Announcements. CS 188: Artificial Intelligence Fall Recap: Search. Today. General Tree Search. Uniform Cost. Lecture 3: A* Search 9/4/2007
|
|
- Candice West
- 5 years ago
- Views:
Transcription
1 CS 88: Artificil Intelligence Fll 2007 Lecture : A* Serch 9/4/2007 Dn Klein UC Berkeley Mny slides over the course dpted from either Sturt Russell or Andrew Moore Announcements Sections: New section 06: Tu 5-6pm You cn go to ny section, if there s spce Sections strt this week Homework Project on the we, due 9/2 New written homework formt: One or two questions hnded out end of section (nd online) Due the next week in section, grded check / no check Ech ssignment % of grde, cp of 0%, so cn skip t lest one week, depends on how mny there re Solve in groups of ny size, write up lone A* Serch Heuristic Design Locl Serch Tody Recp: Serch Serch prolems: Sttes (configurtions of the world) Successor functions, costs, strt nd gol tests Serch trees: Nodes: represent pths / plns Pths hve costs (sum of ction costs) Strtegies differ (only) in fringe mngement enerl Tree Serch Uniform Cost Strtegy: expnd lowest pth cost The good: UCS is complete nd optiml! c c 2 c Expnding includes incrementing the pth cost! The d: Explores options in every direction No informtion out gol loction Strt ol
2 Best First Exmple: Heuristic Function Strtegy: expnd nodes which pper closest to gol Heuristic: function which mps sttes to distnce A common cse: Best-first tkes you stright to the (wrong) gol Worst- cse: like dly- guided DFS h(x) Comining UCS nd reedy Uniform-cost orders y pth cost, or ckwrd cost g(n) Best-first orders y gol proximity, or forwrd cost h(n) 2 S d h=5 2 h=6 h=2 h=0 c h=5 h=4 A* Serch orders y the sum: f(n) = g(n) + h(n) 5 e h= When should A* terminte? Should we stop when we enqueue gol? 2 A 2 S h = 2 h = B 2 h = No: only stop when we dequeue gol h = 0 Exmple: Teg renger Is A* Optiml? Admissile Heuristics A h = 6 A heuristic is dmissile (optimistic) if: S h = 7 h = 0 where is the true cost to nerest gol 5 Wht went wrong? Actul d gol cost > estimted good gol cost We need estimtes to e less thn ctul costs! E.g. Eucliden distnce on mp prolem Coming up with dmissile heuristics is most of wht s involved in using A* in prctice. 2
3 Optimlity of A*: Blocking UCS vs A* Contours Proof: Wht could go wrong? We d hve to hve to pop suoptiml gol off the fringe efore * This cn t hppen: Imgine suoptiml gol is on the queue Some node n which is supth of * must e on the fringe (why?) n will e popped efore Uniform-cost expnded in ll directions A* expnds minly towrd the gol, ut does hedge its ets to ensure optimlity Strt Strt ol ol Properties of A* Admissile Heuristics Uniform- Cost A* Most of the work is in coming up with dmissile heuristics Indmissile heuristics re often quite effective (especilly when you hve no choice) Very common hck: use α x h(n) for dmissile h, α > to generte fster ut less optiml indmissile h from dmissile h Exmple: 8 Puzzle 8 Puzzle I Numer of tiles misplced? Why is it dmissile? Wht re the sttes? Wht re the ctions? Wht sttes cn I rech from the strt stte? Wht should the costs e? h(strt) = 8 This is relxedprolem heuristic ID TILES Averge nodes expnded when optiml pth hs length 4 steps 8 steps 2 6, steps.6 x
4 8 Puzzle II 8 Puzzle III Wht if we hd n esier 8-puzzle where ny tile could slide ny direction t ny time, ignoring other tiles? Totl Mnhttn distnce Why dmissile? h(strt) = TILES = 8 MAN- HATTAN Averge nodes expnded when optiml pth hs length 4 steps 2 8 steps steps How out using the ctul cost s heuristic? Would it e dmissile? Would we sve on nodes? Wht s wrong with it? With A*: trde-off etween qulity of estimte nd work per node! Trivil Heuristics, Dominnce Dominnce: h h c if Heuristics form semi-lttice: Mx of dmissile heuristics is dmissile Trivil heuristics Bottom of lttice is the zero heuristic (wht does this give us?) Top of lttice is the exct heuristic Course Scheduling From the university s perspective: Set of courses {c, c 2, c n } Set of room / times {r, r 2, r n } Ech piring (c k, r m ) hs cost w km Wht s the est ssignment of courses to rooms? Sttes: list of pirings Actions: dd legl piring Costs: cost of the new piring Admissile heuristics? (Who cn think of cs70 nswer to this prolem?) Other A* Applictions Pthing / routing prolems Resource plnning prolems Root motion plnning Lnguge nlysis Mchine trnsltion Speech recognition Tree Serch: Extr Work? Filure to detect repeted sttes cn cuse exponentilly more work. Why? 4
5 rph Serch In BFS, for exmple, we shouldn t other expnding the circled nodes (why?) rph Serch Very simple fix: never expnd stte twice S d e p c e h r q h r p q f p q f q c q c Cn this wreck completeness? Optimlity? Optimlity of A* rph Serch Consider wht A* does: Expnds nodes in incresing totl f vlue (f-contours) Proof ide: optiml gols hve lower f vlue, so get expnded first We mde stronger ssumption thn in the lst proof Wht? Consistency Wit, how do we know we expnd in incresing f vlue? Couldn t we pop some node n, nd find its child n to hve lower f vlue? YES: h = 0 h = 8 B g = 0 Wht cn we ssume to prevent these inversions? Consistency: A h = 0 Rel cost lwys exceeds reduction in heuristic Optimlity Tree serch: A* optiml if heuristic is dmissile (nd nonnegtive) UCS is specil cse (h = 0) rph serch: A* optiml if heuristic is consistent UCS optiml (h = 0 is consistent) In generl, nturl dmissile heuristics tend to e consistent Summry: A* A* uses oth ckwrd costs nd (estimtes of) forwrd costs A* is optiml with dmissile heuristics Heuristic design is key: often use relxed prolems 5
6 Lrge Scle Prolems Limited Memory Options Wht sttes get expnded? All sttes with f-cost less thn optiml gol cost How fr in every direction will this e? Intuition: depth grows like the heuristic gp : h(strt) g(gol) p usully t lest liner in prolem size Work exponentil in depth In huge prolems, often A* isn t enough Stte spce just too ig Cn t visit ll sttes with f less thn optiml Often, cn t even store the entire fringe Solutions Better heuristics Bem serch (limited fringe size) reedy hill-climing (fringe size = ) Strt ol Hill-Climing Serch: Only est node kept round, no fringe! Usully prioritize successor choice y h (greedy hill climing) Compre to greedy cktrcking, which still hs fringe Bem Serch (Limited Memory Serch) In etween: keep K nodes in fringe Dump lowest priority nodes s needed Cn prioritize y h lone (greedy em serch), or h+g (limited memory A*) Why not pplied to UCS? We ll return to em serch lter No gurntees once you limit the fringe size! 6
Today. CS 188: Artificial Intelligence Fall Recap: Search. Example: Pancake Problem. Example: Pancake Problem. General Tree Search.
CS 88: Artificil Intelligence Fll 00 Lecture : A* Serch 9//00 A* Serch rph Serch Tody Heuristic Design Dn Klein UC Berkeley Multiple slides from Sturt Russell or Andrew Moore Recp: Serch Exmple: Pncke
More informationAnnouncements. CS 188: Artificial Intelligence Fall Recap: Search. Today. Example: Pancake Problem. Example: Pancake Problem
Announcements Project : erch It s live! Due 9/. trt erly nd sk questions. It s longer thn most! Need prtner? Come up fter clss or try Pizz ections: cn go to ny, ut hve priority in your own C 88: Artificil
More informationCS 221: Artificial Intelligence Fall 2011
CS 221: Artificil Intelligence Fll 2011 Lecture 2: Serch (Slides from Dn Klein, with help from Sturt Russell, Andrew Moore, Teg Grenger, Peter Norvig) Problem types! Fully observble, deterministic! single-belief-stte
More informationCSEP 573 Artificial Intelligence Winter 2016
CSEP 573 Artificil Intelligence Winter 2016 Luke Zettlemoyer Problem Spces nd Serch slides from Dn Klein, Sturt Russell, Andrew Moore, Dn Weld, Pieter Abbeel, Ali Frhdi Outline Agents tht Pln Ahed Serch
More informationToday. Search Problems. Uninformed Search Methods. Depth-First Search Breadth-First Search Uniform-Cost Search
Uninformed Serch [These slides were creted by Dn Klein nd Pieter Abbeel for CS188 Intro to AI t UC Berkeley. All CS188 mterils re vilble t http://i.berkeley.edu.] Tody Serch Problems Uninformed Serch Methods
More informationSolving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence Winter 2016
Solving Prolems y Serching CS 486/686: Introduction to Artificil Intelligence Winter 2016 1 Introduction Serch ws one of the first topics studied in AI - Newell nd Simon (1961) Generl Prolem Solver Centrl
More informationSolving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence
Solving Prolems y Serching CS 486/686: Introduction to Artificil Intelligence 1 Introduction Serch ws one of the first topics studied in AI - Newell nd Simon (1961) Generl Prolem Solver Centrl component
More informationCSCI 446: Artificial Intelligence
CSCI 446: Artificil Intelligence Serch Instructor: Michele Vn Dyne [These slides were creted by Dn Klein nd Pieter Abbeel for CS188 Intro to AI t UC Berkeley. All CS188 mterils re vilble t http://i.berkeley.edu.]
More informationSearch Gone Wrong? CS 188: Artificial Intelligence Fall Today. Announcements. General Tree Search. Recap: Search. Lecture 3: A* Search 9/3/2009
C 88: Artiicil Intelligence Fll 009 erch one Wrong? Lecture : A* erch 9//009 Pieter Aeel UC Berkeley Mny slides rom Dn Klein Announcements Assignments: Project 0 (Python tutoril): due Fridy /8 t 4:59m
More informationCS 188: Artificial Intelligence Fall Search Gone Wrong?
CS 188: Artificial Intelligence Fall 2009 Lecture 3: A* Search 9/3/2009 Pieter Aeel UC Berkeley Many slides from Dan Klein Search Gone Wrong? 1 Announcements Assignments: Project 0 (Python tutorial): due
More informationUninformed Search. Hal Daumé III. Computer Science University of Maryland CS 421: Introduction to Artificial Intelligence 31 Jan 2012
1 Hl Dumé III (me@hl3.nme) Uninformed Serch Hl Dumé III Comuter Science University of Mrylnd me@hl3.nme CS 421: Introduction to Artificil Intelligence 31 Jn 2012 Mny slides courtesy of Dn Klein, Sturt
More informationToday. Informed Search. Graph Search. Heuristics Greedy Search A* Search
Informed Search [These slides were created by Dan Klein and Pieter Abbeel for CS188 Intro to AI at UC Berkeley. All CS188 materials are available at http://ai.berkeley.edu.] Today Informed Search Heuristics
More informationAI Adjacent Fields. This slide deck courtesy of Dan Klein at UC Berkeley
AI Adjcent Fields Philosophy: Logic, methods of resoning Mind s physicl system Foundtions of lerning, lnguge, rtionlity Mthemtics Forml representtion nd proof Algorithms, computtion, (un)decidility, (in)trctility
More informationCE 473: Artificial Intelligence. Autumn 2011
CE 473: Artificial Intelligence Autumn 2011 A* Search Luke Zettlemoyer Based on slides from Dan Klein Multiple slides from Stuart Russell or Andrew Moore Today A* Search Heuristic Design Graph search Recap:
More informationAnnouncements. CS 188: Artificial Intelligence
Announcements Projects: Looking for project partners? --- Come to front after lecture. Try pair programming, not divide-and-conquer Account forms available up front during break and after lecture Assignments
More informationCS 343H: Artificial Intelligence
CS 343H: Artificial Intelligence Lecture 4: Informed Search 1/23/2014 Slides courtesy of Dan Klein at UC-Berkeley Unless otherwise noted Today Informed search Heuristics Greedy search A* search Graph search
More informationCS 343: Artificial Intelligence
CS 343: Artificial Intelligence Informed Search Prof. Scott Niekum University of Texas at Austin [These slides based on ones created by Dan Klein and Pieter Abbeel for CS188 Intro to AI at UC Berkeley.
More informationCSCI 446: Artificial Intelligence
CSCI 446: Artificial Intelligence Informed Search Instructor: Michele Van Dyne [These slides were created by Dan Klein and Pieter Abbeel for CS188 Intro to AI at UC Berkeley. All CS188 materials are available
More informationCS 188: Artificial Intelligence
CS 188: Artificial Intelligence Today Informed Search Informed Search Heuristics Greedy Search A* Search Instructor: Marco Alvarez University of Rhode Island (These slides were created/modified by Dan
More informationArtificial Intelligence Informed Search
Artificial Intelligence Informed Search Instructors: David Suter and Qince Li Course Delivered @ Harbin Institute of Technology [Many slides adapted from those created by Dan Klein and Pieter Abbeel for
More informationInformed Search A* Algorithm
Informed Search A* Algorithm CE417: Introduction to Artificial Intelligence Sharif University of Technology Spring 2018 Soleymani Artificial Intelligence: A Modern Approach, Chapter 3 Most slides have
More informationCS 188: Artificial Intelligence Fall 2008
CS 188: Artificil Intelligence Fll 2008 Lecture 2: Queue-Bsed Serc 9/2/2008 Dn Klein UC Berkeley Mny slides from eiter Sturt Russell or Andrew Moore Announcements Written ssignments: One mini-omework ec
More informationHeuristic Search. Rob Platt Northeastern University. Some images and slides are used from: AIMA
Heuristic Search Rob Platt Northeastern University Some images and slides are used from: AIMA Recap: What is graph search? Start state Goal state Graph search: find a path from start to goal what are the
More informationCOMP 423 lecture 11 Jan. 28, 2008
COMP 423 lecture 11 Jn. 28, 2008 Up to now, we hve looked t how some symols in n lphet occur more frequently thn others nd how we cn sve its y using code such tht the codewords for more frequently occuring
More informationMa/CS 6b Class 1: Graph Recap
M/CS 6 Clss 1: Grph Recp By Adm Sheffer Course Detils Adm Sheffer. Office hour: Tuesdys 4pm. dmsh@cltech.edu TA: Victor Kstkin. Office hour: Tuesdys 7pm. 1:00 Mondy, Wednesdy, nd Fridy. http://www.mth.cltech.edu/~2014-15/2term/m006/
More information2 Computing all Intersections of a Set of Segments Line Segment Intersection
15-451/651: Design & Anlysis of Algorithms Novemer 14, 2016 Lecture #21 Sweep-Line nd Segment Intersection lst chnged: Novemer 8, 2017 1 Preliminries The sweep-line prdigm is very powerful lgorithmic design
More information521495A: Artificial Intelligence
521495A: Artificial Intelligence Informed Search Lectured by Abdenour Hadid Adjunct Professor, CMVS, University of Oulu Slides adopted from http://ai.berkeley.edu Today Informed Search Heuristics Greedy
More informationTries. Yufei Tao KAIST. April 9, Y. Tao, April 9, 2013 Tries
Tries Yufei To KAIST April 9, 2013 Y. To, April 9, 2013 Tries In this lecture, we will discuss the following exct mtching prolem on strings. Prolem Let S e set of strings, ech of which hs unique integer
More informationCS 5522: Artificial Intelligence II
CS 5522: Artificial Intelligence II Search Algorithms Instructor: Wei Xu Ohio State University [These slides were adapted from CS188 Intro to AI at UC Berkeley.] Today Agents that Plan Ahead Search Problems
More informationHeuristic Search. Robert Platt Northeastern University. Some images and slides are used from: 1. CS188 UC Berkeley 2. RN, AIMA
Heuristic Search Robert Platt Northeastern University Some images and slides are used from: 1. CS188 UC Berkeley 2. RN, AIMA Recap: What is graph search? Start state Goal state Graph search: find a path
More informationMa/CS 6b Class 1: Graph Recap
M/CS 6 Clss 1: Grph Recp By Adm Sheffer Course Detils Instructor: Adm Sheffer. TA: Cosmin Pohot. 1pm Mondys, Wednesdys, nd Fridys. http://mth.cltech.edu/~2015-16/2term/m006/ Min ook: Introduction to Grph
More informationCOMBINATORIAL PATTERN MATCHING
COMBINATORIAL PATTERN MATCHING Genomic Repets Exmple of repets: ATGGTCTAGGTCCTAGTGGTC Motivtion to find them: Genomic rerrngements re often ssocited with repets Trce evolutionry secrets Mny tumors re chrcterized
More informationCS481: Bioinformatics Algorithms
CS481: Bioinformtics Algorithms Cn Alkn EA509 clkn@cs.ilkent.edu.tr http://www.cs.ilkent.edu.tr/~clkn/teching/cs481/ EXACT STRING MATCHING Fingerprint ide Assume: We cn compute fingerprint f(p) of P in
More informationGraphs vs trees up front; use grid too; discuss for BFS, DFS, IDS, UCS Cut back on A* optimality detail; a bit more on importance of heuristics,
Graphs vs trees up front; use grid too; discuss for BFS, DFS, IDS, UCS Cut back on A* optimality detail; a bit more on importance of heuristics, performance data Pattern DBs? General Tree Search function
More informationLecture 10 Evolutionary Computation: Evolution strategies and genetic programming
Lecture 10 Evolutionry Computtion: Evolution strtegies nd genetic progrmming Evolution strtegies Genetic progrmming Summry Negnevitsky, Person Eduction, 2011 1 Evolution Strtegies Another pproch to simulting
More informationRegular Expression Matching with Multi-Strings and Intervals. Philip Bille Mikkel Thorup
Regulr Expression Mtching with Multi-Strings nd Intervls Philip Bille Mikkel Thorup Outline Definition Applictions Previous work Two new problems: Multi-strings nd chrcter clss intervls Algorithms Thompson
More informationWhat are suffix trees?
Suffix Trees 1 Wht re suffix trees? Allow lgorithm designers to store very lrge mount of informtion out strings while still keeping within liner spce Allow users to serch for new strings in the originl
More informationFall 2018 Midterm 1 October 11, ˆ You may not ask questions about the exam except for language clarifications.
15-112 Fll 2018 Midterm 1 October 11, 2018 Nme: Andrew ID: Recittion Section: ˆ You my not use ny books, notes, extr pper, or electronic devices during this exm. There should be nothing on your desk or
More informationCSCI 104. Rafael Ferreira da Silva. Slides adapted from: Mark Redekopp and David Kempe
CSCI 0 fel Ferreir d Silv rfsilv@isi.edu Slides dpted from: Mrk edekopp nd Dvid Kempe LOG STUCTUED MEGE TEES Series Summtion eview Let n = + + + + k $ = #%& #. Wht is n? n = k+ - Wht is log () + log ()
More informationInformation Retrieval and Organisation
Informtion Retrievl nd Orgnistion Suffix Trees dpted from http://www.mth.tu.c.il/~himk/seminr02/suffixtrees.ppt Dell Zhng Birkeck, University of London Trie A tree representing set of strings { } eef d
More informationCS311H: Discrete Mathematics. Graph Theory IV. A Non-planar Graph. Regions of a Planar Graph. Euler s Formula. Instructor: Işıl Dillig
CS311H: Discrete Mthemtics Grph Theory IV Instructor: Işıl Dillig Instructor: Işıl Dillig, CS311H: Discrete Mthemtics Grph Theory IV 1/25 A Non-plnr Grph Regions of Plnr Grph The plnr representtion of
More informationDr. D.M. Akbar Hussain
Dr. D.M. Akr Hussin Lexicl Anlysis. Bsic Ide: Red the source code nd generte tokens, it is similr wht humns will do to red in; just tking on the input nd reking it down in pieces. Ech token is sequence
More informationAllocator Basics. Dynamic Memory Allocation in the Heap (malloc and free) Allocator Goals: malloc/free. Internal Fragmentation
Alloctor Bsics Dynmic Memory Alloction in the Hep (mlloc nd free) Pges too corse-grined for llocting individul objects. Insted: flexible-sized, word-ligned blocks. Allocted block (4 words) Free block (3
More informationΕΠΛ323 - Θεωρία και Πρακτική Μεταγλωττιστών
ΕΠΛ323 - Θωρία και Πρακτική Μταγλωττιστών Lecture 3 Lexicl Anlysis Elis Athnsopoulos elisthn@cs.ucy.c.cy Recognition of Tokens if expressions nd reltionl opertors if è if then è then else è else relop
More informationCS143 Handout 07 Summer 2011 June 24 th, 2011 Written Set 1: Lexical Analysis
CS143 Hndout 07 Summer 2011 June 24 th, 2011 Written Set 1: Lexicl Anlysis In this first written ssignment, you'll get the chnce to ply round with the vrious constructions tht come up when doing lexicl
More informationMidterm 2 Sample solution
Nme: Instructions Midterm 2 Smple solution CMSC 430 Introduction to Compilers Fll 2012 November 28, 2012 This exm contins 9 pges, including this one. Mke sure you hve ll the pges. Write your nme on the
More informationLECT-10, S-1 FP2P08, Javed I.
A Course on Foundtions of Peer-to-Peer Systems & Applictions LECT-10, S-1 CS /799 Foundtion of Peer-to-Peer Applictions & Systems Kent Stte University Dept. of Computer Science www.cs.kent.edu/~jved/clss-p2p08
More informationSection 10.4 Hyperbolas
66 Section 10.4 Hyperbols Objective : Definition of hyperbol & hyperbols centered t (0, 0). The third type of conic we will study is the hyperbol. It is defined in the sme mnner tht we defined the prbol
More informationLexical Analysis: Constructing a Scanner from Regular Expressions
Lexicl Anlysis: Constructing Scnner from Regulr Expressions Gol Show how to construct FA to recognize ny RE This Lecture Convert RE to n nondeterministic finite utomton (NFA) Use Thompson s construction
More informationLING/C SC/PSYC 438/538. Lecture 21 Sandiway Fong
LING/C SC/PSYC 438/538 Lecture 21 Sndiwy Fong Tody's Topics Homework 8 Review Optionl Homework 9 (mke up on Homework 7) Homework 8 Review Question1: write Prolog regulr grmmr for the following lnguge:
More informationQubit allocation for quantum circuit compilers
Quit lloction for quntum circuit compilers Nov. 10, 2017 JIQ 2017 Mrcos Yukio Sirichi Sylvin Collnge Vinícius Fernndes dos Sntos Fernndo Mgno Quintão Pereir Compilers for quntum computing The first genertion
More informationContext-Free Grammars
Context-Free Grmmrs Descriing Lnguges We've seen two models for the regulr lnguges: Finite utomt ccept precisely the strings in the lnguge. Regulr expressions descrie precisely the strings in the lnguge.
More informationPresentation Martin Randers
Presenttion Mrtin Rnders Outline Introduction Algorithms Implementtion nd experiments Memory consumption Summry Introduction Introduction Evolution of species cn e modelled in trees Trees consist of nodes
More informationThe Greedy Method. The Greedy Method
Lists nd Itertors /8/26 Presenttion for use with the textook, Algorithm Design nd Applictions, y M. T. Goodrich nd R. Tmssi, Wiley, 25 The Greedy Method The Greedy Method The greedy method is generl lgorithm
More informationITEC2620 Introduction to Data Structures
ITEC0 Introduction to Dt Structures Lecture 7 Queues, Priority Queues Queues I A queue is First-In, First-Out = FIFO uffer e.g. line-ups People enter from the ck of the line People re served (exit) from
More information3.5.1 Single slit diffraction
3.5.1 Single slit diffrction Wves pssing through single slit will lso diffrct nd produce n interference pttern. The reson for this is to do with the finite width of the slit. We will consider this lter.
More informationMinimal Memory Abstractions
Miniml Memory Astrtions (As implemented for BioWre Corp ) Nthn Sturtevnt University of Alert GAMES Group Ferury, 7 Tlk Overview Prt I: Building Astrtions Minimizing memory requirements Performnes mesures
More informationΕΠΛ323 - Θεωρία και Πρακτική Μεταγλωττιστών. Lecture 3b Lexical Analysis Elias Athanasopoulos
ΕΠΛ323 - Θωρία και Πρακτική Μταγλωττιστών Lecture 3 Lexicl Anlysis Elis Athnsopoulos elisthn@cs.ucy.c.cy RecogniNon of Tokens if expressions nd relnonl opertors if è if then è then else è else relop è
More informationUnit #9 : Definite Integral Properties, Fundamental Theorem of Calculus
Unit #9 : Definite Integrl Properties, Fundmentl Theorem of Clculus Gols: Identify properties of definite integrls Define odd nd even functions, nd reltionship to integrl vlues Introduce the Fundmentl
More informationInformed search. Lirong Xia
Informed search Lirong Xia Spring, 207 Last class ØSearch problems state space graph: modeling the problem search tree: scratch paper for solving the problem ØUninformed search BFS DFS 2 Today s schedule
More informationSuffix Tries. Slides adapted from the course by Ben Langmead
Suffix Tries Slides dpted from the course y Ben Lngmed en.lngmed@gmil.com Indexing with suffixes Until now, our indexes hve een sed on extrcting sustrings from T A very different pproch is to extrct suffixes
More information3.5.1 Single slit diffraction
3..1 Single slit diffrction ves pssing through single slit will lso diffrct nd produce n interference pttern. The reson for this is to do with the finite width of the slit. e will consider this lter. Tke
More informationAlignment of Long Sequences. BMI/CS Spring 2012 Colin Dewey
Alignment of Long Sequences BMI/CS 776 www.biostt.wisc.edu/bmi776/ Spring 2012 Colin Dewey cdewey@biostt.wisc.edu Gols for Lecture the key concepts to understnd re the following how lrge-scle lignment
More informationCompilers Spring 2013 PRACTICE Midterm Exam
Compilers Spring 2013 PRACTICE Midterm Exm This is full length prctice midterm exm. If you wnt to tke it t exm pce, give yourself 7 minutes to tke the entire test. Just like the rel exm, ech question hs
More informationAlgorithm Design (5) Text Search
Algorithm Design (5) Text Serch Tkshi Chikym School of Engineering The University of Tokyo Text Serch Find sustring tht mtches the given key string in text dt of lrge mount Key string: chr x[m] Text Dt:
More informationComplete Coverage Path Planning of Mobile Robot Based on Dynamic Programming Algorithm Peng Zhou, Zhong-min Wang, Zhen-nan Li, Yang Li
2nd Interntionl Conference on Electronic & Mechnicl Engineering nd Informtion Technology (EMEIT-212) Complete Coverge Pth Plnning of Mobile Robot Bsed on Dynmic Progrmming Algorithm Peng Zhou, Zhong-min
More informationZZ - Advanced Math Review 2017
ZZ - Advnced Mth Review Mtrix Multipliction Given! nd! find the sum of the elements of the product BA First, rewrite the mtrices in the correct order to multiply The product is BA hs order x since B is
More informationCS321 Languages and Compiler Design I. Winter 2012 Lecture 5
CS321 Lnguges nd Compiler Design I Winter 2012 Lecture 5 1 FINITE AUTOMATA A non-deterministic finite utomton (NFA) consists of: An input lphet Σ, e.g. Σ =,. A set of sttes S, e.g. S = {1, 3, 5, 7, 11,
More informationInformed/Heuristic Search
Informed/Heuristic Search Outline Limitations of uninformed search methods Informed (or heuristic) search uses problem-specific heuristics to improve efficiency Best-first A* Techniques for generating
More informationPremaster Course Algorithms 1 Chapter 6: Shortest Paths. Christian Scheideler SS 2018
Premster Course Algorithms Chpter 6: Shortest Pths Christin Scheieler SS 8 Bsic Grph Algorithms Overview: Shortest pths in DAGs Dijkstr s lgorithm Bellmn-For lgorithm Johnson s metho SS 8 Chpter 6 Shortest
More informationFig.25: the Role of LEX
The Lnguge for Specifying Lexicl Anlyzer We shll now study how to uild lexicl nlyzer from specifiction of tokens in the form of list of regulr expressions The discussion centers round the design of n existing
More informationLanguages. L((a (b)(c))*) = { ε,a,bc,aa,abc,bca,... } εw = wε = w. εabba = abbaε = abba. (a (b)(c)) *
Pln for Tody nd Beginning Next week Interpreter nd Compiler Structure, or Softwre Architecture Overview of Progrmming Assignments The MeggyJv compiler we will e uilding. Regulr Expressions Finite Stte
More informationUNIT 11. Query Optimization
UNIT Query Optimiztion Contents Introduction to Query Optimiztion 2 The Optimiztion Process: An Overview 3 Optimiztion in System R 4 Optimiztion in INGRES 5 Implementing the Join Opertors Wei-Png Yng,
More informationOrthogonal line segment intersection
Computtionl Geometry [csci 3250] Line segment intersection The prolem (wht) Computtionl Geometry [csci 3250] Orthogonl line segment intersection Applictions (why) Algorithms (how) A specil cse: Orthogonl
More informationInformed Search. Xiaojin Zhu Computer Sciences Department University of Wisconsin, Madison
Informed Search Xiaojin Zhu jerryzhu@cs.wisc.edu Computer Sciences Department University of Wisconsin, Madison [Based on slides from Andrew Moore http://www.cs.cmu.edu/~awm/tutorials ] slide 1 Main messages
More informationUT1553B BCRT True Dual-port Memory Interface
UTMC APPICATION NOTE UT553B BCRT True Dul-port Memory Interfce INTRODUCTION The UTMC UT553B BCRT is monolithic CMOS integrted circuit tht provides comprehensive MI-STD- 553B Bus Controller nd Remote Terminl
More informationCSE 40171: Artificial Intelligence. Informed Search: A* Search
CSE 40171: Artificial Intelligence Informed Search: A* Search 1 Homework #1 has been released. It is due at 11:59PM on 9/10. 2 Quick Recap: Search Quick Recap: Search Search problem: States (configurations
More informationNetwork Interconnection: Bridging CS 571 Fall Kenneth L. Calvert All rights reserved
Network Interconnection: Bridging CS 57 Fll 6 6 Kenneth L. Clvert All rights reserved The Prolem We know how to uild (rodcst) LANs Wnt to connect severl LANs together to overcome scling limits Recll: speed
More informationLooking up objects in Pastry
Review: Pstry routing tbles 0 1 2 3 4 7 8 9 b c d e f 0 1 2 3 4 7 8 9 b c d e f 0 1 2 3 4 7 8 9 b c d e f 0 2 3 4 7 8 9 b c d e f Row0 Row 1 Row 2 Row 3 Routing tble of node with ID i =1fc s - For ech
More informationInformed search. Soleymani. CE417: Introduction to Artificial Intelligence Sharif University of Technology Spring 2016
Informed search CE417: Introduction to Artificial Intelligence Sharif University of Technology Spring 2016 Soleymani Artificial Intelligence: A Modern Approach, Chapter 3 Outline Best-first search Greedy
More informationIf you are at the university, either physically or via the VPN, you can download the chapters of this book as PDFs.
Lecture 5 Wlks, Trils, Pths nd Connectedness Reding: Some of the mteril in this lecture comes from Section 1.2 of Dieter Jungnickel (2008), Grphs, Networks nd Algorithms, 3rd edition, which is ville online
More informationBasics of Logic Design Arithmetic Logic Unit (ALU)
Bsics of Logic Design Arithmetic Logic Unit (ALU) CPS 4 Lecture 9 Tody s Lecture Homework #3 Assigned Due Mrch 3 Project Groups ssigned & posted to lckord. Project Specifiction is on We Due April 9 Building
More informationCS 432 Fall Mike Lam, Professor a (bc)* Regular Expressions and Finite Automata
CS 432 Fll 2017 Mike Lm, Professor (c)* Regulr Expressions nd Finite Automt Compiltion Current focus "Bck end" Source code Tokens Syntx tree Mchine code chr dt[20]; int min() { flot x = 42.0; return 7;
More informationCS 331: Artificial Intelligence Informed Search. Informed Search
CS 331: Artificial Intelligence Informed Search 1 Informed Search How can we make search smarter? Use problem-specific knowledge beyond the definition of the problem itself Specifically, incorporate knowledge
More information10.5 Graphing Quadratic Functions
0.5 Grphing Qudrtic Functions Now tht we cn solve qudrtic equtions, we wnt to lern how to grph the function ssocited with the qudrtic eqution. We cll this the qudrtic function. Grphs of Qudrtic Functions
More informationCompression Outline :Algorithms in the Real World. Lempel-Ziv Algorithms. LZ77: Sliding Window Lempel-Ziv
Compression Outline 15-853:Algorithms in the Rel World Dt Compression III Introduction: Lossy vs. Lossless, Benchmrks, Informtion Theory: Entropy, etc. Proility Coding: Huffmn + Arithmetic Coding Applictions
More informationCS 331: Artificial Intelligence Informed Search. Informed Search
CS 331: Artificial Intelligence Informed Search 1 Informed Search How can we make search smarter? Use problem-specific knowledge beyond the definition of the problem itself Specifically, incorporate knowledge
More informationThe Distributed Data Access Schemes in Lambda Grid Networks
The Distributed Dt Access Schemes in Lmbd Grid Networks Ryot Usui, Hiroyuki Miygi, Yutk Arkw, Storu Okmoto, nd Noki Ymnk Grdute School of Science for Open nd Environmentl Systems, Keio University, Jpn
More information1.5 Extrema and the Mean Value Theorem
.5 Extrem nd the Men Vlue Theorem.5. Mximum nd Minimum Vlues Definition.5. (Glol Mximum). Let f : D! R e function with domin D. Then f hs n glol mximum vlue t point c, iff(c) f(x) for ll x D. The vlue
More informationInformed Search. CS 486/686 University of Waterloo May 10. cs486/686 Lecture Slides 2005 (c) K. Larson and P. Poupart
Informed Search CS 486/686 University of Waterloo May 0 Outline Using knowledge Heuristics Best-first search Greedy best-first search A* search Other variations of A* Back to heuristics 2 Recall from last
More informationView, evaluate, and publish assignments using the Assignment dropbox.
Blckord Lerning System CE 6 Mnging Assignments Competencies After reding this document, you will e le to: Crete ssignments using the Assignment tool. View, evlute, nd pulish ssignments using the Assignment
More informationContext-Free Grammars
Context-Free Grmmrs Descriing Lnguges We've seen two models for the regulr lnguges: Finite utomt ccept precisely the strings in the lnguge. Regulr expressions descrie precisely the strings in the lnguge.
More informationSuffix trees, suffix arrays, BWT
ALGORITHMES POUR LA BIO-INFORMATIQUE ET LA VISUALISATION COURS 3 Rluc Uricru Suffix trees, suffix rrys, BWT Bsed on: Suffix trees nd suffix rrys presenttion y Him Kpln Suffix trees course y Pco Gomez Liner-Time
More informationFall 2018 Midterm 2 November 15, 2018
Nme: 15-112 Fll 2018 Midterm 2 November 15, 2018 Andrew ID: Recittion Section: ˆ You my not use ny books, notes, extr pper, or electronic devices during this exm. There should be nothing on your desk or
More informationPPS: User Manual. Krishnendu Chatterjee, Martin Chmelik, Raghav Gupta, and Ayush Kanodia
PPS: User Mnul Krishnendu Chtterjee, Mrtin Chmelik, Rghv Gupt, nd Ayush Knodi IST Austri (Institute of Science nd Technology Austri), Klosterneuurg, Austri In this section we descrie the tool fetures,
More information12-B FRACTIONS AND DECIMALS
-B Frctions nd Decimls. () If ll four integers were negtive, their product would be positive, nd so could not equl one of them. If ll four integers were positive, their product would be much greter thn
More informationInformed Search Lecture 5
Lecture 5 How can we exploit problem-specific knowledge to find solutions more efficiently? Where does this knowledge come from and under what conditions is it useful? 1 Agenda Review: Uninformed Search
More informationCMSC 331 First Midterm Exam
0 00/ 1 20/ 2 05/ 3 15/ 4 15/ 5 15/ 6 20/ 7 30/ 8 30/ 150/ 331 First Midterm Exm 7 October 2003 CMC 331 First Midterm Exm Nme: mple Answers tudent ID#: You will hve seventy-five (75) minutes to complete
More informationBefore We Begin. Introduction to Spatial Domain Filtering. Introduction to Digital Image Processing. Overview (1): Administrative Details (1):
Overview (): Before We Begin Administrtive detils Review some questions to consider Winter 2006 Imge Enhncement in the Sptil Domin: Bsics of Sptil Filtering, Smoothing Sptil Filters, Order Sttistics Filters
More informationCS 241. Fall 2017 Midterm Review Solutions. October 24, Bits and Bytes 1. 3 MIPS Assembler 6. 4 Regular Languages 7.
CS 241 Fll 2017 Midterm Review Solutions Octoer 24, 2017 Contents 1 Bits nd Bytes 1 2 MIPS Assemly Lnguge Progrmming 2 3 MIPS Assemler 6 4 Regulr Lnguges 7 5 Scnning 9 1 Bits nd Bytes 1. Give two s complement
More information