Today. CS 188: Artificial Intelligence Fall Recap: Search. Example: Pancake Problem. Example: Pancake Problem. General Tree Search.
|
|
- Francis Merritt
- 5 years ago
- Views:
Transcription
1 CS 88: Artificil Intelligence Fll 00 Lecture : A* Serch 9//00 A* Serch rph Serch Tody Heuristic Design Dn Klein UC Berkeley Multiple slides from Sturt Russell or Andrew Moore Recp: Serch Exmple: Pncke Prolem Serch prolem: Sttes (configurtions of the world) Successor function: function from sttes to lists of (stte, ction, cost) triples; drwn s grph Strt stte nd gol test Serch tree: Nodes: represent plns for reching sttes Plns hve costs (sum of ction costs) Serch Algorithm: Systemticlly uilds serch tree Chooses n ordering of the fringe (unexplored nodes) Cost: Numer of pnckes flipped Exmple: Pncke Prolem enerl Tree Serch Stte spce grph with costs s weights Action: flip top two Cost: Action: Pth flip to ll rech fourgol: Flip Cost: four, flip three Totl cost: 7
2 Uniform Cost Serch Strtegy: expnd lowest pth cost The good: UCS is complete nd optiml! The d: Explores options in every direction No informtion out gol loction Strt ol c c c [demo: countours UCS] Exmple: Heuristic Function Heuristic: the lrgest pncke tht is still out of plce h(x) 0 Best First (reedy) Exmple: Heuristic Function Strtegy: expnd node tht you think is closest to gol stte Heuristic: estimte of distnce to nerest gol for ech stte A common cse: Best-first tkes you stright to the (wrong) gol Worst-cse: like dlyguided DFS [demo: countours greedy] h(x) Comining UCS nd reedy Uniform-cost orders y pth cost, or ckwrd cost g(n) Best-first orders y gol proximity, or forwrd cost h(n) S d h=6 h=5 h= c h=7 h=6 A* Serch orders y the sum: f(n) = g(n) + h(n) 5 e h= h=0 When should A* terminte? Should we stop when we enqueue gol? A S h = h = B h = No: only stop when we dequeue gol h = 0 Exmple: Teg renger
3 Is A* Optiml? Admissile Heuristics A h = 6 A heuristic h is dmissile (optimistic) if: S h = 7 h = 0 where is the true cost to nerest gol 5 Wht went wrong? Actul d gol cost < estimted good gol cost We need estimtes to e less thn ctul costs! Exmples: 5 Coming up with dmissile heuristics is most of wht s involved in using A* in prctice. Optimlity of A*: Blocking Optimlity of A*: Blocking Nottion: g(n) = cost to node n h(n) = estimted cost from n to the nerest gol (heuristic) f(n) = g(n) + h(n) = estimted totl cost vi n *: lowest cost gol node : nother gol node Proof: Wht could go wrong? We d hve to hve to pop suoptiml gol off the fringe efore * This cn t hppen: Imgine suoptiml gol is on the queue Some node n which is supth of * must lso e on the fringe (why?) n will e popped efore Properties of A* UCS vs A* Contours Uniform-Cost A* Uniform-cost expnded in ll directions Strt ol A* expnds minly towrd the gol, ut does hedge its ets to ensure optimlity Strt ol [demo: countours UCS / A*]
4 Creting Admissile Heuristics Exmple: 8 Puzzle Most of the work in solving hrd serch prolems optimlly is in coming up with dmissile heuristics Often, dmissile heuristics re solutions to relxed prolems, where new ctions re ville 66 Indmissile heuristics re often useful too (why?) 5 Wht re the sttes? How mny sttes? Wht re the ctions? Wht sttes cn I rech from the strt stte? Wht should the costs e? Heuristic: Numer of tiles misplced Why is it dmissile? h(strt) = 8 This is relxedprolem heuristic 8 Puzzle I Averge nodes expnded when optiml pth hs length steps 8 steps steps UCS 6,00.6 x 0 6 TILES 9 7 Wht if we hd n esier 8-puzzle where ny tile could slide ny direction t ny time, ignoring other tiles? Totl Mnhttn distnce Why dmissile? h(strt) = = 8 8 Puzzle II Averge nodes expnded when optiml pth hs length steps 8 steps steps TILES 9 7 MANHATTAN Puzzle III How out using the ctul cost s heuristic? Would it e dmissile? Would we sve on nodes expnded? Wht s wrong with it? Trivil Heuristics, Dominnce Dominnce: h h c if Heuristics form semi-lttice: Mx of dmissile heuristics is dmissile With A*: trde-off etween qulity of estimte nd work per node! Trivil heuristics Bottom of lttice is the zero heuristic (wht does this give us?) Top of lttice is the exct heuristic
5 Other A* Applictions Pthing / routing prolems Resource plnning prolems Root motion plnning Lnguge nlysis Mchine trnsltion Speech recognition Tree Serch: Extr Work! Filure to detect repeted sttes cn cuse exponentilly more work. Why? [demo: pln tiny UCS / A*] rph Serch In BFS, for exmple, we shouldn t other expnding the circled nodes (why?) d c p h q e r q c f p S h q e r q c f p q rph Serch Ide: never expnd stte twice How to implement: Tree serch + list of expnded sttes ( closed set ) Expnd the serch tree node-y-node, ut Before expnding node, check to mke sure its stte is new Importnt: store the closed set s set, not list Cn grph serch wreck completeness? Why/why not? How out optimlity? Optimlity of A* rph Serch Proof: New possile prolem: some n on pth to * isn t in queue when we need it, ecuse some worse n for the sme stte dequeued nd expnded first (disster!) Tke the highest such n in tree Let p e the ncestor of n tht ws on the queue when n ws popped Assume f(p) < f(n) f(n) < f(n ) ecuse n is suoptiml p would hve een expnded efore n Contrdiction! Consistency Wit, how do we know prents hve etter f-vles thn their successors? Couldn t we pop some node n, nd find its child n to hve lower f vlue? YES: h = 0 h = 8 B g = 0 Wht cn we require to prevent these inversions? Consistency: A h = 0 Rel cost must lwys exceed reduction in heuristic Like dmissiility, ut etter! 5
6 Optimlity Tree serch: A* is optiml if heuristic is dmissile (nd non-negtive) UCS is specil cse (h = 0) rph serch: A* optiml if heuristic is consistent UCS optiml (h = 0 is consistent) Consistency implies dmissiility In generl, most nturl dmissile heuristics tend to e consistent, especilly if from relxed prolems Summry: A* A* uses oth ckwrd costs nd (estimtes of) forwrd costs A* is optiml with dmissile heuristics Heuristic design is key: often use relxed prolems Mzeworld Demos 6
Announcements. CS 188: Artificial Intelligence Fall Recap: Search. Today. Example: Pancake Problem. Example: Pancake Problem
Announcements Project : erch It s live! Due 9/. trt erly nd sk questions. It s longer thn most! Need prtner? Come up fter clss or try Pizz ections: cn go to ny, ut hve priority in your own C 88: Artificil
More informationAnnouncements. CS 188: Artificial Intelligence Fall Recap: Search. Today. General Tree Search. Uniform Cost. Lecture 3: A* Search 9/4/2007
CS 88: Artificil Intelligence Fll 2007 Lecture : A* Serch 9/4/2007 Dn Klein UC Berkeley Mny slides over the course dpted from either Sturt Russell or Andrew Moore Announcements Sections: New section 06:
More informationCS 221: Artificial Intelligence Fall 2011
CS 221: Artificil Intelligence Fll 2011 Lecture 2: Serch (Slides from Dn Klein, with help from Sturt Russell, Andrew Moore, Teg Grenger, Peter Norvig) Problem types! Fully observble, deterministic! single-belief-stte
More informationSearch Gone Wrong? CS 188: Artificial Intelligence Fall Today. Announcements. General Tree Search. Recap: Search. Lecture 3: A* Search 9/3/2009
C 88: Artiicil Intelligence Fll 009 erch one Wrong? Lecture : A* erch 9//009 Pieter Aeel UC Berkeley Mny slides rom Dn Klein Announcements Assignments: Project 0 (Python tutoril): due Fridy /8 t 4:59m
More informationCS 188: Artificial Intelligence Fall Search Gone Wrong?
CS 188: Artificial Intelligence Fall 2009 Lecture 3: A* Search 9/3/2009 Pieter Aeel UC Berkeley Many slides from Dan Klein Search Gone Wrong? 1 Announcements Assignments: Project 0 (Python tutorial): due
More informationCSEP 573 Artificial Intelligence Winter 2016
CSEP 573 Artificil Intelligence Winter 2016 Luke Zettlemoyer Problem Spces nd Serch slides from Dn Klein, Sturt Russell, Andrew Moore, Dn Weld, Pieter Abbeel, Ali Frhdi Outline Agents tht Pln Ahed Serch
More informationToday. Search Problems. Uninformed Search Methods. Depth-First Search Breadth-First Search Uniform-Cost Search
Uninformed Serch [These slides were creted by Dn Klein nd Pieter Abbeel for CS188 Intro to AI t UC Berkeley. All CS188 mterils re vilble t http://i.berkeley.edu.] Tody Serch Problems Uninformed Serch Methods
More informationCSCI 446: Artificial Intelligence
CSCI 446: Artificil Intelligence Serch Instructor: Michele Vn Dyne [These slides were creted by Dn Klein nd Pieter Abbeel for CS188 Intro to AI t UC Berkeley. All CS188 mterils re vilble t http://i.berkeley.edu.]
More informationCE 473: Artificial Intelligence. Autumn 2011
CE 473: Artificial Intelligence Autumn 2011 A* Search Luke Zettlemoyer Based on slides from Dan Klein Multiple slides from Stuart Russell or Andrew Moore Today A* Search Heuristic Design Graph search Recap:
More informationCS 343H: Artificial Intelligence
CS 343H: Artificial Intelligence Lecture 4: Informed Search 1/23/2014 Slides courtesy of Dan Klein at UC-Berkeley Unless otherwise noted Today Informed search Heuristics Greedy search A* search Graph search
More informationToday. Informed Search. Graph Search. Heuristics Greedy Search A* Search
Informed Search [These slides were created by Dan Klein and Pieter Abbeel for CS188 Intro to AI at UC Berkeley. All CS188 materials are available at http://ai.berkeley.edu.] Today Informed Search Heuristics
More informationAnnouncements. CS 188: Artificial Intelligence
Announcements Projects: Looking for project partners? --- Come to front after lecture. Try pair programming, not divide-and-conquer Account forms available up front during break and after lecture Assignments
More informationSolving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence
Solving Prolems y Serching CS 486/686: Introduction to Artificil Intelligence 1 Introduction Serch ws one of the first topics studied in AI - Newell nd Simon (1961) Generl Prolem Solver Centrl component
More informationCS 188: Artificial Intelligence
CS 188: Artificial Intelligence Today Informed Search Informed Search Heuristics Greedy Search A* Search Instructor: Marco Alvarez University of Rhode Island (These slides were created/modified by Dan
More informationAI Adjacent Fields. This slide deck courtesy of Dan Klein at UC Berkeley
AI Adjcent Fields Philosophy: Logic, methods of resoning Mind s physicl system Foundtions of lerning, lnguge, rtionlity Mthemtics Forml representtion nd proof Algorithms, computtion, (un)decidility, (in)trctility
More informationSolving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence Winter 2016
Solving Prolems y Serching CS 486/686: Introduction to Artificil Intelligence Winter 2016 1 Introduction Serch ws one of the first topics studied in AI - Newell nd Simon (1961) Generl Prolem Solver Centrl
More informationUninformed Search. Hal Daumé III. Computer Science University of Maryland CS 421: Introduction to Artificial Intelligence 31 Jan 2012
1 Hl Dumé III (me@hl3.nme) Uninformed Serch Hl Dumé III Comuter Science University of Mrylnd me@hl3.nme CS 421: Introduction to Artificil Intelligence 31 Jn 2012 Mny slides courtesy of Dn Klein, Sturt
More informationCSCI 446: Artificial Intelligence
CSCI 446: Artificial Intelligence Informed Search Instructor: Michele Van Dyne [These slides were created by Dan Klein and Pieter Abbeel for CS188 Intro to AI at UC Berkeley. All CS188 materials are available
More informationCS 343: Artificial Intelligence
CS 343: Artificial Intelligence Informed Search Prof. Scott Niekum University of Texas at Austin [These slides based on ones created by Dan Klein and Pieter Abbeel for CS188 Intro to AI at UC Berkeley.
More informationArtificial Intelligence Informed Search
Artificial Intelligence Informed Search Instructors: David Suter and Qince Li Course Delivered @ Harbin Institute of Technology [Many slides adapted from those created by Dan Klein and Pieter Abbeel for
More information2 Computing all Intersections of a Set of Segments Line Segment Intersection
15-451/651: Design & Anlysis of Algorithms Novemer 14, 2016 Lecture #21 Sweep-Line nd Segment Intersection lst chnged: Novemer 8, 2017 1 Preliminries The sweep-line prdigm is very powerful lgorithmic design
More informationCOMP 423 lecture 11 Jan. 28, 2008
COMP 423 lecture 11 Jn. 28, 2008 Up to now, we hve looked t how some symols in n lphet occur more frequently thn others nd how we cn sve its y using code such tht the codewords for more frequently occuring
More informationHeuristic Search. Rob Platt Northeastern University. Some images and slides are used from: AIMA
Heuristic Search Rob Platt Northeastern University Some images and slides are used from: AIMA Recap: What is graph search? Start state Goal state Graph search: find a path from start to goal what are the
More informationInformed Search A* Algorithm
Informed Search A* Algorithm CE417: Introduction to Artificial Intelligence Sharif University of Technology Spring 2018 Soleymani Artificial Intelligence: A Modern Approach, Chapter 3 Most slides have
More informationCS 188: Artificial Intelligence Fall 2008
CS 188: Artificil Intelligence Fll 2008 Lecture 2: Queue-Bsed Serc 9/2/2008 Dn Klein UC Berkeley Mny slides from eiter Sturt Russell or Andrew Moore Announcements Written ssignments: One mini-omework ec
More informationCS311H: Discrete Mathematics. Graph Theory IV. A Non-planar Graph. Regions of a Planar Graph. Euler s Formula. Instructor: Işıl Dillig
CS311H: Discrete Mthemtics Grph Theory IV Instructor: Işıl Dillig Instructor: Işıl Dillig, CS311H: Discrete Mthemtics Grph Theory IV 1/25 A Non-plnr Grph Regions of Plnr Grph The plnr representtion of
More information10.5 Graphing Quadratic Functions
0.5 Grphing Qudrtic Functions Now tht we cn solve qudrtic equtions, we wnt to lern how to grph the function ssocited with the qudrtic eqution. We cll this the qudrtic function. Grphs of Qudrtic Functions
More informationCS 5522: Artificial Intelligence II
CS 5522: Artificial Intelligence II Search Algorithms Instructor: Wei Xu Ohio State University [These slides were adapted from CS188 Intro to AI at UC Berkeley.] Today Agents that Plan Ahead Search Problems
More informationMa/CS 6b Class 1: Graph Recap
M/CS 6 Clss 1: Grph Recp By Adm Sheffer Course Detils Adm Sheffer. Office hour: Tuesdys 4pm. dmsh@cltech.edu TA: Victor Kstkin. Office hour: Tuesdys 7pm. 1:00 Mondy, Wednesdy, nd Fridy. http://www.mth.cltech.edu/~2014-15/2term/m006/
More information521495A: Artificial Intelligence
521495A: Artificial Intelligence Informed Search Lectured by Abdenour Hadid Adjunct Professor, CMVS, University of Oulu Slides adopted from http://ai.berkeley.edu Today Informed Search Heuristics Greedy
More informationHeuristic Search. Robert Platt Northeastern University. Some images and slides are used from: 1. CS188 UC Berkeley 2. RN, AIMA
Heuristic Search Robert Platt Northeastern University Some images and slides are used from: 1. CS188 UC Berkeley 2. RN, AIMA Recap: What is graph search? Start state Goal state Graph search: find a path
More informationLexical Analysis: Constructing a Scanner from Regular Expressions
Lexicl Anlysis: Constructing Scnner from Regulr Expressions Gol Show how to construct FA to recognize ny RE This Lecture Convert RE to n nondeterministic finite utomton (NFA) Use Thompson s construction
More informationIf you are at the university, either physically or via the VPN, you can download the chapters of this book as PDFs.
Lecture 5 Wlks, Trils, Pths nd Connectedness Reding: Some of the mteril in this lecture comes from Section 1.2 of Dieter Jungnickel (2008), Grphs, Networks nd Algorithms, 3rd edition, which is ville online
More informationTries. Yufei Tao KAIST. April 9, Y. Tao, April 9, 2013 Tries
Tries Yufei To KAIST April 9, 2013 Y. To, April 9, 2013 Tries In this lecture, we will discuss the following exct mtching prolem on strings. Prolem Let S e set of strings, ech of which hs unique integer
More informationEXPONENTIAL & POWER GRAPHS
Eponentil & Power Grphs EXPONENTIAL & POWER GRAPHS www.mthletics.com.u Eponentil EXPONENTIAL & Power & Grphs POWER GRAPHS These re grphs which result from equtions tht re not liner or qudrtic. The eponentil
More informationLecture 10 Evolutionary Computation: Evolution strategies and genetic programming
Lecture 10 Evolutionry Computtion: Evolution strtegies nd genetic progrmming Evolution strtegies Genetic progrmming Summry Negnevitsky, Person Eduction, 2011 1 Evolution Strtegies Another pproch to simulting
More informationMa/CS 6b Class 1: Graph Recap
M/CS 6 Clss 1: Grph Recp By Adm Sheffer Course Detils Instructor: Adm Sheffer. TA: Cosmin Pohot. 1pm Mondys, Wednesdys, nd Fridys. http://mth.cltech.edu/~2015-16/2term/m006/ Min ook: Introduction to Grph
More informationThe Greedy Method. The Greedy Method
Lists nd Itertors /8/26 Presenttion for use with the textook, Algorithm Design nd Applictions, y M. T. Goodrich nd R. Tmssi, Wiley, 25 The Greedy Method The Greedy Method The greedy method is generl lgorithm
More informationWhat are suffix trees?
Suffix Trees 1 Wht re suffix trees? Allow lgorithm designers to store very lrge mount of informtion out strings while still keeping within liner spce Allow users to serch for new strings in the originl
More informationFig.25: the Role of LEX
The Lnguge for Specifying Lexicl Anlyzer We shll now study how to uild lexicl nlyzer from specifiction of tokens in the form of list of regulr expressions The discussion centers round the design of n existing
More informationGraphs vs trees up front; use grid too; discuss for BFS, DFS, IDS, UCS Cut back on A* optimality detail; a bit more on importance of heuristics,
Graphs vs trees up front; use grid too; discuss for BFS, DFS, IDS, UCS Cut back on A* optimality detail; a bit more on importance of heuristics, performance data Pattern DBs? General Tree Search function
More informationΕΠΛ323 - Θεωρία και Πρακτική Μεταγλωττιστών
ΕΠΛ323 - Θωρία και Πρακτική Μταγλωττιστών Lecture 3 Lexicl Anlysis Elis Athnsopoulos elisthn@cs.ucy.c.cy Recognition of Tokens if expressions nd reltionl opertors if è if then è then else è else relop
More informationDr. D.M. Akbar Hussain
Dr. D.M. Akr Hussin Lexicl Anlysis. Bsic Ide: Red the source code nd generte tokens, it is similr wht humns will do to red in; just tking on the input nd reking it down in pieces. Ech token is sequence
More informationInformation Retrieval and Organisation
Informtion Retrievl nd Orgnistion Suffix Trees dpted from http://www.mth.tu.c.il/~himk/seminr02/suffixtrees.ppt Dell Zhng Birkeck, University of London Trie A tree representing set of strings { } eef d
More informationHyperbolas. Definition of Hyperbola
CHAT Pre-Clculus Hyperols The third type of conic is clled hyperol. For n ellipse, the sum of the distnces from the foci nd point on the ellipse is fixed numer. For hyperol, the difference of the distnces
More informationPresentation Martin Randers
Presenttion Mrtin Rnders Outline Introduction Algorithms Implementtion nd experiments Memory consumption Summry Introduction Introduction Evolution of species cn e modelled in trees Trees consist of nodes
More informationLanguages. L((a (b)(c))*) = { ε,a,bc,aa,abc,bca,... } εw = wε = w. εabba = abbaε = abba. (a (b)(c)) *
Pln for Tody nd Beginning Next week Interpreter nd Compiler Structure, or Softwre Architecture Overview of Progrmming Assignments The MeggyJv compiler we will e uilding. Regulr Expressions Finite Stte
More informationUnit #9 : Definite Integral Properties, Fundamental Theorem of Calculus
Unit #9 : Definite Integrl Properties, Fundmentl Theorem of Clculus Gols: Identify properties of definite integrls Define odd nd even functions, nd reltionship to integrl vlues Introduce the Fundmentl
More informationCS143 Handout 07 Summer 2011 June 24 th, 2011 Written Set 1: Lexical Analysis
CS143 Hndout 07 Summer 2011 June 24 th, 2011 Written Set 1: Lexicl Anlysis In this first written ssignment, you'll get the chnce to ply round with the vrious constructions tht come up when doing lexicl
More informationSection 10.4 Hyperbolas
66 Section 10.4 Hyperbols Objective : Definition of hyperbol & hyperbols centered t (0, 0). The third type of conic we will study is the hyperbol. It is defined in the sme mnner tht we defined the prbol
More informationMidterm 2 Sample solution
Nme: Instructions Midterm 2 Smple solution CMSC 430 Introduction to Compilers Fll 2012 November 28, 2012 This exm contins 9 pges, including this one. Mke sure you hve ll the pges. Write your nme on the
More informationPremaster Course Algorithms 1 Chapter 6: Shortest Paths. Christian Scheideler SS 2018
Premster Course Algorithms Chpter 6: Shortest Pths Christin Scheieler SS 8 Bsic Grph Algorithms Overview: Shortest pths in DAGs Dijkstr s lgorithm Bellmn-For lgorithm Johnson s metho SS 8 Chpter 6 Shortest
More informationContext-Free Grammars
Context-Free Grmmrs Descriing Lnguges We've seen two models for the regulr lnguges: Finite utomt ccept precisely the strings in the lnguge. Regulr expressions descrie precisely the strings in the lnguge.
More informationCS481: Bioinformatics Algorithms
CS481: Bioinformtics Algorithms Cn Alkn EA509 clkn@cs.ilkent.edu.tr http://www.cs.ilkent.edu.tr/~clkn/teching/cs481/ EXACT STRING MATCHING Fingerprint ide Assume: We cn compute fingerprint f(p) of P in
More informationCS321 Languages and Compiler Design I. Winter 2012 Lecture 5
CS321 Lnguges nd Compiler Design I Winter 2012 Lecture 5 1 FINITE AUTOMATA A non-deterministic finite utomton (NFA) consists of: An input lphet Σ, e.g. Σ =,. A set of sttes S, e.g. S = {1, 3, 5, 7, 11,
More informationCOMBINATORIAL PATTERN MATCHING
COMBINATORIAL PATTERN MATCHING Genomic Repets Exmple of repets: ATGGTCTAGGTCCTAGTGGTC Motivtion to find them: Genomic rerrngements re often ssocited with repets Trce evolutionry secrets Mny tumors re chrcterized
More informationNetwork Interconnection: Bridging CS 571 Fall Kenneth L. Calvert All rights reserved
Network Interconnection: Bridging CS 57 Fll 6 6 Kenneth L. Clvert All rights reserved The Prolem We know how to uild (rodcst) LANs Wnt to connect severl LANs together to overcome scling limits Recll: speed
More informationContext-Free Grammars
Context-Free Grmmrs Descriing Lnguges We've seen two models for the regulr lnguges: Finite utomt ccept precisely the strings in the lnguge. Regulr expressions descrie precisely the strings in the lnguge.
More informationIn the last lecture, we discussed how valid tokens may be specified by regular expressions.
LECTURE 5 Scnning SYNTAX ANALYSIS We know from our previous lectures tht the process of verifying the syntx of the progrm is performed in two stges: Scnning: Identifying nd verifying tokens in progrm.
More informationITEC2620 Introduction to Data Structures
ITEC0 Introduction to Dt Structures Lecture 7 Queues, Priority Queues Queues I A queue is First-In, First-Out = FIFO uffer e.g. line-ups People enter from the ck of the line People re served (exit) from
More informationΕΠΛ323 - Θεωρία και Πρακτική Μεταγλωττιστών. Lecture 3b Lexical Analysis Elias Athanasopoulos
ΕΠΛ323 - Θωρία και Πρακτική Μταγλωττιστών Lecture 3 Lexicl Anlysis Elis Athnsopoulos elisthn@cs.ucy.c.cy RecogniNon of Tokens if expressions nd relnonl opertors if è if then è then else è else relop è
More informationZZ - Advanced Math Review 2017
ZZ - Advnced Mth Review Mtrix Multipliction Given! nd! find the sum of the elements of the product BA First, rewrite the mtrices in the correct order to multiply The product is BA hs order x since B is
More informationGreedy Algorithm. Algorithm Fall Semester
Greey Algorithm Algorithm 0 Fll Semester Optimiztion prolems An optimiztion prolem is one in whih you wnt to fin, not just solution, ut the est solution A greey lgorithm sometimes works well for optimiztion
More informationIntermediate Information Structures
CPSC 335 Intermedite Informtion Structures LECTURE 13 Suffix Trees Jon Rokne Computer Science University of Clgry Cnd Modified from CMSC 423 - Todd Trengen UMD upd Preprocessing Strings We will look t
More information6.3 Volumes. Just as area is always positive, so is volume and our attitudes towards finding it.
6.3 Volumes Just s re is lwys positive, so is volume nd our ttitudes towrds finding it. Let s review how to find the volume of regulr geometric prism, tht is, 3-dimensionl oject with two regulr fces seprted
More informationCSCI 104. Rafael Ferreira da Silva. Slides adapted from: Mark Redekopp and David Kempe
CSCI 0 fel Ferreir d Silv rfsilv@isi.edu Slides dpted from: Mrk edekopp nd Dvid Kempe LOG STUCTUED MEGE TEES Series Summtion eview Let n = + + + + k $ = #%& #. Wht is n? n = k+ - Wht is log () + log ()
More informationCSCI 3130: Formal Languages and Automata Theory Lecture 12 The Chinese University of Hong Kong, Fall 2011
CSCI 3130: Forml Lnguges nd utomt Theory Lecture 12 The Chinese University of Hong Kong, Fll 2011 ndrej Bogdnov In progrmming lnguges, uilding prse trees is significnt tsk ecuse prse trees tell us the
More informationFinite Automata. Lecture 4 Sections Robb T. Koether. Hampden-Sydney College. Wed, Jan 21, 2015
Finite Automt Lecture 4 Sections 3.6-3.7 Ro T. Koether Hmpden-Sydney College Wed, Jn 21, 2015 Ro T. Koether (Hmpden-Sydney College) Finite Automt Wed, Jn 21, 2015 1 / 23 1 Nondeterministic Finite Automt
More informationSuffix trees, suffix arrays, BWT
ALGORITHMES POUR LA BIO-INFORMATIQUE ET LA VISUALISATION COURS 3 Rluc Uricru Suffix trees, suffix rrys, BWT Bsed on: Suffix trees nd suffix rrys presenttion y Him Kpln Suffix trees course y Pco Gomez Liner-Time
More informationFall 2018 Midterm 1 October 11, ˆ You may not ask questions about the exam except for language clarifications.
15-112 Fll 2018 Midterm 1 October 11, 2018 Nme: Andrew ID: Recittion Section: ˆ You my not use ny books, notes, extr pper, or electronic devices during this exm. There should be nothing on your desk or
More informationThe Fundamental Theorem of Calculus
MATH 6 The Fundmentl Theorem of Clculus The Fundmentl Theorem of Clculus (FTC) gives method of finding the signed re etween the grph of f nd the x-xis on the intervl [, ]. The theorem is: FTC: If f is
More informationMTH 146 Conics Supplement
105- Review of Conics MTH 146 Conics Supplement In this section we review conics If ou ne more detils thn re present in the notes, r through section 105 of the ook Definition: A prol is the set of points
More informationthis grammar generates the following language: Because this symbol will also be used in a later step, it receives the
LR() nlysis Drwcks of LR(). Look-hed symols s eplined efore, concerning LR(), it is possile to consult the net set to determine, in the reduction sttes, for which symols it would e possile to perform reductions.
More informationLexical Analysis. Amitabha Sanyal. (www.cse.iitb.ac.in/ as) Department of Computer Science and Engineering, Indian Institute of Technology, Bombay
Lexicl Anlysis Amith Snyl (www.cse.iit.c.in/ s) Deprtment of Computer Science nd Engineering, Indin Institute of Technology, Bomy Septemer 27 College of Engineering, Pune Lexicl Anlysis: 2/6 Recp The input
More informationMinimal Memory Abstractions
Miniml Memory Astrtions (As implemented for BioWre Corp ) Nthn Sturtevnt University of Alert GAMES Group Ferury, 7 Tlk Overview Prt I: Building Astrtions Minimizing memory requirements Performnes mesures
More informationQuestions About Numbers. Number Systems and Arithmetic. Introduction to Binary Numbers. Negative Numbers?
Questions About Numbers Number Systems nd Arithmetic or Computers go to elementry school How do you represent negtive numbers? frctions? relly lrge numbers? relly smll numbers? How do you do rithmetic?
More informationCompression Outline :Algorithms in the Real World. Lempel-Ziv Algorithms. LZ77: Sliding Window Lempel-Ziv
Compression Outline 15-853:Algorithms in the Rel World Dt Compression III Introduction: Lossy vs. Lossless, Benchmrks, Informtion Theory: Entropy, etc. Proility Coding: Huffmn + Arithmetic Coding Applictions
More informationGrade 7/8 Math Circles Geometric Arithmetic October 31, 2012
Fculty of Mthemtics Wterloo, Ontrio N2L 3G1 Grde 7/8 Mth Circles Geometric Arithmetic Octoer 31, 2012 Centre for Eduction in Mthemtics nd Computing Ancient Greece hs given irth to some of the most importnt
More informationCS 432 Fall Mike Lam, Professor a (bc)* Regular Expressions and Finite Automata
CS 432 Fll 2017 Mike Lm, Professor (c)* Regulr Expressions nd Finite Automt Compiltion Current focus "Bck end" Source code Tokens Syntx tree Mchine code chr dt[20]; int min() { flot x = 42.0; return 7;
More information1.5 Extrema and the Mean Value Theorem
.5 Extrem nd the Men Vlue Theorem.5. Mximum nd Minimum Vlues Definition.5. (Glol Mximum). Let f : D! R e function with domin D. Then f hs n glol mximum vlue t point c, iff(c) f(x) for ll x D. The vlue
More informationDefinition of Regular Expression
Definition of Regulr Expression After the definition of the string nd lnguges, we re redy to descrie regulr expressions, the nottion we shll use to define the clss of lnguges known s regulr sets. Recll
More informationWhat do all those bits mean now? Number Systems and Arithmetic. Introduction to Binary Numbers. Questions About Numbers
Wht do ll those bits men now? bits (...) Number Systems nd Arithmetic or Computers go to elementry school instruction R-formt I-formt... integer dt number text chrs... floting point signed unsigned single
More informationpdfapilot Server 2 Manual
pdfpilot Server 2 Mnul 2011 by clls softwre gmbh Schönhuser Allee 6/7 D 10119 Berlin Germny info@cllssoftwre.com www.cllssoftwre.com Mnul clls pdfpilot Server 2 Pge 2 clls pdfpilot Server 2 Mnul Lst modified:
More informationSimplifying Algebra. Simplifying Algebra. Curriculum Ready.
Simplifying Alger Curriculum Redy www.mthletics.com This ooklet is ll out turning complex prolems into something simple. You will e le to do something like this! ( 9- # + 4 ' ) ' ( 9- + 7-) ' ' Give this
More informationApplied Databases. Sebastian Maneth. Lecture 13 Online Pattern Matching on Strings. University of Edinburgh - February 29th, 2016
Applied Dtses Lecture 13 Online Pttern Mtching on Strings Sestin Mneth University of Edinurgh - Ferury 29th, 2016 2 Outline 1. Nive Method 2. Automton Method 3. Knuth-Morris-Prtt Algorithm 4. Boyer-Moore
More informationOrthogonal line segment intersection
Computtionl Geometry [csci 3250] Line segment intersection The prolem (wht) Computtionl Geometry [csci 3250] Orthogonl line segment intersection Applictions (why) Algorithms (how) A specil cse: Orthogonl
More informationSuffix Tries. Slides adapted from the course by Ben Langmead
Suffix Tries Slides dpted from the course y Ben Lngmed en.lngmed@gmil.com Indexing with suffixes Until now, our indexes hve een sed on extrcting sustrings from T A very different pproch is to extrct suffixes
More information1.1. Interval Notation and Set Notation Essential Question When is it convenient to use set-builder notation to represent a set of numbers?
1.1 TEXAS ESSENTIAL KNOWLEDGE AND SKILLS Prepring for 2A.6.K, 2A.7.I Intervl Nottion nd Set Nottion Essentil Question When is it convenient to use set-uilder nottion to represent set of numers? A collection
More informationRegular Expression Matching with Multi-Strings and Intervals. Philip Bille Mikkel Thorup
Regulr Expression Mtching with Multi-Strings nd Intervls Philip Bille Mikkel Thorup Outline Definition Applictions Previous work Two new problems: Multi-strings nd chrcter clss intervls Algorithms Thompson
More informationSlides for Data Mining by I. H. Witten and E. Frank
Slides for Dt Mining y I. H. Witten nd E. Frnk Simplicity first Simple lgorithms often work very well! There re mny kinds of simple structure, eg: One ttriute does ll the work All ttriutes contriute eqully
More informationQubit allocation for quantum circuit compilers
Quit lloction for quntum circuit compilers Nov. 10, 2017 JIQ 2017 Mrcos Yukio Sirichi Sylvin Collnge Vinícius Fernndes dos Sntos Fernndo Mgno Quintão Pereir Compilers for quntum computing The first genertion
More informationAlgorithm Design (5) Text Search
Algorithm Design (5) Text Serch Tkshi Chikym School of Engineering The University of Tokyo Text Serch Find sustring tht mtches the given key string in text dt of lrge mount Key string: chr x[m] Text Dt:
More informationImplementing Automata. CSc 453. Compilers and Systems Software. 4 : Lexical Analysis II. Department of Computer Science University of Arizona
Implementing utomt Sc 5 ompilers nd Systems Softwre : Lexicl nlysis II Deprtment of omputer Science University of rizon collerg@gmil.com opyright c 009 hristin ollerg NFs nd DFs cn e hrd-coded using this
More informationLecture T1: Pattern Matching
Introduction to Theoreticl CS Lecture T: Pttern Mtchin Two fundmentl questions. Wht cn computer do? Wht cn computer do with limited resources? Generl pproch. Don t tlk out specific mchines or prolems.
More informationPPS: User Manual. Krishnendu Chatterjee, Martin Chmelik, Raghav Gupta, and Ayush Kanodia
PPS: User Mnul Krishnendu Chtterjee, Mrtin Chmelik, Rghv Gupt, nd Ayush Knodi IST Austri (Institute of Science nd Technology Austri), Klosterneuurg, Austri In this section we descrie the tool fetures,
More informationA Comparison of High-Level Approaches for Speeding Up Pathfinding
A Comprison of High-Level Approches for Speeding Up Pthfinding Nthn R. Sturtevnt Deprtment of Computing Science University of Alert Edmonton, Alert, Cnd nthnst@cs.ulert.c Roert Geiserger Fculty of Informtics
More informationUnit 5 Vocabulary. A function is a special relationship where each input has a single output.
MODULE 3 Terms Definition Picture/Exmple/Nottion 1 Function Nottion Function nottion is n efficient nd effective wy to write functions of ll types. This nottion llows you to identify the input vlue with
More informationInformed Search. Xiaojin Zhu Computer Sciences Department University of Wisconsin, Madison
Informed Search Xiaojin Zhu jerryzhu@cs.wisc.edu Computer Sciences Department University of Wisconsin, Madison [Based on slides from Andrew Moore http://www.cs.cmu.edu/~awm/tutorials ] slide 1 Main messages
More information9.1 apply the distance and midpoint formulas
9.1 pply the distnce nd midpoint formuls DISTANCE FORMULA MIDPOINT FORMULA To find the midpoint between two points x, y nd x y 1 1,, we Exmple 1: Find the distnce between the two points. Then, find the
More informationGraphs with at most two trees in a forest building process
Grphs with t most two trees in forest uilding process rxiv:802.0533v [mth.co] 4 Fe 208 Steve Butler Mis Hmnk Mrie Hrdt Astrct Given grph, we cn form spnning forest y first sorting the edges in some order,
More information