Outline CS 412/413. Function calls. Stack layout. Tiling a call. Two translations

Size: px
Start display at page:

Download "Outline CS 412/413. Function calls. Stack layout. Tiling a call. Two translations"

Transcription

1 CS 412/413 Introduction to Compilers nd Trnsltors Cornell University Andrew Myers Outline Implementing function clls Implementing functions Optimizing wy the pointer Dynmiclly-llocted structures strings nd rrys Register lloction the esy wy Lectur7 Finishing bsic genertion 3 Mrch 00 CS 412/413 Spring '00 Lectur7 -- Andrew Myers 2 Function clls How to generte for function clls? Two kinds of IR sttements in cnonicl form dest f EXP f bp old bp Stck lyout current stck bp old bp current stck new stck CS 412/413 Spring '00 Lectur7 -- Andrew Myers 3 CS 412/413 Spring '00 Lectur7 -- Andrew Myers 4 dest f non-risc push push dd, 4*n Two trnsltions RISC sub, 4*n mov [ + 4],... mov [ + 4*n], dd, 4*n CS 412/413 Spring '00 Lectur7 -- Andrew Myers 5 old? f Tiling cll push push dd, 4*n Problem doesn t fit into tiling prdigm; unbounded # tiles required Solution don t fold e i into tile Downside genertes lot of extr temporries f push t n push t 1 dd, 4*n CS 412/413 Spring '00 Lectur7 -- Andrew Myers 6 1

2 Compiling function bodies Function body S Z f () T = e [ = (RV, E Z e [) S Z f () = e [ = EXP(E Z e [) Vribles E Z v [ = TEMP(t v ) for E Z v [ = MEM(TEMP(FP) + k) for rgs Try it out f(x int, yint) = x + y CS 412/413 Spring '00 Lectur7 -- Andrew Myers 7 Abstrct ssembly for f f(x int, yint) = x + y RV + MEM MEM + + FP 8 FP 12 Wht s missing here? CS 412/413 Spring '00 Lectur7 -- Andrew Myers 8 Stck setup Need to set up stck on entry prev push bp mov bp, sub, 4*l mov, bp pop bp new new prev prev. prev. new new stck l Function f push bp mov bp, function prologue sub, 4*l f_epilogue mov, bp pop bp function epilogue CS 412/413 Spring '00 Lectur7 -- Andrew Myers 9 CS 412/413 Spring '00 Lectur7 -- Andrew Myers 10 Compiling urn Iot urn sttement urns immeditely from function. Trnsltion S Z urn e [ = SEQ((RV, E Z e [), JUMP(epilogue)) Every function f hs f prologue epilogue lbel f_epilogue body epilogue CS 412/413 Spring '00 Lectur7 -- Andrew Myers 11 The Glory of Pentium CISC f push ebp mov ebp,e sub e, 4*l f_epilogue mov e, ebp pop ebp enter 4*l, 0 f_epilogue leve CS 412/413 Spring '00 Lectur7 -- Andrew Myers 12 2

3 Optimizing wy ebp Ide mintin constnt offset k between pointer nd stck pointer Use RISC-style rgument pssing rther thn pushing rguments on stck All references to MEM(FP+n) trnslted to opernd [e+(n+k)] insted of to [ebp+n] Advntge get whole extr register to use when llocting registers (7!) CS 412/413 Spring '00 Lectur7 -- Andrew Myers 13 prev. prev Stck setup sub, 4*l dd, 4*l + 4*l prev prev new mx rg ce new stck (size 4*l) CS 412/413 Spring '00 Lectur7 -- Andrew Myers 14 Cvets Get even fster (nd RISC-core) prologue nd epilogue thn with enter/leve but Must sve ebp register if we wnt to use it (like e, cllee-sve) Doesn t work if stck is truly vrible-sized e.g., lloc() cll in C lloctes vrible-sized rry on the stck -- not problem in Iot where rrys hep-llocted Dynmic structures Modern progrmming lnguges llow dynmiclly llocted dt structures strings, rrys, objects C chr *x = (chr *)mlloc(strlen(s) + 1); C++ Foo *f = new Foo(); Jv Foo f = new Foo(); String s = s1 + s2; Iot x rry[int] = new int[5] (0); String s = s1 + s2; CS 412/413 Spring '00 Lectur7 -- Andrew Myers 15 CS 412/413 Spring '00 Lectur7 -- Andrew Myers 16 Progrm Hep Progrm hs 4 memory res segment, stck segment, sttic dt, hep Two typicl memory lyouts (OS-dep.) hep sttic dt stck stck hep sttic dt CS 412/413 Spring '00 Lectur7 -- Andrew Myers 17 Object lloction Dynmic objects llocted in the hep rry cretion, string conctention mlloc(n) urns new chunk of n bytes, free(x) releses memory strting t x Globls stticlly llocted in dt segment globl vribles string constnts ssembler supports dt segment declrtions stck hep sttic dt CS 412/413 Spring '00 Lectur7 -- Andrew Myers 18 3

4 rry[t] Iot dynmic structures.length elements of new T [n] ( e ) = mlloc(4*n + 4); MEM() = n; = + 4; 1 = ; 2 = + 4*n; while ( 1!= 2 ) ( MEM( 1 ) = E Ze[; 1 = ); PA4 We give you newrry, newstring clls with grbge collection support (no free cll needed) CS 412/413 Spring '00 Lectur7 -- Andrew Myers 19 Trivil register lloction Cn convert bstrct ssembly to rel ssembly esily (but generte bd ) Allocte every temporry to loction in the current stck rther thn to register Every temporry stored in different plce -- no possibility of conflict Three registers needed to shuttle dt in nd out of stck (mx. # registers used by one instruction) e.g, ex, ebx, ecx CS 412/413 Spring '00 Lectur7 -- Andrew Myers 20 Rewriting bstrct Given instruction, replce every temporry in instruction with one of three registers Add mov instructions before instruction to lod registers properly Add mov instructions fter instruction to put dt bck onto stck (if necessry) push t1 mov ex, [ - t1off]; push ex mov [+4], t3? dd t1, [ - 4]? Result Simple wy to get working Code is longer thn necessry, slower Also cn llocte temporries to registers until registers run out (3 temporries on Pentium, 20+ on MIPS, Alph) Code genertion technique ctully used by some compilers when ll optimiztion turned off (-O0) Will use for Progrmming Assignment 4 CS 412/413 Spring '00 Lectur7 -- Andrew Myers 21 CS 412/413 Spring '00 Lectur7 -- Andrew Myers 22 Summry Complete genertion technique Use tiling to perform instruction selection Arguments mpped to stck loctions, to temporries Function generted by gluing prologue, epilogue onto body Dynmic structure lloction hndled by relying on hep lloction routines (mlloc) Sttic structures llocted by dt segment ssembler declrtions Allocte temporries to stck loctions to eliminte use of unbounded # of registers Shuttle temporries in nd out using ex-ecx regs CS 412/413 Spring '00 Lectur7 -- Andrew Myers 23 Where we re High-level source Assembly CS 412/413 Spring '00 Lectur7 -- Andrew Myers 24 4

5 Further topics Generting better register lloction optimiztion (high- nd low-level) dtflow nlysis Supporting lnguge fetures objects, modules, polymorphism, first-clss functions, exceptions dvnced GC techniques dynmic linking, loding, & PIC dynmic types nd reflection Compiler-like progrms source-to-source trnsltion interpers CS 412/413 Spring '00 Lectur7 -- Andrew Myers 25 5

Outline. Tiling, formally. Expression tile as rule. Statement tiles as rules. Function calls. CS 412 Introduction to Compilers

Outline. Tiling, formally. Expression tile as rule. Statement tiles as rules. Function calls. CS 412 Introduction to Compilers CS 412 Introduction to Compilers Andrew Myers Cornell University Lectur8 Finishing genertion 9 Mr 01 Outline Tiling s syntx-directed trnsltion Implementing function clls Implementing functions Optimizing

More information

CPSC 213. Polymorphism. Introduction to Computer Systems. Readings for Next Two Lectures. Back to Procedure Calls

CPSC 213. Polymorphism. Introduction to Computer Systems. Readings for Next Two Lectures. Back to Procedure Calls Redings for Next Two Lectures Text CPSC 213 Switch Sttements, Understnding Pointers - 2nd ed: 3.6.7, 3.10-1st ed: 3.6.6, 3.11 Introduction to Computer Systems Unit 1f Dynmic Control Flow Polymorphism nd

More information

Virtual Machine (Part I)

Virtual Machine (Part I) Hrvrd University CS Fll 2, Shimon Schocken Virtul Mchine (Prt I) Elements of Computing Systems Virtul Mchine I (Ch. 7) Motivtion clss clss Min Min sttic sttic x; x; function function void void min() min()

More information

Allocator Basics. Dynamic Memory Allocation in the Heap (malloc and free) Allocator Goals: malloc/free. Internal Fragmentation

Allocator Basics. Dynamic Memory Allocation in the Heap (malloc and free) Allocator Goals: malloc/free. Internal Fragmentation Alloctor Bsics Dynmic Memory Alloction in the Hep (mlloc nd free) Pges too corse-grined for llocting individul objects. Insted: flexible-sized, word-ligned blocks. Allocted block (4 words) Free block (3

More information

Virtual Machine I: Stack Arithmetic

Virtual Machine I: Stack Arithmetic Virtul Mchine I: Stck Arithmetic Building Modern Computer From First Principles www.nnd2tetris.org Elements of Computing Systems, Nisn & Schocken, MIT Press, www.nnd2tetris.org, Chpter 7: Virtul Mchine

More information

Some Thoughts on Grad School. Undergraduate Compilers Review and Intro to MJC. Structure of a Typical Compiler. Lexing and Parsing

Some Thoughts on Grad School. Undergraduate Compilers Review and Intro to MJC. Structure of a Typical Compiler. Lexing and Parsing Undergrdute Compilers Review nd Intro to MJC Announcements Miling list is in full swing Tody Some thoughts on grd school Finish prsing Semntic nlysis Visitor pttern for bstrct syntx trees Some Thoughts

More information

MIPS I/O and Interrupt

MIPS I/O and Interrupt MIPS I/O nd Interrupt Review Floting point instructions re crried out on seprte chip clled coprocessor 1 You hve to move dt to/from coprocessor 1 to do most common opertions such s printing, clling functions,

More information

From Dependencies to Evaluation Strategies

From Dependencies to Evaluation Strategies From Dependencies to Evlution Strtegies Possile strtegies: 1 let the user define the evlution order 2 utomtic strtegy sed on the dependencies: use locl dependencies to determine which ttriutes to compute

More information

CS201 Discussion 10 DRAWTREE + TRIES

CS201 Discussion 10 DRAWTREE + TRIES CS201 Discussion 10 DRAWTREE + TRIES DrwTree First instinct: recursion As very generic structure, we could tckle this problem s follows: drw(): Find the root drw(root) drw(root): Write the line for the

More information

Languages. L((a (b)(c))*) = { ε,a,bc,aa,abc,bca,... } εw = wε = w. εabba = abbaε = abba. (a (b)(c)) *

Languages. L((a (b)(c))*) = { ε,a,bc,aa,abc,bca,... } εw = wε = w. εabba = abbaε = abba. (a (b)(c)) * Pln for Tody nd Beginning Next week Interpreter nd Compiler Structure, or Softwre Architecture Overview of Progrmming Assignments The MeggyJv compiler we will e uilding. Regulr Expressions Finite Stte

More information

Sample Midterm Solutions COMS W4115 Programming Languages and Translators Monday, October 12, 2009

Sample Midterm Solutions COMS W4115 Programming Languages and Translators Monday, October 12, 2009 Deprtment of Computer cience Columbi University mple Midterm olutions COM W4115 Progrmming Lnguges nd Trnsltors Mondy, October 12, 2009 Closed book, no ids. ch question is worth 20 points. Question 5(c)

More information

Stack. A list whose end points are pointed by top and bottom

Stack. A list whose end points are pointed by top and bottom 4. Stck Stck A list whose end points re pointed by top nd bottom Insertion nd deletion tke plce t the top (cf: Wht is the difference between Stck nd Arry?) Bottom is constnt, but top grows nd shrinks!

More information

520 Principles of Programming Languages. Memory Management. Memory Management... 35: Garbage Collection

520 Principles of Programming Languages. Memory Management. Memory Management... 35: Garbage Collection Dynmic Memory Mngement 50 Principles of Progrmming Lnguges 35: Grbge Collection Christin Collberg collberg@cs.rizon.edu Deprtment of Computer Science University of Arizon The run-time system linked in

More information

CS412/CS413. Introduction to Compilers Tim Teitelbaum. Lecture 21: Generating Pentium Code 10 March 08

CS412/CS413. Introduction to Compilers Tim Teitelbaum. Lecture 21: Generating Pentium Code 10 March 08 CS412/CS413 Introduction to Compilers Tim Teitelbaum Lecture 21: Generating Pentium Code 10 March 08 CS 412/413 Spring 2008 Introduction to Compilers 1 Simple Code Generation Three-address code makes it

More information

Agenda & Reading. Class Exercise. COMPSCI 105 SS 2012 Principles of Computer Science. Arrays

Agenda & Reading. Class Exercise. COMPSCI 105 SS 2012 Principles of Computer Science. Arrays COMPSCI 5 SS Principles of Computer Science Arrys & Multidimensionl Arrys Agend & Reding Agend Arrys Creting & Using Primitive & Reference Types Assignments & Equlity Pss y Vlue & Pss y Reference Copying

More information

Symbol Table management

Symbol Table management TDDD Compilers nd interpreters TDDB44 Compiler Construction Symol Tles Symol Tles in the Compiler Symol Tle mngement source progrm Leicl nlysis Syntctic nlysis Semntic nlysis nd Intermedite code gen Code

More information

CS 430 Spring Mike Lam, Professor. Parsing

CS 430 Spring Mike Lam, Professor. Parsing CS 430 Spring 2015 Mike Lm, Professor Prsing Syntx Anlysis We cn now formlly descrie lnguge's syntx Using regulr expressions nd BNF grmmrs How does tht help us? Syntx Anlysis We cn now formlly descrie

More information

Where we are. Instruction selection. Abstract Assembly. CS 4120 Introduction to Compilers

Where we are. Instruction selection. Abstract Assembly. CS 4120 Introduction to Compilers Where we are CS 420 Introduction to Compilers Andrew Myers Cornell University Lecture 8: Instruction Selection 5 Oct 20 Intermediate code Canonical intermediate code Abstract assembly code Assembly code

More information

Midterm 2 Sample solution

Midterm 2 Sample solution Nme: Instructions Midterm 2 Smple solution CMSC 430 Introduction to Compilers Fll 2012 November 28, 2012 This exm contins 9 pges, including this one. Mke sure you hve ll the pges. Write your nme on the

More information

Memory Management Functions

Memory Management Functions Meory Mngeent Functions Chpter 9 Meory Mngeent Process of binding vlues to eory loctions Vlues y be sttic or dynic Vlues re ssigned t different plces Sttic eory Run-tie stck Hep 1 Meory Mngeent Sttic Meory

More information

Control-Flow Analysis and Loop Detection

Control-Flow Analysis and Loop Detection ! Control-Flow Anlysis nd Loop Detection!Lst time! PRE!Tody! Control-flow nlysis! Loops! Identifying loops using domintors! Reducibility! Using loop identifiction to identify induction vribles CS553 Lecture

More information

Stack Manipulation. Other Issues. How about larger constants? Frame Pointer. PowerPC. Alternative Architectures

Stack Manipulation. Other Issues. How about larger constants? Frame Pointer. PowerPC. Alternative Architectures Other Issues Stck Mnipultion support for procedures (Refer to section 3.6), stcks, frmes, recursion mnipulting strings nd pointers linkers, loders, memory lyout Interrupts, exceptions, system clls nd conventions

More information

Page 1. Memory Allocation and Usage CSE 361S. Different free lists for different size classes

Page 1. Memory Allocation and Usage CSE 361S. Different free lists for different size classes Keeping Trck o Free Blocks Method 1: : Implicit list using lengths -- links ll blocks Memory Alloction nd Usge Method : : Explicit list mong the ree blocks using pointers within the ree blocks CSE 361S

More information

Variables vs. Registers/Memory. Simple Approach. Register Allocation. Interference Graph. Register Allocation Algorithm CS412/CS413

Variables vs. Registers/Memory. Simple Approach. Register Allocation. Interference Graph. Register Allocation Algorithm CS412/CS413 Variables vs. Registers/Memory CS412/CS413 Introduction to Compilers Tim Teitelbaum Lecture 33: Register Allocation 18 Apr 07 Difference between IR and assembly code: IR (and abstract assembly) manipulate

More information

Fig.25: the Role of LEX

Fig.25: the Role of LEX The Lnguge for Specifying Lexicl Anlyzer We shll now study how to uild lexicl nlyzer from specifiction of tokens in the form of list of regulr expressions The discussion centers round the design of n existing

More information

Discussion 1 Recap. COP4600 Discussion 2 OS concepts, System call, and Assignment 1. Questions. Questions. Outline. Outline 10/24/2010

Discussion 1 Recap. COP4600 Discussion 2 OS concepts, System call, and Assignment 1. Questions. Questions. Outline. Outline 10/24/2010 COP4600 Discussion 2 OS concepts, System cll, nd Assignment 1 TA: Hufeng Jin hj0@cise.ufl.edu Discussion 1 Recp Introduction to C C Bsic Types (chr, int, long, flot, doule, ) C Preprocessors (#include,

More information

Process Layout and Function Calls

Process Layout and Function Calls Process Layout and Function Calls CS 6 Spring 07 / 8 Process Layout in Memory Stack grows towards decreasing addresses. is initialized at run-time. Heap grow towards increasing addresses. is initialized

More information

Should be done. Do Soon. Structure of a Typical Compiler. Plan for Today. Lab hours and Office hours. Quiz 1 is due tonight, was posted Tuesday night

Should be done. Do Soon. Structure of a Typical Compiler. Plan for Today. Lab hours and Office hours. Quiz 1 is due tonight, was posted Tuesday night Should e done L hours nd Office hours Sign up for the miling list t, strting to send importnt info to list http://groups.google.com/group/cs453-spring-2011 Red Ch 1 nd skim Ch 2 through 2.6, red 3.3 nd

More information

Mid-term exam. Scores. Fall term 2012 KAIST EE209 Programming Structures for EE. Thursday Oct 25, Student's name: Student ID:

Mid-term exam. Scores. Fall term 2012 KAIST EE209 Programming Structures for EE. Thursday Oct 25, Student's name: Student ID: Fll term 2012 KAIST EE209 Progrmming Structures for EE Mid-term exm Thursdy Oct 25, 2012 Student's nme: Student ID: The exm is closed book nd notes. Red the questions crefully nd focus your nswers on wht

More information

Data Flow on a Queue Machine. Bruno R. Preiss. Copyright (c) 1987 by Bruno R. Preiss, P.Eng. All rights reserved.

Data Flow on a Queue Machine. Bruno R. Preiss. Copyright (c) 1987 by Bruno R. Preiss, P.Eng. All rights reserved. Dt Flow on Queue Mchine Bruno R. Preiss 2 Outline Genesis of dt-flow rchitectures Sttic vs. dynmic dt-flow rchitectures Pseudo-sttic dt-flow execution model Some dt-flow mchines Simple queue mchine Prioritized

More information

Geometric transformations

Geometric transformations Geometric trnsformtions Computer Grphics Some slides re bsed on Shy Shlom slides from TAU mn n n m m T A,,,,,, 2 1 2 22 12 1 21 11 Rows become columns nd columns become rows nm n n m m A,,,,,, 1 1 2 22

More information

CS 241. Fall 2017 Midterm Review Solutions. October 24, Bits and Bytes 1. 3 MIPS Assembler 6. 4 Regular Languages 7.

CS 241. Fall 2017 Midterm Review Solutions. October 24, Bits and Bytes 1. 3 MIPS Assembler 6. 4 Regular Languages 7. CS 241 Fll 2017 Midterm Review Solutions Octoer 24, 2017 Contents 1 Bits nd Bytes 1 2 MIPS Assemly Lnguge Progrmming 2 3 MIPS Assemler 6 4 Regulr Lnguges 7 5 Scnning 9 1 Bits nd Bytes 1. Give two s complement

More information

CSc 453. Compilers and Systems Software. 4 : Lexical Analysis II. Department of Computer Science University of Arizona

CSc 453. Compilers and Systems Software. 4 : Lexical Analysis II. Department of Computer Science University of Arizona CSc 453 Compilers nd Systems Softwre 4 : Lexicl Anlysis II Deprtment of Computer Science University of Arizon collerg@gmil.com Copyright c 2009 Christin Collerg Implementing Automt NFAs nd DFAs cn e hrd-coded

More information

Outlines. Dynamic Memory Dynamic Memory Dynamic Memory The malloc Package. malloc Example

Outlines. Dynamic Memory Dynamic Memory Dynamic Memory The malloc Package. malloc Example Outlines Dynmic Memory Alloc@on CSCI 01: Mchine Architecture nd Orgniz@on Bsic concepts Implicit free lists Explicit free lists Pen- Chung Yew Deprtment Computer Science nd Engineering University of Minnesot

More information

cisc1110 fall 2010 lecture VI.2 call by value function parameters another call by value example:

cisc1110 fall 2010 lecture VI.2 call by value function parameters another call by value example: cisc1110 fll 2010 lecture VI.2 cll y vlue function prmeters more on functions more on cll y vlue nd cll y reference pssing strings to functions returning strings from functions vrile scope glol vriles

More information

ECE 468/573 Midterm 1 September 28, 2012

ECE 468/573 Midterm 1 September 28, 2012 ECE 468/573 Midterm 1 September 28, 2012 Nme:! Purdue emil:! Plese sign the following: I ffirm tht the nswers given on this test re mine nd mine lone. I did not receive help from ny person or mteril (other

More information

W4118: PC Hardware and x86. Junfeng Yang

W4118: PC Hardware and x86. Junfeng Yang W4118: PC Hardware and x86 Junfeng Yang A PC How to make it do something useful? 2 Outline PC organization x86 instruction set gcc calling conventions PC emulation 3 PC board 4 PC organization One or more

More information

Keeping Track of Free Blocks The course that gives CMU its Zip! Dynamic Memory Allocation II Nov 7, Allocating From Explicit Free Lists

Keeping Track of Free Blocks The course that gives CMU its Zip! Dynamic Memory Allocation II Nov 7, Allocating From Explicit Free Lists Dynmic Memory Alloction II Nov 7, 2002 clss22.ppt 15-213 The course tht gives CMU its Zip! Topics Explicit doubly-linked ree lists Segregted ree lists Grbge collection Memory-relted perils nd pitlls Keeping

More information

Reference types and their characteristics Class Definition Constructors and Object Creation Special objects: Strings and Arrays

Reference types and their characteristics Class Definition Constructors and Object Creation Special objects: Strings and Arrays Objects nd Clsses Reference types nd their chrcteristics Clss Definition Constructors nd Object Cretion Specil objects: Strings nd Arrys OOAD 1999/2000 Cludi Niederée, Jochim W. Schmidt Softwre Systems

More information

Scope, Functions, and Storage Management

Scope, Functions, and Storage Management Scope, Functions, nd Storge Mngement Block-structured lnguges nd stck storge In-le Blocks (previous set of overheds) ctivtion records storge for locl, glol vriles First-order functions (previous set of

More information

Creating Flexible Interfaces. Friday, 24 April 2015

Creating Flexible Interfaces. Friday, 24 April 2015 Creting Flexible Interfces 1 Requests, not Objects Domin objects re esy to find but they re not t the design center of your ppliction. Insted, they re trp for the unwry. Sequence digrms re vehicle for

More information

Arrays as functions. Types. Multidimensional Arrays (row major, column major form) Java arrays

Arrays as functions. Types. Multidimensional Arrays (row major, column major form) Java arrays Louden Chpters 6,9 Types Dt Types nd Abstrct Dt Types 1 Arrys s functons f: U -> V (f U s ordnl type) f() rry C rrys types cn be wthout szes rry vrbles must hve fxed sze rry_mx( [], sze) // prmeters re

More information

Small Business Networking

Small Business Networking Why network is n essentil productivity tool for ny smll business Effective technology is essentil for smll businesses looking to increse the productivity of their people nd processes. Introducing technology

More information

box Boxes and Arrows 3 true 7.59 'X' An object is drawn as a box that contains its data members, for example:

box Boxes and Arrows 3 true 7.59 'X' An object is drawn as a box that contains its data members, for example: Boxes nd Arrows There re two kinds of vriles in Jv: those tht store primitive vlues nd those tht store references. Primitive vlues re vlues of type long, int, short, chr, yte, oolen, doule, nd flot. References

More information

Pointer Analysis. CSE 501 Spring 15

Pointer Analysis. CSE 501 Spring 15 Pointer Anlysis CSE 501 Sring 15 Course Outline St8c nlysis Dtflow nd strct interret8on Alic8ons We re here Beyond generl- urose lnguges Progrm Verific8on Dynmic nlysis New comilers Tody Intro to ointer

More information

Implementing Automata. CSc 453. Compilers and Systems Software. 4 : Lexical Analysis II. Department of Computer Science University of Arizona

Implementing Automata. CSc 453. Compilers and Systems Software. 4 : Lexical Analysis II. Department of Computer Science University of Arizona Implementing utomt Sc 5 ompilers nd Systems Softwre : Lexicl nlysis II Deprtment of omputer Science University of rizon collerg@gmil.com opyright c 009 hristin ollerg NFs nd DFs cn e hrd-coded using this

More information

x86 assembly CS449 Spring 2016

x86 assembly CS449 Spring 2016 x86 assembly CS449 Spring 2016 CISC vs. RISC CISC [Complex instruction set Computing] - larger, more feature-rich instruction set (more operations, addressing modes, etc.). slower clock speeds. fewer general

More information

Assembly Language: Function Calls" Goals of this Lecture"

Assembly Language: Function Calls Goals of this Lecture Assembly Language: Function Calls" 1 Goals of this Lecture" Help you learn:" Function call problems:" Calling and urning" Passing parameters" Storing local variables" Handling registers without interference"

More information

Scanner Termination. Multi Character Lookahead. to its physical end. Most parsers require an end of file token. Lex and Jlex automatically create an

Scanner Termination. Multi Character Lookahead. to its physical end. Most parsers require an end of file token. Lex and Jlex automatically create an Scnner Termintion A scnner reds input chrcters nd prtitions them into tokens. Wht hppens when the end of the input file is reched? It my be useful to crete n Eof pseudo-chrcter when this occurs. In Jv,

More information

Winter Compiler Construction T11 Activation records + Introduction to x86 assembly. Today. Tips for PA4. Today:

Winter Compiler Construction T11 Activation records + Introduction to x86 assembly. Today. Tips for PA4. Today: Winter 2006-2007 Compiler Construction T11 Activation records + Introduction to x86 assembly Mooly Sagiv and Roman Manevich School of Computer Science Tel-Aviv University Today ic IC Language Lexical Analysis

More information

IA-32 Architecture. CS 4440/7440 Malware Analysis and Defense

IA-32 Architecture. CS 4440/7440 Malware Analysis and Defense IA-32 Architecture CS 4440/7440 Malware Analysis and Defense Intel x86 Architecture } Security professionals constantly analyze assembly language code } Many exploits are written in assembly } Source code

More information

Small Business Networking

Small Business Networking Why network is n essentil productivity tool for ny smll business Effective technology is essentil for smll businesses looking to increse the productivity of their people nd business. Introducing technology

More information

Code Generation. Lecture 30

Code Generation. Lecture 30 Code Generation Lecture 30 (based on slides by R. Bodik) 11/14/06 Prof. Hilfinger CS164 Lecture 30 1 Lecture Outline Stack machines The MIPS assembly language The x86 assembly language A simple source

More information

CMSC 313 COMPUTER ORGANIZATION & ASSEMBLY LANGUAGE PROGRAMMING

CMSC 313 COMPUTER ORGANIZATION & ASSEMBLY LANGUAGE PROGRAMMING CMSC 313 COMPUTER ORGANIZATION & ASSEMBLY LANGUAGE PROGRAMMING LECTURE 16, SPRING 2013 TOPICS TODAY Project 6 Perils & Pitfalls of Memory Allocation C Function Call Conventions in Assembly Language PERILS

More information

Small Business Networking

Small Business Networking Why network is n essentil productivity tool for ny smll business Effective technology is essentil for smll businesses looking to increse the productivity of their people nd business. Introducing technology

More information

Subprograms: Local Variables

Subprograms: Local Variables Subprograms: Local Variables ICS312 Machine-Level and Systems Programming Henri Casanova (henric@hawaii.edu) Local Variables in Subprograms In all the examples we have seen so far, the subprograms were

More information

Small Business Networking

Small Business Networking Why network is n essentil productivity tool for ny smll business Effective technology is essentil for smll businesses looking to increse the productivity of their people nd business. Introducing technology

More information

Small Business Networking

Small Business Networking Why network is n essentil productivity tool for ny smll business Effective technology is essentil for smll businesses looking to increse the productivity of their people nd processes. Introducing technology

More information

Small Business Networking

Small Business Networking Why network is n essentil productivity tool for ny smll business Effective technology is essentil for smll businesses looking to increse the productivity of their people nd processes. Introducing technology

More information

Small Business Networking

Small Business Networking Why network is n essentil productivity tool for ny smll business Effective technology is essentil for smll businesses looking to increse the productivity of their people nd processes. Introducing technology

More information

EECE.3170: Microprocessor Systems Design I Summer 2017 Homework 4 Solution

EECE.3170: Microprocessor Systems Design I Summer 2017 Homework 4 Solution 1. (40 points) Write the following subroutine in x86 assembly: Recall that: int f(int v1, int v2, int v3) { int x = v1 + v2; urn (x + v3) * (x v3); Subroutine arguments are passed on the stack, and can

More information

CS241 Computer Organization Spring 2015 IA

CS241 Computer Organization Spring 2015 IA CS241 Computer Organization Spring 2015 IA-32 2-10 2015 Outline! Review HW#3 and Quiz#1! More on Assembly (IA32) move instruction (mov) memory address computation arithmetic & logic instructions (add,

More information

Systems Architecture I

Systems Architecture I Systems Architecture I Topics Assemblers, Linkers, and Loaders * Alternative Instruction Sets ** *This lecture was derived from material in the text (sec. 3.8-3.9). **This lecture was derived from material

More information

Lecture Outline. Code Generation. Lecture 30. Example of a Stack Machine Program. Stack Machines

Lecture Outline. Code Generation. Lecture 30. Example of a Stack Machine Program. Stack Machines Lecture Outline Code Generation Lecture 30 (based on slides by R. Bodik) Stack machines The MIPS assembly language The x86 assembly language A simple source language Stack-machine implementation of the

More information

See P&H 2.8 and 2.12, and A.5-6. Prof. Hakim Weatherspoon CS 3410, Spring 2015 Computer Science Cornell University

See P&H 2.8 and 2.12, and A.5-6. Prof. Hakim Weatherspoon CS 3410, Spring 2015 Computer Science Cornell University See P&H 2.8 and 2.12, and A.5-6 Prof. Hakim Weatherspoon CS 3410, Spring 2015 Computer Science Cornell University Upcoming agenda PA1 due yesterday PA2 available and discussed during lab section this week

More information

Lecture #16: Introduction to Runtime Organization. Last modified: Fri Mar 19 00:17: CS164: Lecture #16 1

Lecture #16: Introduction to Runtime Organization. Last modified: Fri Mar 19 00:17: CS164: Lecture #16 1 Lecture #16: Introduction to Runtime Organization Last modified: Fri Mar 19 00:17:19 2010 CS164: Lecture #16 1 Status Lexical analysis Produces tokens Detects & eliminates illegal tokens Parsing Produces

More information

In the last lecture, we discussed how valid tokens may be specified by regular expressions.

In the last lecture, we discussed how valid tokens may be specified by regular expressions. LECTURE 5 Scnning SYNTAX ANALYSIS We know from our previous lectures tht the process of verifying the syntx of the progrm is performed in two stges: Scnning: Identifying nd verifying tokens in progrm.

More information

Pointers and Arrays. More Pointer Examples. Pointers CS 217

Pointers and Arrays. More Pointer Examples. Pointers CS 217 Pointers nd Arrs CS 21 1 2 Pointers More Pointer Emples Wht is pointer A vrile whose vlue is the ddress of nother vrile p is pointer to vrile v Opertions &: ddress of (reference) *: indirection (dereference)

More information

Small Business Networking

Small Business Networking Why network is n essentil productivity tool for ny smll business Effective technology is essentil for smll businesses looking to increse the productivity of their people nd business. Introducing technology

More information

16 Bit Software Tools ADDU-21xx-PC-1 Code Generation and Simulation

16 Bit Software Tools ADDU-21xx-PC-1 Code Generation and Simulation 16 Bit Softwre Tools ADDU-21xx-PC-1 Code Genertion nd Simultion ADDS-21xx-PC-1 Version 6.1 Contents The entire softwre cretion tool chin in one pckge System Builder Assembler C Compiler Linker Softwre

More information

Reducing Costs with Duck Typing. Structural

Reducing Costs with Duck Typing. Structural Reducing Costs with Duck Typing Structurl 1 Duck Typing In computer progrmming with object-oriented progrmming lnguges, duck typing is lyer of progrmming lnguge nd design rules on top of typing. Typing

More information

LING/C SC/PSYC 438/538. Lecture 21 Sandiway Fong

LING/C SC/PSYC 438/538. Lecture 21 Sandiway Fong LING/C SC/PSYC 438/538 Lecture 21 Sndiwy Fong Tody's Topics Homework 8 Review Optionl Homework 9 (mke up on Homework 7) Homework 8 Review Question1: write Prolog regulr grmmr for the following lnguge:

More information

binary trees, expression trees

binary trees, expression trees COMP 250 Lecture 21 binry trees, expression trees Oct. 27, 2017 1 Binry tree: ech node hs t most two children. 2 Mximum number of nodes in binry tree? Height h (e.g. 3) 3 Mximum number of nodes in binry

More information

Compiler construction. x86 architecture. This lecture. Lecture 6: Code generation for x86. x86: assembly for a real machine.

Compiler construction. x86 architecture. This lecture. Lecture 6: Code generation for x86. x86: assembly for a real machine. This lecture Compiler construction Lecture 6: Code generation for x86 Magnus Myreen Spring 2018 Chalmers University of Technology Gothenburg University x86 architecture s Some x86 instructions From LLVM

More information

Assembly Language: Function Calls" Goals of this Lecture"

Assembly Language: Function Calls Goals of this Lecture Assembly Language: Function Calls" 1 Goals of this Lecture" Help you learn:" Function call problems:" Calling and returning" Passing parameters" Storing local variables" Handling registers without interference"

More information

Example: 2:1 Multiplexer

Example: 2:1 Multiplexer Exmple: 2:1 Multiplexer Exmple #1 reg ; lwys @( or or s) egin if (s == 1') egin = ; else egin = ; 1 s B. Bs 114 Exmple: 2:1 Multiplexer Exmple #2 Normlly lwys include egin nd sttements even though they

More information

Engineer-to-Engineer Note

Engineer-to-Engineer Note Engineer-to-Engineer Note EE-069 Technicl notes on using Anlog Devices DSPs, processors nd development tools Visit our Web resources http://www.nlog.com/ee-notes nd http://www.nlog.com/processors or e-mil

More information

Today s Lecture. Basics of Logic Design: Boolean Algebra, Logic Gates. Recursive Example. Review: The C / C++ code. Recursive Example (Continued)

Today s Lecture. Basics of Logic Design: Boolean Algebra, Logic Gates. Recursive Example. Review: The C / C++ code. Recursive Example (Continued) Tod s Lecture Bsics of Logic Design: Boolen Alger, Logic Gtes Alvin R. Leeck CPS 4 Lecture 8 Homework #2 Due Ferur 3 Outline Review (sseml recursion) Building the uilding locks Logic Design Truth tles,

More information

Data sharing in OpenMP

Data sharing in OpenMP Dt shring in OpenMP Polo Burgio polo.burgio@unimore.it Outline Expressing prllelism Understnding prllel threds Memory Dt mngement Dt cluses Synchroniztion Brriers, locks, criticl sections Work prtitioning

More information

Presentation Martin Randers

Presentation Martin Randers Presenttion Mrtin Rnders Outline Introduction Algorithms Implementtion nd experiments Memory consumption Summry Introduction Introduction Evolution of species cn e modelled in trees Trees consist of nodes

More information

Compilers I - Chapter 6: Optimisation and data-flow analysis

Compilers I - Chapter 6: Optimisation and data-flow analysis Compilers I - Chpter 6: Optimistion nd dt-flow nlysis Lecturers: Prt I: Pul Kelly (phjk@doc.ic.c.uk) Office: room 304, Willim Penney Building Prt II: Nrnker Duly (nd@doc.ic.c.uk) Mterils: Office: room

More information

Caches I. CSE 351 Autumn 2018

Caches I. CSE 351 Autumn 2018 Cches I CSE 351 Autumn 2018 Instructors: Mx Willsey Luis Ceze Teching Assistnts: Britt Henderson Luks Joswik Josie Lee Wei Lin Dniel Snitkovsky Luis Veg Kory Wtson Ivy Yu Alt text: I looked t some of the

More information

Assembly Language: Function Calls. Goals of this Lecture. Function Call Problems

Assembly Language: Function Calls. Goals of this Lecture. Function Call Problems Assembly Language: Function Calls 1 Goals of this Lecture Help you learn: Function call problems: Calling and urning Passing parameters Storing local variables Handling registers without interference Returning

More information

Small Business Networking

Small Business Networking Why network is n essentil productivity tool for ny smll business Effective technology is essentil for smll businesses looking to increse the productivity of their people nd processes. Introducing technology

More information

We ve written these as a grammar, but the grammar also stands for an abstract syntax tree representation of the IR.

We ve written these as a grammar, but the grammar also stands for an abstract syntax tree representation of the IR. CS 4120 Lecture 14 Syntax-directed translation 26 September 2011 Lecturer: Andrew Myers We want to translate from a high-level programming into an intermediate representation (IR). This lecture introduces

More information

Readings : Computer Networking. Outline. The Next Internet: More of the Same? Required: Relevant earlier meeting:

Readings : Computer Networking. Outline. The Next Internet: More of the Same? Required: Relevant earlier meeting: Redings 15-744: Computer Networking L-14 Future Internet Architecture Required: Servl pper Extr reding on Mobility First Relevnt erlier meeting: CCN -> Nmed Dt Network 2 Outline The Next Internet: More

More information

Caches I. CSE 351 Autumn Instructor: Justin Hsia

Caches I. CSE 351 Autumn Instructor: Justin Hsia L01: Intro, L01: L16: Combintionl Introduction Cches I Logic CSE369, CSE351, Autumn 2016 Cches I CSE 351 Autumn 2016 Instructor: Justin Hsi Teching Assistnts: Chris M Hunter Zhn John Kltenbch Kevin Bi

More information

How to Design REST API? Written Date : March 23, 2015

How to Design REST API? Written Date : March 23, 2015 Visul Prdigm How Design REST API? Turil How Design REST API? Written Dte : Mrch 23, 2015 REpresenttionl Stte Trnsfer, n rchitecturl style tht cn be used in building networked pplictions, is becoming incresingly

More information

Real-Time Programming in Java

Real-Time Programming in Java ARTIST2 Summer School 2008 in Europe Autrns (ner Grenole), Frnce Septemer 8-12, 8 2008 Rel-Time Progrmming in Jv Rel-Time in the Age of Complex Systems Invited Speker: Dvid F. Bcon IBM Reserch 0 Clssicl

More information

Code Generation. Lecture 31 (courtesy R. Bodik) CS164 Lecture14 Fall2004 1

Code Generation. Lecture 31 (courtesy R. Bodik) CS164 Lecture14 Fall2004 1 Code Generation Lecture 31 (courtesy R. Bodik) CS164 Lecture14 Fall2004 1 Lecture Outline Stack machines The MIPS assembly language The x86 assembly language A simple source language Stack-machine implementation

More information

4/29/18 FIBONACCI NUMBERS GOLDEN RATIO, RECURRENCES. Fibonacci function. Fibonacci (Leonardo Pisano) ? Statue in Pisa Italy

4/29/18 FIBONACCI NUMBERS GOLDEN RATIO, RECURRENCES. Fibonacci function. Fibonacci (Leonardo Pisano) ? Statue in Pisa Italy /9/8 Fioncci (Leonrdo Pisno) -? Sttue in Pis Itly FIBONACCI NUERS GOLDEN RATIO, RECURRENCES Lecture CS Spring 8 Fioncci function fi() fi() fi(n) fi(n-) + fi(n-) for n,,,,,, 8,,, In his ook in titled Lier

More information

Outline. Unresolved references

Outline. Unresolved references Outline CS 4120 Introduction to Compilers Andrew Myers Cornell University Lecture 36: Linking and Loading 21 Nov 11 Static linking Object files Libraries Shared libraries Relocatable Dynamic linking explicit

More information

Instruction Selection. Problems. DAG Tiling. Pentium ISA. Example Tiling CS412/CS413. Introduction to Compilers Tim Teitelbaum

Instruction Selection. Problems. DAG Tiling. Pentium ISA. Example Tiling CS412/CS413. Introduction to Compilers Tim Teitelbaum Instruction Selection CS42/CS43 Introduction to Compilers Tim Teitelbaum Lecture 32: More Instruction Selection 20 Apr 05. Translate low-level IR code into DAG representation 2. Then find a good tiling

More information

Functor (1A) Young Won Lim 8/2/17

Functor (1A) Young Won Lim 8/2/17 Copyright (c) 2016-2017 Young W. Lim. Permission is grnted to copy, distribute nd/or modify this document under the terms of the GNU Free Documenttion License, Version 1.2 or ny lter version published

More information

Exam #1 for Computer Simulation Spring 2005

Exam #1 for Computer Simulation Spring 2005 Exm # for Computer Simultion Spring 005 >>> SOLUTION

More information

COMBINATORIAL PATTERN MATCHING

COMBINATORIAL PATTERN MATCHING COMBINATORIAL PATTERN MATCHING Genomic Repets Exmple of repets: ATGGTCTAGGTCCTAGTGGTC Motivtion to find them: Genomic rerrngements re often ssocited with repets Trce evolutionry secrets Mny tumors re chrcterized

More information

Dr. D.M. Akbar Hussain

Dr. D.M. Akbar Hussain Dr. D.M. Akr Hussin Lexicl Anlysis. Bsic Ide: Red the source code nd generte tokens, it is similr wht humns will do to red in; just tking on the input nd reking it down in pieces. Ech token is sequence

More information

Page. Harsh Reality. Dynamic Memory Allocation. Malloc Package. Process Memory Image. Assumptions. Malloc Example

Page. Harsh Reality. Dynamic Memory Allocation. Malloc Package. Process Memory Image. Assumptions. Malloc Example Hrsh Relity Memory Mtters Memory is not unbounded It must be llocted nd mnged 1 Mny lictions re memory dominted Esecilly those bsed on comlex, grh lgorithms Memory referencing bugs esecilly ernicious Effects

More information

Administration CS 412/413. Advanced Language Support. First-class vs. Second-class. First-class functions. Function Types

Administration CS 412/413. Advanced Language Support. First-class vs. Second-class. First-class functions. Function Types Administration CS 412/413 Introduction to Compilers and Translators Andrew Myers Cornell University Lecture 33: First-class functions 21 April 00 Programming Assignment 6 handed out today register allocation

More information

Coprocessor memory definition. Loic Pallardy / Arnaud Pouliquen

Coprocessor memory definition. Loic Pallardy / Arnaud Pouliquen Coprocessor memory definition Loic Pllrdy / Arnud Pouliquen Objective 2 The gol of following slides is to sum up on-going discussion in OpenAP weekly bout Remoteproc/Rpmsg memory lloction. Following proposl

More information