tumor 15 Workflow Guide For Research Use Only. Not for use in diagnostic procedures. Introduction 3 TruSight Tumor 15 Workflow Overview 4 Reports 8 Analysis Output Files 9 Manifest
More informationRNA-Seq in Galaxy: Tuxedo protocol. Igor Makunin, UQ RCC, QCIF
RNA-Seq in Galaxy: Tuxedo protocol Igor Makunin, UQ RCC, QCIF Acknowledgments Genomics Virtual Lab: gvl.org.au Galaxy for tutorials: galaxy-tut.genome.edu.au Galaxy Australia: galaxy-aust.genome.edu.au
More informationTumor-Specific NeoAntigen Detector (TSNAD) v2.0 User s Manual
Tumor-Specific NeoAntigen Detector (TSNAD) v2.0 User s Manual Zhan Zhou, Xingzheng Lyu and Jingcheng Wu Zhejiang University, CHINA March, 2016 USER'S MANUAL TABLE OF CONTENTS 1 GETTING STARTED... 1 1.1
More informationHalvade: scalable sequence analysis with MapReduce
Bioinformatics Advance Access published March 26, 2015 Halvade: scalable sequence analysis with MapReduce Dries Decap 1,5, Joke Reumers 2,5, Charlotte Herzeel 3,5, Pascal Costanza, 4,5 and Jan Fostier
More informationThe Variant Call Format (VCF) Version 4.2 Specification
The Variant Call Format (VCF) Version 4.2 Specification 17 Dec 2013 The master version of this document can be found at https://github.com/samtools/hts-specs. This printing is version c02ad4c from that
More informationIsaac Enrichment v2.0 App
Isaac Enrichment v2.0 App Introduction 3 Running Isaac Enrichment v2.0 5 Isaac Enrichment v2.0 Output 7 Isaac Enrichment v2.0 Methods 31 Technical Assistance ILLUMINA PROPRIETARY 15050960 Rev. C December
More informationGenome Assembly Using de Bruijn Graphs. Biostatistics 666
Genome Assembly Using de Bruijn Graphs Biostatistics 666 Previously: Reference Based Analyses Individual short reads are aligned to reference Genotypes generated by examining reads overlapping each position
More informationPRACTICAL SESSION 8 SEQUENCE-BASED ASSOCIATION, INTERPRETATION, VISUALIZATION USING EPACTS JAN 7 TH, 2014 STOM 2014 WORKSHOP
PRACTICAL SESSION 8 SEQUENCE-BASED ASSOCIATION, INTERPRETATION, VISUALIZATION USING EPACTS JAN 7 TH, 2014 STOM 2014 WORKSHOP HYUN MIN KANG UNIVERSITY OF MICHIGAN, ANN ARBOR EPACTS ASSOCIATION ANALYSIS
More informationSNP Calling. Tuesday 4/21/15
SNP Calling Tuesday 4/21/15 Why Call SNPs? map mutations, ex: EMS, natural variation, introgressions associate with changes in expression develop markers for whole genome QTL analysis/ GWAS access diversity
More informationIntro to NGS Tutorial
Intro to NGS Tutorial Release 8.6.0 Golden Helix, Inc. October 31, 2016 Contents 1. Overview 2 2. Import Variants and Quality Fields 3 3. Quality Filters 10 Generate Alternate Read Ratio.........................................
More informationRVD2.7 command line program (CLI) instructions
RVD2.7 command line program (CLI) instructions Contents I. The overall Flowchart of RVD2 program... 1 II. The overall Flow chart of Test s... 2 III. RVD2 CLI syntax... 3 IV. RVD2 CLI demo... 5 I. The overall
More informationLecture 12. Short read aligners
Lecture 12 Short read aligners Ebola reference genome We will align ebola sequencing data against the 1976 Mayinga reference genome. We will hold the reference gnome and all indices: mkdir -p ~/reference/ebola
More informationGenome Data Management using RDBMSs
Genome Data Management using RDBMSs Steffen Janetzki University of Magdeburg steffen.janetzki@st.ovgu.de Magnús Rafn Tiedemann University of Magdeburg magnus.tiedemann@st.ovgu.de Hardik Balar University
More informationTutorial. Identification of Variants Using GATK. Sample to Insight. November 21, 2017
Identification of Variants Using GATK November 21, 2017 Sample to Insight QIAGEN Aarhus Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 www.qiagenbioinformatics.com AdvancedGenomicsSupport@qiagen.com
More informationPractical Linux Examples
Practical Linux Examples Processing large text file Parallelization of independent tasks Qi Sun & Robert Bukowski Bioinformatics Facility Cornell University http://cbsu.tc.cornell.edu/lab/doc/linux_examples_slides.pdf
More informationfreebayes in depth: model, filtering, and walkthrough Erik Garrison Wellcome Trust Sanger of Iowa May 19, 2015
freebayes in depth: model, filtering, and walkthrough Erik Garrison Wellcome Trust Sanger Institute @University of Iowa May 19, 2015 Overview 1. Primary filtering: Bayesian callers 2. Post-call filtering:
More informationIntroduction to NGS analysis on a Raspberry Pi. Beta version 1.1 (04 June 2013)
Introduction to NGS analysis on a Raspberry Pi Beta version 1.1 (04 June 2013)!! Contents Overview Contents... 3! Overview... 4! Download some simulated reads... 5! Quality Control... 7! Map reads using
More informationADNI Sequencing Working Group. Robert C. Green, MD, MPH Andrew J. Saykin, PsyD Arthur Toga, PhD
ADNI Sequencing Working Group Robert C. Green, MD, MPH Andrew J. Saykin, PsyD Arthur Toga, PhD Why sequencing? V V V V V V V V V V V V V A fortuitous relationship TIME s Best Invention of 2008 The initial
More informationEnsembl RNASeq Practical. Overview
Ensembl RNASeq Practical The aim of this practical session is to use BWA to align 2 lanes of Zebrafish paired end Illumina RNASeq reads to chromosome 12 of the zebrafish ZV9 assembly. We have restricted
More informationSequence Analysis Pipeline
Sequence Analysis Pipeline Transcript fragments 1. PREPROCESSING 2. ASSEMBLY (today) Removal of contaminants, vector, adaptors, etc Put overlapping sequence together and calculate bigger sequences 3. Analysis/Annotation
More informationLocal Run Manager Resequencing Analysis Module Workflow Guide
Local Run Manager Resequencing Analysis Module Workflow Guide For Research Use Only. Not for use in diagnostic procedures. Overview 3 Set Parameters 4 Analysis Methods 6 View Analysis Results 8 Analysis
More informationSentieon Documentation
Sentieon Documentation Release 201808.03 Sentieon, Inc Dec 21, 2018 Sentieon Manual 1 Introduction 1 1.1 Description.............................................. 1 1.2 Benefits and Value..........................................
More informationRCAC. Job files Example: Running seqyclean (a module)
RCAC Job files Why? When you log into an RCAC server you are using a special server designed for multiple users. This is called a frontend node ( or sometimes a head node). There are (I think) three front
More informationNext generation sequencing: assembly by mapping reads. Laurent Falquet, Vital-IT Helsinki, June 3, 2010
Next generation sequencing: assembly by mapping reads Laurent Falquet, Vital-IT Helsinki, June 3, 2010 Overview What is assembly by mapping? Methods BWT File formats Tools Issues Visualization Discussion
More informationThe software comes with 2 installers: (1) SureCall installer (2) GenAligners (contains BWA, BWA-MEM).
Release Notes Agilent SureCall 3.5 Product Number G4980AA SureCall Client 6-month named license supports installation of one client and server (to host the SureCall database) on one machine. For additional
More informationNGS Analyses with Galaxy
1 NGS Analyses with Galaxy Introduction Every living organism on our planet possesses a genome that is composed of one or several DNA (deoxyribonucleotide acid) molecules determining the way the organism
More informationRsubread package: high-performance read alignment, quantification and mutation discovery
Rsubread package: high-performance read alignment, quantification and mutation discovery Wei Shi 14 September 2015 1 Introduction This vignette provides a brief description to the Rsubread package. For
More informationQIAseq DNA V3 Panel Analysis Plugin USER MANUAL
QIAseq DNA V3 Panel Analysis Plugin USER MANUAL User manual for QIAseq DNA V3 Panel Analysis 1.0.1 Windows, Mac OS X and Linux January 25, 2018 This software is for research purposes only. QIAGEN Aarhus
More informationIntroduction to Read Alignment. UCD Genome Center Bioinformatics Core Tuesday 15 September 2015
Introduction to Read Alignment UCD Genome Center Bioinformatics Core Tuesday 15 September 2015 From reads to molecules Why align? Individual A Individual B ATGATAGCATCGTCGGGTGTCTGCTCAATAATAGTGCCGTATCATGCTGGTGTTATAATCGCCGCATGACATGATCAATGG
More informationDRAGEN Bio-IT Platform Enabling the Global Genomic Infrastructure
TM DRAGEN Bio-IT Platform Enabling the Global Genomic Infrastructure About DRAGEN Edico Genome s DRAGEN TM (Dynamic Read Analysis for GENomics) Bio-IT Platform provides ultra-rapid secondary analysis of
More informationTutorial on gene-c ancestry es-ma-on: How to use LASER. Chaolong Wang Sequence Analysis Workshop June University of Michigan
Tutorial on gene-c ancestry es-ma-on: How to use LASER Chaolong Wang Sequence Analysis Workshop June 2014 @ University of Michigan LASER: Loca-ng Ancestry from SEquence Reads Main func:ons of the so
More informationPre-processing and quality control of sequence data. Barbera van Schaik KEBB - Bioinformatics Laboratory
Pre-processing and quality control of sequence data Barbera van Schaik KEBB - Bioinformatics Laboratory b.d.vanschaik@amc.uva.nl Topic: quality control and prepare data for the interesting stuf Keep Throw
More informationmyvcf Documentation Release latest
myvcf Documentation Release latest Oct 09, 2017 Contents 1 Want to try myvcf? 3 2 Documentation contents 5 2.1 How to install myvcf.......................................... 5 2.2 Setup the application...........................................
More informationRsubread package: high-performance read alignment, quantification and mutation discovery
Rsubread package: high-performance read alignment, quantification and mutation discovery Wei Shi 14 September 2015 1 Introduction This vignette provides a brief description to the Rsubread package. For
More informationMapping reads to a reference genome
Introduction Mapping reads to a reference genome Dr. Robert Kofler October 17, 2014 Dr. Robert Kofler Mapping reads to a reference genome October 17, 2014 1 / 52 Introduction RESOURCES the lecture: http://drrobertkofler.wikispaces.com/ngsandeelecture
More informationData Walkthrough: Background
Data Walkthrough: Background File Types FASTA Files FASTA files are text-based representations of genetic information. They can contain nucleotide or amino acid sequences. For this activity, students will
More information