Lecture 13: Graphs I: Breadth First Search
|
|
- Cornelius Houston
- 6 years ago
- Views:
Transcription
1 Leture 13 Grphs I: BFS Fll 2011 Leture 13: Grphs I: Bredth First Serh Leture Overview Applitions of Grph Serh Grph Representtions Bredth-First Serh Rell: Grph G = (V, E) V = set of verties (ritrry lels) E = set of edges i.e. vertex pirs (v, w) ordered pir = direted edge of grph unordered pir = undireted e.g. V = {,,,d} E = {{,},{,}, {,},{,d}, {,d}} V = {,,} E = {(,),(,), (,),(,)} d UNDIRECTED DIRECTED Figure 1: Exmple to illustrte grph terminology Grph Serh Explore grph, e.g.: find pth from strt vertex s to desired vertex visit ll verties or edges of grph, or only those rehle from s 1
2 Leture 13 Grphs I: BFS Fll 2011 Applitions: There re mny. we rwling (how Google finds pges) soil networking (Feook friend finder) network rodst routing grge olletion model heking (finite stte mhine) heking mthemtil onjetures solving puzzles nd gmes Poket Cue: Consider Ruik s ue Configurtion Grph: vertex for eh possile stte edge for eh si move (e.g., 90 degree turn) from one stte to nother undireted: moves re reversile Dimeter ( God s Numer ) 11 for 2 2 2, 20 for 3 3 3, Θ(n 2 / lg n) for n n n [Demine, Demine, Eisenstt Luiw Winslow 2011] solved possile first moves rehle in two steps ut not one hrdest onfigs... redthfirst tree 2
3 Leture 13 Grphs I: BFS Fll 2011 # verties = 8! 3 8 = 264, 539, 520 where 8! omes from hving 8 uelets in ritrry positions nd 3 8 omes s eh uelet hs 3 possile twists. This n e divided y 24 if we remove ue symmetries nd further divided y 3 to ount for tully rehle onfigurtions (there re 3 onneted omponents). Grph Representtions: (dt strutures) Adjeny lists: Arry Adj of V linked lists for eh vertex u V, Adj[u] stores u s neighors, i.e., {v V (u, v) E}. (u, v) re just outgoing edges if direted. (See Fig. 2 for n exmple.) Adj Figure 2: Adjeny List Representtion: Spe Θ(V + E) in Python: Adj = ditionry of list/set vlues; vertex = ny hshle ojet (e.g., int, tuple) dvntge: multiple grphs on sme verties Impliit Grphs: Adj(u) is funtion ompute lol struture on the fly (e.g., Ruik s Cue). This requires Zero Spe. 3
4 Leture 13 Grphs I: BFS Fll 2011 Ojet-oriented Vritions: ojet for eh vertex u u.neighors = list of neighors i.e. Adj[u] In other words, this is method for impliit grphs Inidene Lists: n lso mke edges ojets e. e e. u.edges = list of (outgoing) edges from u. dvntge: store edge dt without hshing Bredth-First Serh Explore grph level y level from s level 0 = {s} level i = verties rehle y pth of i edges ut not fewer s... level0 level1 level2 lst level Figure 3: Illustrting Bredth-First Serh 4
5 Leture 13 Grphs I: BFS Fll 2011 uild level i > 0 from level i 1 y trying ll outgoing edges, ut ignoring verties from previous levels Bredth-First-Serh Algorithm Exmple BFS (V,Adj,s): See CLRS for queue-sed implementtion level = { s: 0 } prent = {s : None } i = 1 frontier = [s] # previous level, i 1 while frontier: next = [ ] # next level, i for u in frontier: for v in Adj [u]: if v not in level: # not yet seen level[v] = i = level[u] + 1 prent[v] = u next.ppend(v) frontier = next i + =1 level 1 level s 2 d 3 f 2 z 1 x 2 3 v frontier 0 = {s} frontier 1 = {, x} frontier 2 = {z, d, } frontier 3 = {f, v} (not x,, d) level 2 level 3 Figure 4: Bredth-First Serh Frontier Anlysis: vertex V enters next (& then frontier) only one (euse level[v] then set) se se: v = s 5
6 Leture 13 Grphs I: BFS Fll 2011 = Adj[v] looped through only one time = Adj[V ] = = O(E) time v V { E for direted grphs 2 E for undireted grphs O(V + E) ( LINEAR TIME ) to lso list verties unrehle from v (those still not ssigned level) Shortest Pths: f. L15-18 for every vertex v, fewest edges to get from s to v is { level[v] if v ssigned level else (no pth) prent pointers form shortest-pth tree = union of suh shortest pth for eh v = to find shortest pth, tke v, prent[v], prent[prent[v]], et., until s (or None) 6
7 MIT OpenCourseWre Introdution to Algorithms Fll 2011 For informtion out iting these mterils or our Terms of Use, visit:
8 Leture 14 Grphs II: DFS Fll 2011 Leture 14: Grphs II: Depth-First Serh Leture Overview Depth-First Serh Edge Clssifition Cyle Testing Topologil Sort Rell: grph serh: explore grph e.g., find pth from strt vertex s to desired vertex djeny lists: rry Adj of V linked lists For exmple: for eh vertex u V, Adj[u] stores u s neighors, i.e., {v V (u, v) E} (just outgoing edges if direted) Adj Figure 1: Adjeny Lists Bredth-first Serh (BFS): Explore level-y-level from s find shortest pths 1
9 Leture 14 Grphs II: DFS Fll 2011 Depth-First Serh (DFS) This is like exploring mze. s Figure 2: Depth-First Serh Frontier Depth First Serh Algorithm follow pth until you get stuk ktrk long redrums until reh unexplored neighor reursively explore reful not to repet vertex strt v finish v prent = {s: None} DFS-visit (V, Adj, s): for v in Adj [s]: if v not in prent: prent [v] = s DFS-visit (V, Adj, v) DFS (V, Adj) prent = { } for s in V: if s not in prent: prent [s] = None DFS-visit (V, Adj, s) } } serh from strt vertex s (only see stuff rehle from s) explore entire grph (ould do sme to extend BFS) Figure 3: Depth-First Serh Algorithm 2
10 Leture 14 Grphs II: DFS Fll 2011 Exmple forwrd edge S 1 1 S ross edge k edge d e f 3 7 k edge Figure 4: Depth-First Trversl Edge Clssifition tree edges (formed y prent) nontree edges k edge: to nestor forwrd edge: to desendnt ross edge (to nother sutree) Figure 5: Edge Clssifition to ompute this lssifition (k or not), mrk nodes for durtion they re on the stk only tree nd k edges in undireted grph Anlysis DFS-visit gets lled with vertex s only one (euse then prent[s] set) = time in DFS-visit = Adj[s] = O(E) s V DFS outer loop dds just O(V ) = O(V + E) time (liner time) 3
11 Leture 14 Grphs II: DFS Fll 2011 Cyle Detetion Grph G hs yle DFS hs k edge Proof (<=) tree edges is yle k edge: to tree nestor (=>) onsider first visit to yle: v 2 v 3 v k v 1 v 0 FIRST! efore visit to v i finishes, will visit v i+1 (& finish): will onsider edge (v i, v i+1 ) = visit v i+1 now or lredy did = efore visit to v 0 finishes, will visit v k (& didn t efore) = efore visit to v k (or v 0 ) finishes, will see (v k, v 0 ) s k edge Jo sheduling Given Direted Ayli Grph (DAG), where verties represent tsks & edges represent dependenies, order tsks without violting dependenies 4
12 Leture 14 Grphs II: DFS Fll 2011 G H I A B C F 1 D 6 E 5 Figure 6: Dependene Grph: DFS Finishing Times Soure: Soure = vertex with no inoming edges = shedulle t eginning (A,G,I) Attempt: BFS from eh soure: from A finds A, BH, C, F from D finds D, BE, CF slow... nd wrong! from G finds G, H from I finds I Topologil Sort Reverse of DFS finishing times (time t whih DFS-Visit(v) finishes) DFS-Visit(v)... order.ppend(v) order.reverse() 5
13 Leture 14 Grphs II: DFS Fll 2011 Corretness For ny edge (u, v) u ordered efore v, i.e., v finished efore u u v if u visited efore v: efore visit to u finishes, will visit v (vi (u, v) or otherwise) = v finishes efore u if v visited efore u: grph is yli = u nnot e rehed from v = visit to v finishes efore visiting u 6
14 MIT OpenCourseWre Introdution to Algorithms Fll 2011 For informtion out iting these mterils or our Terms of Use, visit:
COMP108 Algorithmic Foundations
Grph Theory Prudene Wong http://www.s.liv..uk/~pwong/tehing/omp108/201617 How to Mesure 4L? 3L 5L 3L ontiner & 5L ontiner (without mrk) infinite supply of wter You n pour wter from one ontiner to nother
More informationChapter 9. Greedy Technique. Copyright 2007 Pearson Addison-Wesley. All rights reserved.
Chpter 9 Greey Tehnique Copyright 2007 Person Aison-Wesley. All rights reserve. Greey Tehnique Construts solution to n optimiztion prolem piee y piee through sequene of hoies tht re: fesile lolly optiml
More informationV = set of vertices (vertex / node) E = set of edges (v, w) (v, w in V)
Definitions G = (V, E) V = set of verties (vertex / noe) E = set of eges (v, w) (v, w in V) (v, w) orere => irete grph (igrph) (v, w) non-orere => unirete grph igrph: w is jent to v if there is n ege from
More information10.2 Graph Terminology and Special Types of Graphs
10.2 Grph Terminology n Speil Types of Grphs Definition 1. Two verties u n v in n unirete grph G re lle jent (or neighors) in G iff u n v re enpoints of n ege e of G. Suh n ege e is lle inient with the
More informationLesson 4.4. Euler Circuits and Paths. Explore This
Lesson 4.4 Euler Ciruits nd Pths Now tht you re fmilir with some of the onepts of grphs nd the wy grphs onvey onnetions nd reltionships, it s time to egin exploring how they n e used to model mny different
More informationParadigm 5. Data Structure. Suffix trees. What is a suffix tree? Suffix tree. Simple applications. Simple applications. Algorithms
Prdigm. Dt Struture Known exmples: link tble, hep, Our leture: suffix tree Will involve mortize method tht will be stressed shortly in this ourse Suffix trees Wht is suffix tree? Simple pplitions History
More information12/9/14. CS151 Fall 20124Lecture (almost there) 12/6. Graphs. Seven Bridges of Königsberg. Leonard Euler
CS5 Fll 04Leture (lmost there) /6 Seven Bridges of Königserg Grphs Prof. Tny Berger-Wolf Leonrd Euler 707-783 Is it possile to wlk with route tht rosses eh ridge e Seven Bridges of Königserg Forget unimportnt
More informationAdjacency. Adjacency Two vertices u and v are adjacent if there is an edge connecting them. This is sometimes written as u v.
Terminology Adjeny Adjeny Two verties u nd v re djent if there is n edge onneting them. This is sometimes written s u v. v v is djent to nd ut not to. 2 / 27 Neighourhood Neighourhood The open neighourhood
More informationMITSUBISHI ELECTRIC RESEARCH LABORATORIES Cambridge, Massachusetts. Introduction to Matroids and Applications. Srikumar Ramalingam
Cmrige, Msshusetts Introution to Mtrois n Applitions Srikumr Rmlingm MERL mm//yy Liner Alger (,0,0) (0,,0) Liner inepenene in vetors: v, v2,..., For ll non-trivil we hve s v s v n s, s2,..., s n 2v2...
More informationGreedy Algorithm. Algorithm Fall Semester
Greey Algorithm Algorithm 0 Fll Semester Optimiztion prolems An optimiztion prolem is one in whih you wnt to fin, not just solution, ut the est solution A greey lgorithm sometimes works well for optimiztion
More informationCS553 Lecture Introduction to Data-flow Analysis 1
! Ide Introdution to Dt-flow nlysis!lst Time! Implementing Mrk nd Sweep GC!Tody! Control flow grphs! Liveness nlysis! Register llotion CS553 Leture Introdution to Dt-flow Anlysis 1 Dt-flow Anlysis! Dt-flow
More informationLecture 12 : Topological Spaces
Leture 12 : Topologil Spes 1 Topologil Spes Topology generlizes notion of distne nd loseness et. Definition 1.1. A topology on set X is olletion T of susets of X hving the following properties. 1. nd X
More informationOutline. CS38 Introduction to Algorithms. Graphs. Graphs. Graphs. Graph traversals
Outline CS38 Introution to Algorithms Leture 2 April 3, 2014 grph trversls (BFS, DFS) onnetivity topologil sort strongly onnete omponents heps n hepsort greey lgorithms April 3, 2014 CS38 Leture 2 2 Grphs
More informationCS 241 Week 4 Tutorial Solutions
CS 4 Week 4 Tutoril Solutions Writing n Assemler, Prt & Regulr Lnguges Prt Winter 8 Assemling instrutions utomtilly. slt $d, $s, $t. Solution: $d, $s, nd $t ll fit in -it signed integers sine they re 5-it
More informationLecture 8: Graph-theoretic problems (again)
COMP36111: Advned Algorithms I Leture 8: Grph-theoreti prolems (gin) In Prtt-Hrtmnn Room KB2.38: emil: iprtt@s.mn..uk 2017 18 Reding for this leture: Sipser: Chpter 7. A grph is pir G = (V, E), where V
More informationPattern Matching. Pattern Matching. Pattern Matching. Review of Regular Expressions
Pttern Mthing Pttern Mthing Some of these leture slides hve een dpted from: lgorithms in C, Roert Sedgewik. Gol. Generlize string serhing to inompletely speified ptterns. pplitions. Test if string or its
More informationToday. CS 188: Artificial Intelligence Fall Recap: Search. Example: Pancake Problem. Example: Pancake Problem. General Tree Search.
CS 88: Artificil Intelligence Fll 00 Lecture : A* Serch 9//00 A* Serch rph Serch Tody Heuristic Design Dn Klein UC Berkeley Multiple slides from Sturt Russell or Andrew Moore Recp: Serch Exmple: Pncke
More informationDistance vector protocol
istne vetor protool Irene Finohi finohi@i.unirom.it Routing Routing protool Gol: etermine goo pth (sequene of routers) thru network from soure to Grph strtion for routing lgorithms: grph noes re routers
More informationMa/CS 6b Class 1: Graph Recap
M/CS 6 Clss 1: Grph Recp By Adm Sheffer Course Detils Adm Sheffer. Office hour: Tuesdys 4pm. dmsh@cltech.edu TA: Victor Kstkin. Office hour: Tuesdys 7pm. 1:00 Mondy, Wednesdy, nd Fridy. http://www.mth.cltech.edu/~2014-15/2term/m006/
More informationWhat are suffix trees?
Suffix Trees 1 Wht re suffix trees? Allow lgorithm designers to store very lrge mount of informtion out strings while still keeping within liner spce Allow users to serch for new strings in the originl
More informationLesson6: Modeling the Web as a graph Unit5: Linear Algebra for graphs
Lesson6: Modeling the We s grph Unit5: Liner Alger for grphs Rene Pikhrdt Introdution to We Siene Prt 2 Emerging We Properties Rene Pikhrdt Institute CC-BY-SA-3. for We Siene nd Tehnologies Modeling the
More informationChapter 4 Fuzzy Graph and Relation
Chpter 4 Fuzzy Grph nd Reltion Grph nd Fuzzy Grph! Grph n G = (V, E) n V : Set of verties(node or element) n E : Set of edges An edge is pir (x, y) of verties in V.! Fuzzy Grph ~ n ( ~ G = V, E) n V :
More informationProblem Final Exam Set 2 Solutions
CSE 5 5 Algoritms nd nd Progrms Prolem Finl Exm Set Solutions Jontn Turner Exm - //05 0/8/0. (5 points) Suppose you re implementing grp lgoritm tt uses ep s one of its primry dt strutures. Te lgoritm does
More informationIf you are at the university, either physically or via the VPN, you can download the chapters of this book as PDFs.
Lecture 5 Wlks, Trils, Pths nd Connectedness Reding: Some of the mteril in this lecture comes from Section 1.2 of Dieter Jungnickel (2008), Grphs, Networks nd Algorithms, 3rd edition, which is ville online
More informationCS 340, Fall 2016 Sep 29th Exam 1 Note: in all questions, the special symbol ɛ (epsilon) is used to indicate the empty string.
CS 340, Fll 2016 Sep 29th Exm 1 Nme: Note: in ll questions, the speil symol ɛ (epsilon) is used to indite the empty string. Question 1. [10 points] Speify regulr expression tht genertes the lnguge over
More informationToday. Search Problems. Uninformed Search Methods. Depth-First Search Breadth-First Search Uniform-Cost Search
Uninformed Serch [These slides were creted by Dn Klein nd Pieter Abbeel for CS188 Intro to AI t UC Berkeley. All CS188 mterils re vilble t http://i.berkeley.edu.] Tody Serch Problems Uninformed Serch Methods
More informationMinimal Memory Abstractions
Miniml Memory Astrtions (As implemented for BioWre Corp ) Nthn Sturtevnt University of Alert GAMES Group Ferury, 7 Tlk Overview Prt I: Building Astrtions Minimizing memory requirements Performnes mesures
More informationSuffix Tries. Slides adapted from the course by Ben Langmead
Suffix Tries Slides dpted from the course y Ben Lngmed en.lngmed@gmil.com Indexing with suffixes Until now, our indexes hve een sed on extrcting sustrings from T A very different pproch is to extrct suffixes
More informationSolving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence Winter 2016
Solving Prolems y Serching CS 486/686: Introduction to Artificil Intelligence Winter 2016 1 Introduction Serch ws one of the first topics studied in AI - Newell nd Simon (1961) Generl Prolem Solver Centrl
More informationAnnouncements. CS 188: Artificial Intelligence Fall Recap: Search. Today. Example: Pancake Problem. Example: Pancake Problem
Announcements Project : erch It s live! Due 9/. trt erly nd sk questions. It s longer thn most! Need prtner? Come up fter clss or try Pizz ections: cn go to ny, ut hve priority in your own C 88: Artificil
More informationCSCI 446: Artificial Intelligence
CSCI 446: Artificil Intelligence Serch Instructor: Michele Vn Dyne [These slides were creted by Dn Klein nd Pieter Abbeel for CS188 Intro to AI t UC Berkeley. All CS188 mterils re vilble t http://i.berkeley.edu.]
More informationCS 551 Computer Graphics. Hidden Surface Elimination. Z-Buffering. Basic idea: Hidden Surface Removal
CS 55 Computer Grphis Hidden Surfe Removl Hidden Surfe Elimintion Ojet preision lgorithms: determine whih ojets re in front of others Uses the Pinter s lgorithm drw visile surfes from k (frthest) to front
More informationError Numbers of the Standard Function Block
A.2.2 Numers of the Stndrd Funtion Blok evlution The result of the logi opertion RLO is set if n error ours while the stndrd funtion lok is eing proessed. This llows you to rnh to your own error evlution
More informationSolving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence
Solving Prolems y Serching CS 486/686: Introduction to Artificil Intelligence 1 Introduction Serch ws one of the first topics studied in AI - Newell nd Simon (1961) Generl Prolem Solver Centrl component
More informationCMPUT101 Introduction to Computing - Summer 2002
CMPUT Introdution to Computing - Summer 22 %XLOGLQJ&RPSXWHU&LUFXLWV Chpter 4.4 3XUSRVH We hve looked t so fr how to uild logi gtes from trnsistors. Next we will look t how to uild iruits from logi gtes,
More informationΕΠΛ323 - Θεωρία και Πρακτική Μεταγλωττιστών
ΕΠΛ323 - Θωρία και Πρακτική Μταγλωττιστών Lecture 3 Lexicl Anlysis Elis Athnsopoulos elisthn@cs.ucy.c.cy Recognition of Tokens if expressions nd reltionl opertors if è if then è then else è else relop
More informationIntroduction to Algebra
INTRODUCTORY ALGEBRA Mini-Leture 1.1 Introdution to Alger Evlute lgeri expressions y sustitution. Trnslte phrses to lgeri expressions. 1. Evlute the expressions when =, =, nd = 6. ) d) 5 10. Trnslte eh
More informationMa/CS 6b Class 1: Graph Recap
M/CS 6 Clss 1: Grph Recp By Adm Sheffer Course Detils Instructor: Adm Sheffer. TA: Cosmin Pohot. 1pm Mondys, Wednesdys, nd Fridys. http://mth.cltech.edu/~2015-16/2term/m006/ Min ook: Introduction to Grph
More informationCS 221: Artificial Intelligence Fall 2011
CS 221: Artificil Intelligence Fll 2011 Lecture 2: Serch (Slides from Dn Klein, with help from Sturt Russell, Andrew Moore, Teg Grenger, Peter Norvig) Problem types! Fully observble, deterministic! single-belief-stte
More informationInternet Routing. IP Packet Format. IP Fragmentation & Reassembly. Principles of Internet Routing. Computer Networks 9/29/2014.
omputer Networks 9/29/2014 IP Pket Formt Internet Routing Ki Shen IP protool version numer heder length (words) for qulity of servie mx numer remining hops (deremented t eh router) upper lyer protool to
More informationCOMP 423 lecture 11 Jan. 28, 2008
COMP 423 lecture 11 Jn. 28, 2008 Up to now, we hve looked t how some symols in n lphet occur more frequently thn others nd how we cn sve its y using code such tht the codewords for more frequently occuring
More informationCS453 INTRODUCTION TO DATAFLOW ANALYSIS
CS453 INTRODUCTION TO DATAFLOW ANALYSIS CS453 Leture Register llotion using liveness nlysis 1 Introdution to Dt-flow nlysis Lst Time Register llotion for expression trees nd lol nd prm vrs Tody Register
More informationInformation Retrieval and Organisation
Informtion Retrievl nd Orgnistion Suffix Trees dpted from http://www.mth.tu.c.il/~himk/seminr02/suffixtrees.ppt Dell Zhng Birkeck, University of London Trie A tree representing set of strings { } eef d
More informationSuffix trees, suffix arrays, BWT
ALGORITHMES POUR LA BIO-INFORMATIQUE ET LA VISUALISATION COURS 3 Rluc Uricru Suffix trees, suffix rrys, BWT Bsed on: Suffix trees nd suffix rrys presenttion y Him Kpln Suffix trees course y Pco Gomez Liner-Time
More informationIn the last lecture, we discussed how valid tokens may be specified by regular expressions.
LECTURE 5 Scnning SYNTAX ANALYSIS We know from our previous lectures tht the process of verifying the syntx of the progrm is performed in two stges: Scnning: Identifying nd verifying tokens in progrm.
More informationConvex Hull Algorithms. Convex hull: basic facts
CG Leture D Conve Hull Algorithms Bsi fts Algorithms: Nïve, Gift wrpping, Grhm sn, Quik hull, Divide-nd-onquer Lower ound 3D Bsi fts Algorithms: Gift wrpping, Divide nd onquer, inrementl Conve hulls in
More informationComputational geometry
Leture 23 Computtionl geometry Supplementl reding in CLRS: Chpter 33 exept 33.3 There re mny importnt prolems in whih the reltionships we wish to nlyze hve geometri struture. For exmple, omputtionl geometry
More informationHonors Thesis: Investigating the Algebraic Properties of Cayley Digraphs
Honors Thesis: Investigting the Algebri Properties of Cyley Digrphs Alexis Byers, Wittenberg University Mthemtis Deprtment April 30, 2014 This pper utilizes Grph Theory to gin insight into the lgebri struture
More information2 Computing all Intersections of a Set of Segments Line Segment Intersection
15-451/651: Design & Anlysis of Algorithms Novemer 14, 2016 Lecture #21 Sweep-Line nd Segment Intersection lst chnged: Novemer 8, 2017 1 Preliminries The sweep-line prdigm is very powerful lgorithmic design
More informationDistributed Systems Principles and Paradigms
Distriuted Systems Priniples nd Prdigms Christoph Dorn Distriuted Systems Group, Vienn University of Tehnology.dorn@infosys.tuwien..t http://www.infosys.tuwien..t/stff/dorn Slides dpted from Mrten vn Steen,
More information10.5 Graphing Quadratic Functions
0.5 Grphing Qudrtic Functions Now tht we cn solve qudrtic equtions, we wnt to lern how to grph the function ssocited with the qudrtic eqution. We cll this the qudrtic function. Grphs of Qudrtic Functions
More informationFig.25: the Role of LEX
The Lnguge for Specifying Lexicl Anlyzer We shll now study how to uild lexicl nlyzer from specifiction of tokens in the form of list of regulr expressions The discussion centers round the design of n existing
More informationSimple strategy Computes shortest paths from the start note
Leture Notes for I500 Fall 2009 Fundamental Computer Conepts of Informatis by Xiaoqian Zhang (Instrutor: Predrag Radivoja) Last time: dynami programming Today: Elementary graph algorithm (textbook Chapter
More informationContainers: Queue and List
Continers: Queue n List Queue A ontiner in whih insertion is one t one en (the til) n eletion is one t the other en (the he). Also lle FIFO (First-In, First-Out) Jori Cortell n Jori Petit Deprtment of
More informationOutline. CS38 Introduction to Algorithms. Administrative Stuff. Administrative Stuff. Motivation/Overview. Administrative Stuff
Outline CS38 Introdution to Algorithms Leture 1 April 1, 2014 administrative stuff motivation and overview of the ourse stale mathings example graphs, representing graphs graph traversals (BFS, DFS) onnetivity,
More informationTight triangulations: a link between combinatorics and topology
Tight tringultions: link between ombintoris nd topology Jonthn Spreer Melbourne, August 15, 2016 Topologil mnifolds (Geometri) Topology is study of mnifolds (surfes) up to ontinuous deformtion Complited
More informationCS311H: Discrete Mathematics. Graph Theory IV. A Non-planar Graph. Regions of a Planar Graph. Euler s Formula. Instructor: Işıl Dillig
CS311H: Discrete Mthemtics Grph Theory IV Instructor: Işıl Dillig Instructor: Işıl Dillig, CS311H: Discrete Mthemtics Grph Theory IV 1/25 A Non-plnr Grph Regions of Plnr Grph The plnr representtion of
More informationChapter 22. Elementary Graph Algorithms
Graph Algorithms - Spring 2011 Set 7. Lecturer: Huilan Chang Reference: (1) Cormen, Leiserson, Rivest, and Stein, Introduction to Algorithms, 2nd Edition, The MIT Press. (2) Lecture notes from C. Y. Chen
More informationIntroduction. Example
OMS0 Introution isjoint sets n minimum spnning trees In this leture we will strt by isussing t struture use for mintining isjoint subsets of some bigger set. This hs number of pplitions, inluing to mintining
More informationCalculus Differentiation
//007 Clulus Differentition Jeffrey Seguritn person in rowot miles from the nerest point on strit shoreline wishes to reh house 6 miles frther down the shore. The person n row t rte of mi/hr nd wlk t rte
More informationPremaster Course Algorithms 1 Chapter 6: Shortest Paths. Christian Scheideler SS 2018
Premster Course Algorithms Chpter 6: Shortest Pths Christin Scheieler SS 8 Bsic Grph Algorithms Overview: Shortest pths in DAGs Dijkstr s lgorithm Bellmn-For lgorithm Johnson s metho SS 8 Chpter 6 Shortest
More informationCOSC 6374 Parallel Computation. Non-blocking Collective Operations. Edgar Gabriel Fall Overview
COSC 6374 Prllel Computtion Non-loking Colletive Opertions Edgr Griel Fll 2014 Overview Impt of olletive ommunition opertions Impt of ommunition osts on Speedup Crtesin stenil ommunition All-to-ll ommunition
More informationCSEP 573 Artificial Intelligence Winter 2016
CSEP 573 Artificil Intelligence Winter 2016 Luke Zettlemoyer Problem Spces nd Serch slides from Dn Klein, Sturt Russell, Andrew Moore, Dn Weld, Pieter Abbeel, Ali Frhdi Outline Agents tht Pln Ahed Serch
More informationDistributed Systems Principles and Paradigms. Chapter 11: Distributed File Systems
Distriuted Systems Priniples nd Prdigms Mrten vn Steen VU Amsterdm, Dept. Computer Siene steen@s.vu.nl Chpter 11: Distriuted File Systems Version: Deemer 10, 2012 2 / 14 Distriuted File Systems Distriuted
More informationGENG2140 Modelling and Computer Analysis for Engineers
GENG4 Moelling n Computer Anlysis or Engineers Letures 9 & : Gussin qurture Crete y Grn Romn Joles, PhD Shool o Mehnil Engineering, UWA GENG4 Content Deinition o Gussin qurture Computtion o weights n points
More informationInter-domain Routing
COMP 631: NETWORKED & DISTRIBUTED SYSTEMS Inter-domin Routing Jsleen Kur Fll 2016 1 Internet-sle Routing: Approhes DV nd link-stte protools do not sle to glol Internet How to mke routing slle? Exploit
More informationReducing a DFA to a Minimal DFA
Lexicl Anlysis - Prt 4 Reducing DFA to Miniml DFA Input: DFA IN Assume DFA IN never gets stuck (dd ded stte if necessry) Output: DFA MIN An equivlent DFA with the minimum numer of sttes. Hrry H. Porter,
More informationLexical Analysis: Constructing a Scanner from Regular Expressions
Lexicl Anlysis: Constructing Scnner from Regulr Expressions Gol Show how to construct FA to recognize ny RE This Lecture Convert RE to n nondeterministic finite utomton (NFA) Use Thompson s construction
More informationBayesian Networks: Directed Markov Properties (Cont d) and Markov Equivalent DAGs
Byesin Networks: Direte Mrkov Properties (Cont ) n Mrkov Equivlent DAGs Huizhen Yu jney.yu@s.helsinki.fi Dept. Computer Siene, Univ. of Helsinki Proilisti Moels, Spring, 2010 Huizhen Yu (U.H.) Byesin Networks:
More informationImplementing Automata. CSc 453. Compilers and Systems Software. 4 : Lexical Analysis II. Department of Computer Science University of Arizona
Implementing utomt Sc 5 ompilers nd Systems Softwre : Lexicl nlysis II Deprtment of omputer Science University of rizon collerg@gmil.com opyright c 009 hristin ollerg NFs nd DFs cn e hrd-coded using this
More informationMidterm Exam CSC October 2001
Midterm Exm CSC 173 23 Otoer 2001 Diretions This exm hs 8 questions, severl of whih hve suprts. Eh question indites its point vlue. The totl is 100 points. Questions 5() nd 6() re optionl; they re not
More informationLINX MATRIX SWITCHERS FIRMWARE UPDATE INSTRUCTIONS FIRMWARE VERSION
Overview LINX MATRIX SWITCHERS FIRMWARE UPDATE INSTRUCTIONS FIRMWARE VERSION 4.4.1.0 Due to the omplex nture of this updte, plese fmilirize yourself with these instrutions nd then ontt RGB Spetrum Tehnil
More informationΕΠΛ323 - Θεωρία και Πρακτική Μεταγλωττιστών. Lecture 3b Lexical Analysis Elias Athanasopoulos
ΕΠΛ323 - Θωρία και Πρακτική Μταγλωττιστών Lecture 3 Lexicl Anlysis Elis Athnsopoulos elisthn@cs.ucy.c.cy RecogniNon of Tokens if expressions nd relnonl opertors if è if then è then else è else relop è
More informationDuality in linear interval equations
Aville online t http://ijim.sriu..ir Int. J. Industril Mthemtis Vol. 1, No. 1 (2009) 41-45 Dulity in liner intervl equtions M. Movhedin, S. Slhshour, S. Hji Ghsemi, S. Khezerloo, M. Khezerloo, S. M. Khorsny
More information[Prakash* et al., 5(8): August, 2016] ISSN: IC Value: 3.00 Impact Factor: 4.116
[Prksh* et l 58: ugust 6] ISSN: 77-9655 I Vlue: Impt Ftor: 6 IJESRT INTERNTIONL JOURNL OF ENGINEERING SIENES & RESERH TEHNOLOGY SOME PROPERTIES ND THEOREM ON FUZZY SU-TRIDENT DISTNE Prveen Prksh* M Geeth
More informationElementary Graph Algorithms. Ref: Chapter 22 of the text by Cormen et al. Representing a graph:
Elementary Graph Algorithms Ref: Chapter 22 of the text by Cormen et al. Representing a graph: Graph G(V, E): V set of nodes (vertices); E set of edges. Notation: n = V and m = E. (Vertices are numbered
More informationType Checking. Roadmap (Where are we?) Last lecture Context-sensitive analysis. This lecture Type checking. Symbol tables
Type Cheking Rodmp (Where re we?) Lst leture Contet-sensitie nlysis Motition Attriute grmmrs Ad ho Synt-direted trnsltion This leture Type heking Type systems Using synt direted trnsltion Symol tles Leil
More informationUnion-Find Problem. Using Arrays And Chains. A Set As A Tree. Result Of A Find Operation
Union-Find Problem Given set {,,, n} of n elements. Initilly ech element is in different set. ƒ {}, {},, {n} An intermixed sequence of union nd find opertions is performed. A union opertion combines two
More informationAI Adjacent Fields. This slide deck courtesy of Dan Klein at UC Berkeley
AI Adjcent Fields Philosophy: Logic, methods of resoning Mind s physicl system Foundtions of lerning, lnguge, rtionlity Mthemtics Forml representtion nd proof Algorithms, computtion, (un)decidility, (in)trctility
More informationUTMC APPLICATION NOTE UT1553B BCRT TO INTERFACE PSEUDO-DUAL-PORT RAM ARCHITECTURE INTRODUCTION ARBITRATION DETAILS DESIGN SELECTIONS
UTMC APPLICATION NOTE UT1553B BCRT TO 80186 INTERFACE INTRODUCTION The UTMC UT1553B BCRT is monolithi CMOS integrte iruit tht provies omprehensive Bus Controller n Remote Terminl funtions for MIL-STD-
More informationINTEGRATED WORKFLOW ART DIRECTOR
ART DIRECTOR Progrm Resoures INTEGRATED WORKFLOW PROGRAM PLANNING PHASE In this workflow phse proess, you ollorte with the Progrm Mnger, the Projet Mnger, nd the Art Speilist/ Imge Led to updte the resoures
More informationTries. Yufei Tao KAIST. April 9, Y. Tao, April 9, 2013 Tries
Tries Yufei To KAIST April 9, 2013 Y. To, April 9, 2013 Tries In this lecture, we will discuss the following exct mtching prolem on strings. Prolem Let S e set of strings, ech of which hs unique integer
More informationCOSC 6374 Parallel Computation. Communication Performance Modeling (II) Edgar Gabriel Fall Overview. Impact of communication costs on Speedup
COSC 6374 Prllel Computtion Communition Performne Modeling (II) Edgr Griel Fll 2015 Overview Impt of ommunition osts on Speedup Crtesin stenil ommunition All-to-ll ommunition Impt of olletive ommunition
More informationTo access your mailbox from inside your organization. For assistance, call:
2001 Ative Voie, In. All rights reserved. First edition 2001. Proteted y one or more of the following United Sttes ptents:,070,2;,3,90;,88,0;,33,102;,8,0;,81,0;,2,7;,1,0;,90,88;,01,11. Additionl U.S. nd
More informationSoftware Configuration Management
Softwre Configurtion Mngement Leture: Introdution SCM Chpters: 1, 2 nd 3 René Krikhr Niels Veermn Leture Objetives Lern bout SCM nd history of SCM Lern the reltion between SCM nd Softwre development proess
More informationCSI 604 Elementary Graph Algorithms
CSI 604 Elementary Graph Algorithms Ref: Chapter 22 of the text by Cormen et al. (Second edition) 1 / 25 Graphs: Basic Definitions Undirected Graph G(V, E): V is set of nodes (or vertices) and E is the
More informationStack. A list whose end points are pointed by top and bottom
4. Stck Stck A list whose end points re pointed by top nd bottom Insertion nd deletion tke plce t the top (cf: Wht is the difference between Stck nd Arry?) Bottom is constnt, but top grows nd shrinks!
More informationCSc 453. Compilers and Systems Software. 4 : Lexical Analysis II. Department of Computer Science University of Arizona
CSc 453 Compilers nd Systems Softwre 4 : Lexicl Anlysis II Deprtment of Computer Science University of Arizon collerg@gmil.com Copyright c 2009 Christin Collerg Implementing Automt NFAs nd DFAs cn e hrd-coded
More informationFall 2018 Midterm 1 October 11, ˆ You may not ask questions about the exam except for language clarifications.
15-112 Fll 2018 Midterm 1 October 11, 2018 Nme: Andrew ID: Recittion Section: ˆ You my not use ny books, notes, extr pper, or electronic devices during this exm. There should be nothing on your desk or
More informationcisc1110 fall 2010 lecture VI.2 call by value function parameters another call by value example:
cisc1110 fll 2010 lecture VI.2 cll y vlue function prmeters more on functions more on cll y vlue nd cll y reference pssing strings to functions returning strings from functions vrile scope glol vriles
More informationCS201 Discussion 10 DRAWTREE + TRIES
CS201 Discussion 10 DRAWTREE + TRIES DrwTree First instinct: recursion As very generic structure, we could tckle this problem s follows: drw(): Find the root drw(root) drw(root): Write the line for the
More informationSummer Review Packet For Algebra 2 CP/Honors
Summer Review Pcket For Alger CP/Honors Nme Current Course Mth Techer Introduction Alger uilds on topics studied from oth Alger nd Geometr. Certin topics re sufficientl involved tht the cll for some review
More informationCHAPTER 13 GRAPH ALGORITHMS
CHPTER 13 GRPH LGORITHMS SFO LX ORD DFW 1 CKNOWLEDGEMENT: THESE SLIDES RE DPTED FROM SLIDES PROVIDED WITH DT STRUCTURES ND LGORITHMS IN C++, GOODRICH, TMSSI ND MOUNT (WILEY 2004) ND SLIDES FROM JORY DENNY
More informationRegular Expression Matching with Multi-Strings and Intervals. Philip Bille Mikkel Thorup
Regulr Expression Mtching with Multi-Strings nd Intervls Philip Bille Mikkel Thorup Outline Definition Applictions Previous work Two new problems: Multi-strings nd chrcter clss intervls Algorithms Thompson
More informationAnnouncements. CS 188: Artificial Intelligence Fall Recap: Search. Today. General Tree Search. Uniform Cost. Lecture 3: A* Search 9/4/2007
CS 88: Artificil Intelligence Fll 2007 Lecture : A* Serch 9/4/2007 Dn Klein UC Berkeley Mny slides over the course dpted from either Sturt Russell or Andrew Moore Announcements Sections: New section 06:
More informationMcAfee Web Gateway
Relese Notes Revision C MAfee We Gtewy 7.6.2.11 Contents Aout this relese Enhnement Resolved issues Instlltion instrutions Known issues Additionl informtion Find produt doumenttion Aout this relese This
More informationThe Greedy Method. The Greedy Method
Lists nd Itertors /8/26 Presenttion for use with the textook, Algorithm Design nd Applictions, y M. T. Goodrich nd R. Tmssi, Wiley, 25 The Greedy Method The Greedy Method The greedy method is generl lgorithm
More informationIntroduction to Algorithms. Lecture 11. Prof. Patrick Jaillet
6.006- Introduction to Algorithms Lecture 11 Prof. Patrick Jaillet Lecture Overview Searching I: Graph Search and Representations Readings: CLRS 22.1-22.3, B.4 Graphs G=(V,E) V a set of vertices usually
More informationCompilers. Topic 4. The Symbol Table and Block Structure PART II. Mick O Donnell: Alfonso Ortega:
Compilers Topi 4 The ol Tle nd Blok Struture PART II Mik O Donnell: mihel.odonnell@um.es Alfonso Orteg: lfonso.orteg@um.es Topi 2: Blok Struture 2 1 ol tles with lok strutures Blok Struture Progrmming
More informationCOMBINATORIAL PATTERN MATCHING
COMBINATORIAL PATTERN MATCHING Genomic Repets Exmple of repets: ATGGTCTAGGTCCTAGTGGTC Motivtion to find them: Genomic rerrngements re often ssocited with repets Trce evolutionry secrets Mny tumors re chrcterized
More information