Announcements. CS 188: Artificial Intelligence Fall Recap: Search. Today. General Tree Search. Uniform Cost. Lecture 3: A* Search 9/4/2007

Size: px
Start display at page:

Download "Announcements. CS 188: Artificial Intelligence Fall Recap: Search. Today. General Tree Search. Uniform Cost. Lecture 3: A* Search 9/4/2007"

Transcription

1 CS 88: Artificil Intelligence Fll 2007 Lecture : A* Serch 9/4/2007 Dn Klein UC Berkeley Mny slides over the course dpted from either Sturt Russell or Andrew Moore Announcements Sections: New section 06: Tu 5-6pm You cn go to ny section, if there s spce Sections strt this week Homework Project on the we, due 9/2 New written homework formt: One or two questions hnded out end of section (nd online) Due the next week in section, grded check / no check Ech ssignment % of grde, cp of 0%, so cn skip t lest one week, depends on how mny there re Solve in groups of ny size, write up lone A* Serch Heuristic Design Locl Serch Tody Recp: Serch Serch prolems: Sttes (configurtions of the world) Successor functions, costs, strt nd gol tests Serch trees: Nodes: represent pths / plns Pths hve costs (sum of ction costs) Strtegies differ (only) in fringe mngement enerl Tree Serch Uniform Cost Strtegy: expnd lowest pth cost The good: UCS is complete nd optiml! c c 2 c Expnding includes incrementing the pth cost! The d: Explores options in every direction No informtion out gol loction Strt ol

2 Best First Exmple: Heuristic Function Strtegy: expnd nodes which pper closest to gol Heuristic: function which mps sttes to distnce A common cse: Best-first tkes you stright to the (wrong) gol Worst- cse: like dly- guided DFS h(x) Comining UCS nd reedy Uniform-cost orders y pth cost, or ckwrd cost g(n) Best-first orders y gol proximity, or forwrd cost h(n) 2 S d h=5 2 h=6 h=2 h=0 c h=5 h=4 A* Serch orders y the sum: f(n) = g(n) + h(n) 5 e h= When should A* terminte? Should we stop when we enqueue gol? 2 A 2 S h = 2 h = B 2 h = No: only stop when we dequeue gol h = 0 Exmple: Teg renger Is A* Optiml? Admissile Heuristics A h = 6 A heuristic is dmissile (optimistic) if: S h = 7 h = 0 where is the true cost to nerest gol 5 Wht went wrong? Actul d gol cost > estimted good gol cost We need estimtes to e less thn ctul costs! E.g. Eucliden distnce on mp prolem Coming up with dmissile heuristics is most of wht s involved in using A* in prctice. 2

3 Optimlity of A*: Blocking UCS vs A* Contours Proof: Wht could go wrong? We d hve to hve to pop suoptiml gol off the fringe efore * This cn t hppen: Imgine suoptiml gol is on the queue Some node n which is supth of * must e on the fringe (why?) n will e popped efore Uniform-cost expnded in ll directions A* expnds minly towrd the gol, ut does hedge its ets to ensure optimlity Strt Strt ol ol Properties of A* Admissile Heuristics Uniform- Cost A* Most of the work is in coming up with dmissile heuristics Indmissile heuristics re often quite effective (especilly when you hve no choice) Very common hck: use α x h(n) for dmissile h, α > to generte fster ut less optiml indmissile h from dmissile h Exmple: 8 Puzzle 8 Puzzle I Numer of tiles misplced? Why is it dmissile? Wht re the sttes? Wht re the ctions? Wht sttes cn I rech from the strt stte? Wht should the costs e? h(strt) = 8 This is relxedprolem heuristic ID TILES Averge nodes expnded when optiml pth hs length 4 steps 8 steps 2 6, steps.6 x

4 8 Puzzle II 8 Puzzle III Wht if we hd n esier 8-puzzle where ny tile could slide ny direction t ny time, ignoring other tiles? Totl Mnhttn distnce Why dmissile? h(strt) = TILES = 8 MAN- HATTAN Averge nodes expnded when optiml pth hs length 4 steps 2 8 steps steps How out using the ctul cost s heuristic? Would it e dmissile? Would we sve on nodes? Wht s wrong with it? With A*: trde-off etween qulity of estimte nd work per node! Trivil Heuristics, Dominnce Dominnce: h h c if Heuristics form semi-lttice: Mx of dmissile heuristics is dmissile Trivil heuristics Bottom of lttice is the zero heuristic (wht does this give us?) Top of lttice is the exct heuristic Course Scheduling From the university s perspective: Set of courses {c, c 2, c n } Set of room / times {r, r 2, r n } Ech piring (c k, r m ) hs cost w km Wht s the est ssignment of courses to rooms? Sttes: list of pirings Actions: dd legl piring Costs: cost of the new piring Admissile heuristics? (Who cn think of cs70 nswer to this prolem?) Other A* Applictions Pthing / routing prolems Resource plnning prolems Root motion plnning Lnguge nlysis Mchine trnsltion Speech recognition Tree Serch: Extr Work? Filure to detect repeted sttes cn cuse exponentilly more work. Why? 4

5 rph Serch In BFS, for exmple, we shouldn t other expnding the circled nodes (why?) rph Serch Very simple fix: never expnd stte twice S d e p c e h r q h r p q f p q f q c q c Cn this wreck completeness? Optimlity? Optimlity of A* rph Serch Consider wht A* does: Expnds nodes in incresing totl f vlue (f-contours) Proof ide: optiml gols hve lower f vlue, so get expnded first We mde stronger ssumption thn in the lst proof Wht? Consistency Wit, how do we know we expnd in incresing f vlue? Couldn t we pop some node n, nd find its child n to hve lower f vlue? YES: h = 0 h = 8 B g = 0 Wht cn we ssume to prevent these inversions? Consistency: A h = 0 Rel cost lwys exceeds reduction in heuristic Optimlity Tree serch: A* optiml if heuristic is dmissile (nd nonnegtive) UCS is specil cse (h = 0) rph serch: A* optiml if heuristic is consistent UCS optiml (h = 0 is consistent) In generl, nturl dmissile heuristics tend to e consistent Summry: A* A* uses oth ckwrd costs nd (estimtes of) forwrd costs A* is optiml with dmissile heuristics Heuristic design is key: often use relxed prolems 5

6 Lrge Scle Prolems Limited Memory Options Wht sttes get expnded? All sttes with f-cost less thn optiml gol cost How fr in every direction will this e? Intuition: depth grows like the heuristic gp : h(strt) g(gol) p usully t lest liner in prolem size Work exponentil in depth In huge prolems, often A* isn t enough Stte spce just too ig Cn t visit ll sttes with f less thn optiml Often, cn t even store the entire fringe Solutions Better heuristics Bem serch (limited fringe size) reedy hill-climing (fringe size = ) Strt ol Hill-Climing Serch: Only est node kept round, no fringe! Usully prioritize successor choice y h (greedy hill climing) Compre to greedy cktrcking, which still hs fringe Bem Serch (Limited Memory Serch) In etween: keep K nodes in fringe Dump lowest priority nodes s needed Cn prioritize y h lone (greedy em serch), or h+g (limited memory A*) Why not pplied to UCS? We ll return to em serch lter No gurntees once you limit the fringe size! 6

Today. CS 188: Artificial Intelligence Fall Recap: Search. Example: Pancake Problem. Example: Pancake Problem. General Tree Search.

Today. CS 188: Artificial Intelligence Fall Recap: Search. Example: Pancake Problem. Example: Pancake Problem. General Tree Search. CS 88: Artificil Intelligence Fll 00 Lecture : A* Serch 9//00 A* Serch rph Serch Tody Heuristic Design Dn Klein UC Berkeley Multiple slides from Sturt Russell or Andrew Moore Recp: Serch Exmple: Pncke

More information

Announcements. CS 188: Artificial Intelligence Fall Recap: Search. Today. Example: Pancake Problem. Example: Pancake Problem

Announcements. CS 188: Artificial Intelligence Fall Recap: Search. Today. Example: Pancake Problem. Example: Pancake Problem Announcements Project : erch It s live! Due 9/. trt erly nd sk questions. It s longer thn most! Need prtner? Come up fter clss or try Pizz ections: cn go to ny, ut hve priority in your own C 88: Artificil

More information

CS 221: Artificial Intelligence Fall 2011

CS 221: Artificial Intelligence Fall 2011 CS 221: Artificil Intelligence Fll 2011 Lecture 2: Serch (Slides from Dn Klein, with help from Sturt Russell, Andrew Moore, Teg Grenger, Peter Norvig) Problem types! Fully observble, deterministic! single-belief-stte

More information

CSEP 573 Artificial Intelligence Winter 2016

CSEP 573 Artificial Intelligence Winter 2016 CSEP 573 Artificil Intelligence Winter 2016 Luke Zettlemoyer Problem Spces nd Serch slides from Dn Klein, Sturt Russell, Andrew Moore, Dn Weld, Pieter Abbeel, Ali Frhdi Outline Agents tht Pln Ahed Serch

More information

Today. Search Problems. Uninformed Search Methods. Depth-First Search Breadth-First Search Uniform-Cost Search

Today. Search Problems. Uninformed Search Methods. Depth-First Search Breadth-First Search Uniform-Cost Search Uninformed Serch [These slides were creted by Dn Klein nd Pieter Abbeel for CS188 Intro to AI t UC Berkeley. All CS188 mterils re vilble t http://i.berkeley.edu.] Tody Serch Problems Uninformed Serch Methods

More information

Solving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence Winter 2016

Solving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence Winter 2016 Solving Prolems y Serching CS 486/686: Introduction to Artificil Intelligence Winter 2016 1 Introduction Serch ws one of the first topics studied in AI - Newell nd Simon (1961) Generl Prolem Solver Centrl

More information

Solving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence

Solving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence Solving Prolems y Serching CS 486/686: Introduction to Artificil Intelligence 1 Introduction Serch ws one of the first topics studied in AI - Newell nd Simon (1961) Generl Prolem Solver Centrl component

More information

CSCI 446: Artificial Intelligence

CSCI 446: Artificial Intelligence CSCI 446: Artificil Intelligence Serch Instructor: Michele Vn Dyne [These slides were creted by Dn Klein nd Pieter Abbeel for CS188 Intro to AI t UC Berkeley. All CS188 mterils re vilble t http://i.berkeley.edu.]

More information

Search Gone Wrong? CS 188: Artificial Intelligence Fall Today. Announcements. General Tree Search. Recap: Search. Lecture 3: A* Search 9/3/2009

Search Gone Wrong? CS 188: Artificial Intelligence Fall Today. Announcements. General Tree Search. Recap: Search. Lecture 3: A* Search 9/3/2009 C 88: Artiicil Intelligence Fll 009 erch one Wrong? Lecture : A* erch 9//009 Pieter Aeel UC Berkeley Mny slides rom Dn Klein Announcements Assignments: Project 0 (Python tutoril): due Fridy /8 t 4:59m

More information

CS 188: Artificial Intelligence Fall Search Gone Wrong?

CS 188: Artificial Intelligence Fall Search Gone Wrong? CS 188: Artificial Intelligence Fall 2009 Lecture 3: A* Search 9/3/2009 Pieter Aeel UC Berkeley Many slides from Dan Klein Search Gone Wrong? 1 Announcements Assignments: Project 0 (Python tutorial): due

More information

Uninformed Search. Hal Daumé III. Computer Science University of Maryland CS 421: Introduction to Artificial Intelligence 31 Jan 2012

Uninformed Search. Hal Daumé III. Computer Science University of Maryland CS 421: Introduction to Artificial Intelligence 31 Jan 2012 1 Hl Dumé III (me@hl3.nme) Uninformed Serch Hl Dumé III Comuter Science University of Mrylnd me@hl3.nme CS 421: Introduction to Artificil Intelligence 31 Jn 2012 Mny slides courtesy of Dn Klein, Sturt

More information

Today. Informed Search. Graph Search. Heuristics Greedy Search A* Search

Today. Informed Search. Graph Search. Heuristics Greedy Search A* Search Informed Search [These slides were created by Dan Klein and Pieter Abbeel for CS188 Intro to AI at UC Berkeley. All CS188 materials are available at http://ai.berkeley.edu.] Today Informed Search Heuristics

More information

AI Adjacent Fields. This slide deck courtesy of Dan Klein at UC Berkeley

AI Adjacent Fields. This slide deck courtesy of Dan Klein at UC Berkeley AI Adjcent Fields Philosophy: Logic, methods of resoning Mind s physicl system Foundtions of lerning, lnguge, rtionlity Mthemtics Forml representtion nd proof Algorithms, computtion, (un)decidility, (in)trctility

More information

CE 473: Artificial Intelligence. Autumn 2011

CE 473: Artificial Intelligence. Autumn 2011 CE 473: Artificial Intelligence Autumn 2011 A* Search Luke Zettlemoyer Based on slides from Dan Klein Multiple slides from Stuart Russell or Andrew Moore Today A* Search Heuristic Design Graph search Recap:

More information

Announcements. CS 188: Artificial Intelligence

Announcements. CS 188: Artificial Intelligence Announcements Projects: Looking for project partners? --- Come to front after lecture. Try pair programming, not divide-and-conquer Account forms available up front during break and after lecture Assignments

More information

CS 343H: Artificial Intelligence

CS 343H: Artificial Intelligence CS 343H: Artificial Intelligence Lecture 4: Informed Search 1/23/2014 Slides courtesy of Dan Klein at UC-Berkeley Unless otherwise noted Today Informed search Heuristics Greedy search A* search Graph search

More information

CS 343: Artificial Intelligence

CS 343: Artificial Intelligence CS 343: Artificial Intelligence Informed Search Prof. Scott Niekum University of Texas at Austin [These slides based on ones created by Dan Klein and Pieter Abbeel for CS188 Intro to AI at UC Berkeley.

More information

CSCI 446: Artificial Intelligence

CSCI 446: Artificial Intelligence CSCI 446: Artificial Intelligence Informed Search Instructor: Michele Van Dyne [These slides were created by Dan Klein and Pieter Abbeel for CS188 Intro to AI at UC Berkeley. All CS188 materials are available

More information

CS 188: Artificial Intelligence

CS 188: Artificial Intelligence CS 188: Artificial Intelligence Today Informed Search Informed Search Heuristics Greedy Search A* Search Instructor: Marco Alvarez University of Rhode Island (These slides were created/modified by Dan

More information

Artificial Intelligence Informed Search

Artificial Intelligence Informed Search Artificial Intelligence Informed Search Instructors: David Suter and Qince Li Course Delivered @ Harbin Institute of Technology [Many slides adapted from those created by Dan Klein and Pieter Abbeel for

More information

Informed Search A* Algorithm

Informed Search A* Algorithm Informed Search A* Algorithm CE417: Introduction to Artificial Intelligence Sharif University of Technology Spring 2018 Soleymani Artificial Intelligence: A Modern Approach, Chapter 3 Most slides have

More information

CS 188: Artificial Intelligence Fall 2008

CS 188: Artificial Intelligence Fall 2008 CS 188: Artificil Intelligence Fll 2008 Lecture 2: Queue-Bsed Serc 9/2/2008 Dn Klein UC Berkeley Mny slides from eiter Sturt Russell or Andrew Moore Announcements Written ssignments: One mini-omework ec

More information

Heuristic Search. Rob Platt Northeastern University. Some images and slides are used from: AIMA

Heuristic Search. Rob Platt Northeastern University. Some images and slides are used from: AIMA Heuristic Search Rob Platt Northeastern University Some images and slides are used from: AIMA Recap: What is graph search? Start state Goal state Graph search: find a path from start to goal what are the

More information

COMP 423 lecture 11 Jan. 28, 2008

COMP 423 lecture 11 Jan. 28, 2008 COMP 423 lecture 11 Jn. 28, 2008 Up to now, we hve looked t how some symols in n lphet occur more frequently thn others nd how we cn sve its y using code such tht the codewords for more frequently occuring

More information

Ma/CS 6b Class 1: Graph Recap

Ma/CS 6b Class 1: Graph Recap M/CS 6 Clss 1: Grph Recp By Adm Sheffer Course Detils Adm Sheffer. Office hour: Tuesdys 4pm. dmsh@cltech.edu TA: Victor Kstkin. Office hour: Tuesdys 7pm. 1:00 Mondy, Wednesdy, nd Fridy. http://www.mth.cltech.edu/~2014-15/2term/m006/

More information

2 Computing all Intersections of a Set of Segments Line Segment Intersection

2 Computing all Intersections of a Set of Segments Line Segment Intersection 15-451/651: Design & Anlysis of Algorithms Novemer 14, 2016 Lecture #21 Sweep-Line nd Segment Intersection lst chnged: Novemer 8, 2017 1 Preliminries The sweep-line prdigm is very powerful lgorithmic design

More information

521495A: Artificial Intelligence

521495A: Artificial Intelligence 521495A: Artificial Intelligence Informed Search Lectured by Abdenour Hadid Adjunct Professor, CMVS, University of Oulu Slides adopted from http://ai.berkeley.edu Today Informed Search Heuristics Greedy

More information

Tries. Yufei Tao KAIST. April 9, Y. Tao, April 9, 2013 Tries

Tries. Yufei Tao KAIST. April 9, Y. Tao, April 9, 2013 Tries Tries Yufei To KAIST April 9, 2013 Y. To, April 9, 2013 Tries In this lecture, we will discuss the following exct mtching prolem on strings. Prolem Let S e set of strings, ech of which hs unique integer

More information

CS 5522: Artificial Intelligence II

CS 5522: Artificial Intelligence II CS 5522: Artificial Intelligence II Search Algorithms Instructor: Wei Xu Ohio State University [These slides were adapted from CS188 Intro to AI at UC Berkeley.] Today Agents that Plan Ahead Search Problems

More information

Heuristic Search. Robert Platt Northeastern University. Some images and slides are used from: 1. CS188 UC Berkeley 2. RN, AIMA

Heuristic Search. Robert Platt Northeastern University. Some images and slides are used from: 1. CS188 UC Berkeley 2. RN, AIMA Heuristic Search Robert Platt Northeastern University Some images and slides are used from: 1. CS188 UC Berkeley 2. RN, AIMA Recap: What is graph search? Start state Goal state Graph search: find a path

More information

Ma/CS 6b Class 1: Graph Recap

Ma/CS 6b Class 1: Graph Recap M/CS 6 Clss 1: Grph Recp By Adm Sheffer Course Detils Instructor: Adm Sheffer. TA: Cosmin Pohot. 1pm Mondys, Wednesdys, nd Fridys. http://mth.cltech.edu/~2015-16/2term/m006/ Min ook: Introduction to Grph

More information

COMBINATORIAL PATTERN MATCHING

COMBINATORIAL PATTERN MATCHING COMBINATORIAL PATTERN MATCHING Genomic Repets Exmple of repets: ATGGTCTAGGTCCTAGTGGTC Motivtion to find them: Genomic rerrngements re often ssocited with repets Trce evolutionry secrets Mny tumors re chrcterized

More information

CS481: Bioinformatics Algorithms

CS481: Bioinformatics Algorithms CS481: Bioinformtics Algorithms Cn Alkn EA509 clkn@cs.ilkent.edu.tr http://www.cs.ilkent.edu.tr/~clkn/teching/cs481/ EXACT STRING MATCHING Fingerprint ide Assume: We cn compute fingerprint f(p) of P in

More information

Graphs vs trees up front; use grid too; discuss for BFS, DFS, IDS, UCS Cut back on A* optimality detail; a bit more on importance of heuristics,

Graphs vs trees up front; use grid too; discuss for BFS, DFS, IDS, UCS Cut back on A* optimality detail; a bit more on importance of heuristics, Graphs vs trees up front; use grid too; discuss for BFS, DFS, IDS, UCS Cut back on A* optimality detail; a bit more on importance of heuristics, performance data Pattern DBs? General Tree Search function

More information

Lecture 10 Evolutionary Computation: Evolution strategies and genetic programming

Lecture 10 Evolutionary Computation: Evolution strategies and genetic programming Lecture 10 Evolutionry Computtion: Evolution strtegies nd genetic progrmming Evolution strtegies Genetic progrmming Summry Negnevitsky, Person Eduction, 2011 1 Evolution Strtegies Another pproch to simulting

More information

Regular Expression Matching with Multi-Strings and Intervals. Philip Bille Mikkel Thorup

Regular Expression Matching with Multi-Strings and Intervals. Philip Bille Mikkel Thorup Regulr Expression Mtching with Multi-Strings nd Intervls Philip Bille Mikkel Thorup Outline Definition Applictions Previous work Two new problems: Multi-strings nd chrcter clss intervls Algorithms Thompson

More information

What are suffix trees?

What are suffix trees? Suffix Trees 1 Wht re suffix trees? Allow lgorithm designers to store very lrge mount of informtion out strings while still keeping within liner spce Allow users to serch for new strings in the originl

More information

Fall 2018 Midterm 1 October 11, ˆ You may not ask questions about the exam except for language clarifications.

Fall 2018 Midterm 1 October 11, ˆ You may not ask questions about the exam except for language clarifications. 15-112 Fll 2018 Midterm 1 October 11, 2018 Nme: Andrew ID: Recittion Section: ˆ You my not use ny books, notes, extr pper, or electronic devices during this exm. There should be nothing on your desk or

More information

CSCI 104. Rafael Ferreira da Silva. Slides adapted from: Mark Redekopp and David Kempe

CSCI 104. Rafael Ferreira da Silva. Slides adapted from: Mark Redekopp and David Kempe CSCI 0 fel Ferreir d Silv rfsilv@isi.edu Slides dpted from: Mrk edekopp nd Dvid Kempe LOG STUCTUED MEGE TEES Series Summtion eview Let n = + + + + k $ = #%& #. Wht is n? n = k+ - Wht is log () + log ()

More information

Information Retrieval and Organisation

Information Retrieval and Organisation Informtion Retrievl nd Orgnistion Suffix Trees dpted from http://www.mth.tu.c.il/~himk/seminr02/suffixtrees.ppt Dell Zhng Birkeck, University of London Trie A tree representing set of strings { } eef d

More information

CS311H: Discrete Mathematics. Graph Theory IV. A Non-planar Graph. Regions of a Planar Graph. Euler s Formula. Instructor: Işıl Dillig

CS311H: Discrete Mathematics. Graph Theory IV. A Non-planar Graph. Regions of a Planar Graph. Euler s Formula. Instructor: Işıl Dillig CS311H: Discrete Mthemtics Grph Theory IV Instructor: Işıl Dillig Instructor: Işıl Dillig, CS311H: Discrete Mthemtics Grph Theory IV 1/25 A Non-plnr Grph Regions of Plnr Grph The plnr representtion of

More information

Dr. D.M. Akbar Hussain

Dr. D.M. Akbar Hussain Dr. D.M. Akr Hussin Lexicl Anlysis. Bsic Ide: Red the source code nd generte tokens, it is similr wht humns will do to red in; just tking on the input nd reking it down in pieces. Ech token is sequence

More information

Allocator Basics. Dynamic Memory Allocation in the Heap (malloc and free) Allocator Goals: malloc/free. Internal Fragmentation

Allocator Basics. Dynamic Memory Allocation in the Heap (malloc and free) Allocator Goals: malloc/free. Internal Fragmentation Alloctor Bsics Dynmic Memory Alloction in the Hep (mlloc nd free) Pges too corse-grined for llocting individul objects. Insted: flexible-sized, word-ligned blocks. Allocted block (4 words) Free block (3

More information

ΕΠΛ323 - Θεωρία και Πρακτική Μεταγλωττιστών

ΕΠΛ323 - Θεωρία και Πρακτική Μεταγλωττιστών ΕΠΛ323 - Θωρία και Πρακτική Μταγλωττιστών Lecture 3 Lexicl Anlysis Elis Athnsopoulos elisthn@cs.ucy.c.cy Recognition of Tokens if expressions nd reltionl opertors if è if then è then else è else relop

More information

CS143 Handout 07 Summer 2011 June 24 th, 2011 Written Set 1: Lexical Analysis

CS143 Handout 07 Summer 2011 June 24 th, 2011 Written Set 1: Lexical Analysis CS143 Hndout 07 Summer 2011 June 24 th, 2011 Written Set 1: Lexicl Anlysis In this first written ssignment, you'll get the chnce to ply round with the vrious constructions tht come up when doing lexicl

More information

Midterm 2 Sample solution

Midterm 2 Sample solution Nme: Instructions Midterm 2 Smple solution CMSC 430 Introduction to Compilers Fll 2012 November 28, 2012 This exm contins 9 pges, including this one. Mke sure you hve ll the pges. Write your nme on the

More information

LECT-10, S-1 FP2P08, Javed I.

LECT-10, S-1 FP2P08, Javed I. A Course on Foundtions of Peer-to-Peer Systems & Applictions LECT-10, S-1 CS /799 Foundtion of Peer-to-Peer Applictions & Systems Kent Stte University Dept. of Computer Science www.cs.kent.edu/~jved/clss-p2p08

More information

Section 10.4 Hyperbolas

Section 10.4 Hyperbolas 66 Section 10.4 Hyperbols Objective : Definition of hyperbol & hyperbols centered t (0, 0). The third type of conic we will study is the hyperbol. It is defined in the sme mnner tht we defined the prbol

More information

Lexical Analysis: Constructing a Scanner from Regular Expressions

Lexical Analysis: Constructing a Scanner from Regular Expressions Lexicl Anlysis: Constructing Scnner from Regulr Expressions Gol Show how to construct FA to recognize ny RE This Lecture Convert RE to n nondeterministic finite utomton (NFA) Use Thompson s construction

More information

LING/C SC/PSYC 438/538. Lecture 21 Sandiway Fong

LING/C SC/PSYC 438/538. Lecture 21 Sandiway Fong LING/C SC/PSYC 438/538 Lecture 21 Sndiwy Fong Tody's Topics Homework 8 Review Optionl Homework 9 (mke up on Homework 7) Homework 8 Review Question1: write Prolog regulr grmmr for the following lnguge:

More information

Qubit allocation for quantum circuit compilers

Qubit allocation for quantum circuit compilers Quit lloction for quntum circuit compilers Nov. 10, 2017 JIQ 2017 Mrcos Yukio Sirichi Sylvin Collnge Vinícius Fernndes dos Sntos Fernndo Mgno Quintão Pereir Compilers for quntum computing The first genertion

More information

Context-Free Grammars

Context-Free Grammars Context-Free Grmmrs Descriing Lnguges We've seen two models for the regulr lnguges: Finite utomt ccept precisely the strings in the lnguge. Regulr expressions descrie precisely the strings in the lnguge.

More information

Presentation Martin Randers

Presentation Martin Randers Presenttion Mrtin Rnders Outline Introduction Algorithms Implementtion nd experiments Memory consumption Summry Introduction Introduction Evolution of species cn e modelled in trees Trees consist of nodes

More information

The Greedy Method. The Greedy Method

The Greedy Method. The Greedy Method Lists nd Itertors /8/26 Presenttion for use with the textook, Algorithm Design nd Applictions, y M. T. Goodrich nd R. Tmssi, Wiley, 25 The Greedy Method The Greedy Method The greedy method is generl lgorithm

More information

ITEC2620 Introduction to Data Structures

ITEC2620 Introduction to Data Structures ITEC0 Introduction to Dt Structures Lecture 7 Queues, Priority Queues Queues I A queue is First-In, First-Out = FIFO uffer e.g. line-ups People enter from the ck of the line People re served (exit) from

More information

3.5.1 Single slit diffraction

3.5.1 Single slit diffraction 3.5.1 Single slit diffrction Wves pssing through single slit will lso diffrct nd produce n interference pttern. The reson for this is to do with the finite width of the slit. We will consider this lter.

More information

Minimal Memory Abstractions

Minimal Memory Abstractions Miniml Memory Astrtions (As implemented for BioWre Corp ) Nthn Sturtevnt University of Alert GAMES Group Ferury, 7 Tlk Overview Prt I: Building Astrtions Minimizing memory requirements Performnes mesures

More information

ΕΠΛ323 - Θεωρία και Πρακτική Μεταγλωττιστών. Lecture 3b Lexical Analysis Elias Athanasopoulos

ΕΠΛ323 - Θεωρία και Πρακτική Μεταγλωττιστών. Lecture 3b Lexical Analysis Elias Athanasopoulos ΕΠΛ323 - Θωρία και Πρακτική Μταγλωττιστών Lecture 3 Lexicl Anlysis Elis Athnsopoulos elisthn@cs.ucy.c.cy RecogniNon of Tokens if expressions nd relnonl opertors if è if then è then else è else relop è

More information

Unit #9 : Definite Integral Properties, Fundamental Theorem of Calculus

Unit #9 : Definite Integral Properties, Fundamental Theorem of Calculus Unit #9 : Definite Integrl Properties, Fundmentl Theorem of Clculus Gols: Identify properties of definite integrls Define odd nd even functions, nd reltionship to integrl vlues Introduce the Fundmentl

More information

Informed search. Lirong Xia

Informed search. Lirong Xia Informed search Lirong Xia Spring, 207 Last class ØSearch problems state space graph: modeling the problem search tree: scratch paper for solving the problem ØUninformed search BFS DFS 2 Today s schedule

More information

Suffix Tries. Slides adapted from the course by Ben Langmead

Suffix Tries. Slides adapted from the course by Ben Langmead Suffix Tries Slides dpted from the course y Ben Lngmed en.lngmed@gmil.com Indexing with suffixes Until now, our indexes hve een sed on extrcting sustrings from T A very different pproch is to extrct suffixes

More information

3.5.1 Single slit diffraction

3.5.1 Single slit diffraction 3..1 Single slit diffrction ves pssing through single slit will lso diffrct nd produce n interference pttern. The reson for this is to do with the finite width of the slit. e will consider this lter. Tke

More information

Alignment of Long Sequences. BMI/CS Spring 2012 Colin Dewey

Alignment of Long Sequences. BMI/CS Spring 2012 Colin Dewey Alignment of Long Sequences BMI/CS 776 www.biostt.wisc.edu/bmi776/ Spring 2012 Colin Dewey cdewey@biostt.wisc.edu Gols for Lecture the key concepts to understnd re the following how lrge-scle lignment

More information

Compilers Spring 2013 PRACTICE Midterm Exam

Compilers Spring 2013 PRACTICE Midterm Exam Compilers Spring 2013 PRACTICE Midterm Exm This is full length prctice midterm exm. If you wnt to tke it t exm pce, give yourself 7 minutes to tke the entire test. Just like the rel exm, ech question hs

More information

Algorithm Design (5) Text Search

Algorithm Design (5) Text Search Algorithm Design (5) Text Serch Tkshi Chikym School of Engineering The University of Tokyo Text Serch Find sustring tht mtches the given key string in text dt of lrge mount Key string: chr x[m] Text Dt:

More information

Complete Coverage Path Planning of Mobile Robot Based on Dynamic Programming Algorithm Peng Zhou, Zhong-min Wang, Zhen-nan Li, Yang Li

Complete Coverage Path Planning of Mobile Robot Based on Dynamic Programming Algorithm Peng Zhou, Zhong-min Wang, Zhen-nan Li, Yang Li 2nd Interntionl Conference on Electronic & Mechnicl Engineering nd Informtion Technology (EMEIT-212) Complete Coverge Pth Plnning of Mobile Robot Bsed on Dynmic Progrmming Algorithm Peng Zhou, Zhong-min

More information

ZZ - Advanced Math Review 2017

ZZ - Advanced Math Review 2017 ZZ - Advnced Mth Review Mtrix Multipliction Given! nd! find the sum of the elements of the product BA First, rewrite the mtrices in the correct order to multiply The product is BA hs order x since B is

More information

CS321 Languages and Compiler Design I. Winter 2012 Lecture 5

CS321 Languages and Compiler Design I. Winter 2012 Lecture 5 CS321 Lnguges nd Compiler Design I Winter 2012 Lecture 5 1 FINITE AUTOMATA A non-deterministic finite utomton (NFA) consists of: An input lphet Σ, e.g. Σ =,. A set of sttes S, e.g. S = {1, 3, 5, 7, 11,

More information

Informed/Heuristic Search

Informed/Heuristic Search Informed/Heuristic Search Outline Limitations of uninformed search methods Informed (or heuristic) search uses problem-specific heuristics to improve efficiency Best-first A* Techniques for generating

More information

Premaster Course Algorithms 1 Chapter 6: Shortest Paths. Christian Scheideler SS 2018

Premaster Course Algorithms 1 Chapter 6: Shortest Paths. Christian Scheideler SS 2018 Premster Course Algorithms Chpter 6: Shortest Pths Christin Scheieler SS 8 Bsic Grph Algorithms Overview: Shortest pths in DAGs Dijkstr s lgorithm Bellmn-For lgorithm Johnson s metho SS 8 Chpter 6 Shortest

More information

Fig.25: the Role of LEX

Fig.25: the Role of LEX The Lnguge for Specifying Lexicl Anlyzer We shll now study how to uild lexicl nlyzer from specifiction of tokens in the form of list of regulr expressions The discussion centers round the design of n existing

More information

Languages. L((a (b)(c))*) = { ε,a,bc,aa,abc,bca,... } εw = wε = w. εabba = abbaε = abba. (a (b)(c)) *

Languages. L((a (b)(c))*) = { ε,a,bc,aa,abc,bca,... } εw = wε = w. εabba = abbaε = abba. (a (b)(c)) * Pln for Tody nd Beginning Next week Interpreter nd Compiler Structure, or Softwre Architecture Overview of Progrmming Assignments The MeggyJv compiler we will e uilding. Regulr Expressions Finite Stte

More information

UNIT 11. Query Optimization

UNIT 11. Query Optimization UNIT Query Optimiztion Contents Introduction to Query Optimiztion 2 The Optimiztion Process: An Overview 3 Optimiztion in System R 4 Optimiztion in INGRES 5 Implementing the Join Opertors Wei-Png Yng,

More information

Orthogonal line segment intersection

Orthogonal line segment intersection Computtionl Geometry [csci 3250] Line segment intersection The prolem (wht) Computtionl Geometry [csci 3250] Orthogonl line segment intersection Applictions (why) Algorithms (how) A specil cse: Orthogonl

More information

Informed Search. Xiaojin Zhu Computer Sciences Department University of Wisconsin, Madison

Informed Search. Xiaojin Zhu Computer Sciences Department University of Wisconsin, Madison Informed Search Xiaojin Zhu jerryzhu@cs.wisc.edu Computer Sciences Department University of Wisconsin, Madison [Based on slides from Andrew Moore http://www.cs.cmu.edu/~awm/tutorials ] slide 1 Main messages

More information

UT1553B BCRT True Dual-port Memory Interface

UT1553B BCRT True Dual-port Memory Interface UTMC APPICATION NOTE UT553B BCRT True Dul-port Memory Interfce INTRODUCTION The UTMC UT553B BCRT is monolithic CMOS integrted circuit tht provides comprehensive MI-STD- 553B Bus Controller nd Remote Terminl

More information

CSE 40171: Artificial Intelligence. Informed Search: A* Search

CSE 40171: Artificial Intelligence. Informed Search: A* Search CSE 40171: Artificial Intelligence Informed Search: A* Search 1 Homework #1 has been released. It is due at 11:59PM on 9/10. 2 Quick Recap: Search Quick Recap: Search Search problem: States (configurations

More information

Network Interconnection: Bridging CS 571 Fall Kenneth L. Calvert All rights reserved

Network Interconnection: Bridging CS 571 Fall Kenneth L. Calvert All rights reserved Network Interconnection: Bridging CS 57 Fll 6 6 Kenneth L. Clvert All rights reserved The Prolem We know how to uild (rodcst) LANs Wnt to connect severl LANs together to overcome scling limits Recll: speed

More information

Looking up objects in Pastry

Looking up objects in Pastry Review: Pstry routing tbles 0 1 2 3 4 7 8 9 b c d e f 0 1 2 3 4 7 8 9 b c d e f 0 1 2 3 4 7 8 9 b c d e f 0 2 3 4 7 8 9 b c d e f Row0 Row 1 Row 2 Row 3 Routing tble of node with ID i =1fc s - For ech

More information

Informed search. Soleymani. CE417: Introduction to Artificial Intelligence Sharif University of Technology Spring 2016

Informed search. Soleymani. CE417: Introduction to Artificial Intelligence Sharif University of Technology Spring 2016 Informed search CE417: Introduction to Artificial Intelligence Sharif University of Technology Spring 2016 Soleymani Artificial Intelligence: A Modern Approach, Chapter 3 Outline Best-first search Greedy

More information

If you are at the university, either physically or via the VPN, you can download the chapters of this book as PDFs.

If you are at the university, either physically or via the VPN, you can download the chapters of this book as PDFs. Lecture 5 Wlks, Trils, Pths nd Connectedness Reding: Some of the mteril in this lecture comes from Section 1.2 of Dieter Jungnickel (2008), Grphs, Networks nd Algorithms, 3rd edition, which is ville online

More information

Basics of Logic Design Arithmetic Logic Unit (ALU)

Basics of Logic Design Arithmetic Logic Unit (ALU) Bsics of Logic Design Arithmetic Logic Unit (ALU) CPS 4 Lecture 9 Tody s Lecture Homework #3 Assigned Due Mrch 3 Project Groups ssigned & posted to lckord. Project Specifiction is on We Due April 9 Building

More information

CS 432 Fall Mike Lam, Professor a (bc)* Regular Expressions and Finite Automata

CS 432 Fall Mike Lam, Professor a (bc)* Regular Expressions and Finite Automata CS 432 Fll 2017 Mike Lm, Professor (c)* Regulr Expressions nd Finite Automt Compiltion Current focus "Bck end" Source code Tokens Syntx tree Mchine code chr dt[20]; int min() { flot x = 42.0; return 7;

More information

CS 331: Artificial Intelligence Informed Search. Informed Search

CS 331: Artificial Intelligence Informed Search. Informed Search CS 331: Artificial Intelligence Informed Search 1 Informed Search How can we make search smarter? Use problem-specific knowledge beyond the definition of the problem itself Specifically, incorporate knowledge

More information

10.5 Graphing Quadratic Functions

10.5 Graphing Quadratic Functions 0.5 Grphing Qudrtic Functions Now tht we cn solve qudrtic equtions, we wnt to lern how to grph the function ssocited with the qudrtic eqution. We cll this the qudrtic function. Grphs of Qudrtic Functions

More information

Compression Outline :Algorithms in the Real World. Lempel-Ziv Algorithms. LZ77: Sliding Window Lempel-Ziv

Compression Outline :Algorithms in the Real World. Lempel-Ziv Algorithms. LZ77: Sliding Window Lempel-Ziv Compression Outline 15-853:Algorithms in the Rel World Dt Compression III Introduction: Lossy vs. Lossless, Benchmrks, Informtion Theory: Entropy, etc. Proility Coding: Huffmn + Arithmetic Coding Applictions

More information

CS 331: Artificial Intelligence Informed Search. Informed Search

CS 331: Artificial Intelligence Informed Search. Informed Search CS 331: Artificial Intelligence Informed Search 1 Informed Search How can we make search smarter? Use problem-specific knowledge beyond the definition of the problem itself Specifically, incorporate knowledge

More information

The Distributed Data Access Schemes in Lambda Grid Networks

The Distributed Data Access Schemes in Lambda Grid Networks The Distributed Dt Access Schemes in Lmbd Grid Networks Ryot Usui, Hiroyuki Miygi, Yutk Arkw, Storu Okmoto, nd Noki Ymnk Grdute School of Science for Open nd Environmentl Systems, Keio University, Jpn

More information

1.5 Extrema and the Mean Value Theorem

1.5 Extrema and the Mean Value Theorem .5 Extrem nd the Men Vlue Theorem.5. Mximum nd Minimum Vlues Definition.5. (Glol Mximum). Let f : D! R e function with domin D. Then f hs n glol mximum vlue t point c, iff(c) f(x) for ll x D. The vlue

More information

Informed Search. CS 486/686 University of Waterloo May 10. cs486/686 Lecture Slides 2005 (c) K. Larson and P. Poupart

Informed Search. CS 486/686 University of Waterloo May 10. cs486/686 Lecture Slides 2005 (c) K. Larson and P. Poupart Informed Search CS 486/686 University of Waterloo May 0 Outline Using knowledge Heuristics Best-first search Greedy best-first search A* search Other variations of A* Back to heuristics 2 Recall from last

More information

View, evaluate, and publish assignments using the Assignment dropbox.

View, evaluate, and publish assignments using the Assignment dropbox. Blckord Lerning System CE 6 Mnging Assignments Competencies After reding this document, you will e le to: Crete ssignments using the Assignment tool. View, evlute, nd pulish ssignments using the Assignment

More information

Context-Free Grammars

Context-Free Grammars Context-Free Grmmrs Descriing Lnguges We've seen two models for the regulr lnguges: Finite utomt ccept precisely the strings in the lnguge. Regulr expressions descrie precisely the strings in the lnguge.

More information

Suffix trees, suffix arrays, BWT

Suffix trees, suffix arrays, BWT ALGORITHMES POUR LA BIO-INFORMATIQUE ET LA VISUALISATION COURS 3 Rluc Uricru Suffix trees, suffix rrys, BWT Bsed on: Suffix trees nd suffix rrys presenttion y Him Kpln Suffix trees course y Pco Gomez Liner-Time

More information

Fall 2018 Midterm 2 November 15, 2018

Fall 2018 Midterm 2 November 15, 2018 Nme: 15-112 Fll 2018 Midterm 2 November 15, 2018 Andrew ID: Recittion Section: ˆ You my not use ny books, notes, extr pper, or electronic devices during this exm. There should be nothing on your desk or

More information

PPS: User Manual. Krishnendu Chatterjee, Martin Chmelik, Raghav Gupta, and Ayush Kanodia

PPS: User Manual. Krishnendu Chatterjee, Martin Chmelik, Raghav Gupta, and Ayush Kanodia PPS: User Mnul Krishnendu Chtterjee, Mrtin Chmelik, Rghv Gupt, nd Ayush Knodi IST Austri (Institute of Science nd Technology Austri), Klosterneuurg, Austri In this section we descrie the tool fetures,

More information

12-B FRACTIONS AND DECIMALS

12-B FRACTIONS AND DECIMALS -B Frctions nd Decimls. () If ll four integers were negtive, their product would be positive, nd so could not equl one of them. If ll four integers were positive, their product would be much greter thn

More information

Informed Search Lecture 5

Informed Search Lecture 5 Lecture 5 How can we exploit problem-specific knowledge to find solutions more efficiently? Where does this knowledge come from and under what conditions is it useful? 1 Agenda Review: Uninformed Search

More information

CMSC 331 First Midterm Exam

CMSC 331 First Midterm Exam 0 00/ 1 20/ 2 05/ 3 15/ 4 15/ 5 15/ 6 20/ 7 30/ 8 30/ 150/ 331 First Midterm Exm 7 October 2003 CMC 331 First Midterm Exm Nme: mple Answers tudent ID#: You will hve seventy-five (75) minutes to complete

More information

Before We Begin. Introduction to Spatial Domain Filtering. Introduction to Digital Image Processing. Overview (1): Administrative Details (1):

Before We Begin. Introduction to Spatial Domain Filtering. Introduction to Digital Image Processing. Overview (1): Administrative Details (1): Overview (): Before We Begin Administrtive detils Review some questions to consider Winter 2006 Imge Enhncement in the Sptil Domin: Bsics of Sptil Filtering, Smoothing Sptil Filters, Order Sttistics Filters

More information

CS 241. Fall 2017 Midterm Review Solutions. October 24, Bits and Bytes 1. 3 MIPS Assembler 6. 4 Regular Languages 7.

CS 241. Fall 2017 Midterm Review Solutions. October 24, Bits and Bytes 1. 3 MIPS Assembler 6. 4 Regular Languages 7. CS 241 Fll 2017 Midterm Review Solutions Octoer 24, 2017 Contents 1 Bits nd Bytes 1 2 MIPS Assemly Lnguge Progrmming 2 3 MIPS Assemler 6 4 Regulr Lnguges 7 5 Scnning 9 1 Bits nd Bytes 1. Give two s complement

More information