Dr. D.M. Akbar Hussain

Size: px
Start display at page:

Download "Dr. D.M. Akbar Hussain"

Transcription

1 Dr. D.M. Akr Hussin Lexicl Anlysis. Bsic Ide: Red the source code nd generte tokens, it is similr wht humns will do to red in; just tking on the input nd reking it down in pieces. Ech token is sequence of chrcters representing some informtion. Possile Types of Token: Keywords: if, while, Specil Symols: +, *, <, >.. Identifiers: User defined strings of chrcters.. Scnning is specil cse of pttern mtching: Method used re Regulr Expressions nd Finite Automt. 1 Lexicl Anlysis. It is simple ut time consuming process: Must e efficient Responsiility is to recognize tokens nothing else: int foo 1; foo int 1 ; Wht is the out come? Is this its jo? (Syntx nlysis.) Lexicl nlysis my lso perform one or more of the following: Deleting comments. Inserting line numers. Evluting constnts. (this is controversil, whether it should e done here or not) Compiler Construction F6S/Chpter 1

2 Dr. D.M. Akr Hussin Scnning Genertor #include.. #include min() { chr in; in getch ( ); if ( islph (in) ) in getch ( ); else error (); while ( islph (in) isdigit (in) ) in getch ( ); } For n identifier Regulr Expressions (RE) RE represent pttern of strings composed of chrcters. It is very convenient method to represent identifiers nd constnt. A lnguge is set of strings. String is finite sequence of symols. Symols themselves re tken from finite lphet. RE r is defined y set of strings with which it mtches: L(r) Which mens r contin chrcters (could e lphet + specil symols e.g. met-chrcters). Some Bsic RE: L(x) {x} Expression mtches x. L() {} Empty string with no chrcters. L(Ø) { } Ø mtches no string (empty set). 4 Compiler Construction F6S/Chpter

3 Dr. D.M. Akr Hussin RE Opertions Choice (lterntion) Conctention Repetition Choice: Given two RE M nd N, it is written with the lterntion opertor (verticl r) s M N. A string is in the lnguge M N if it is in the lnguge M or in the lnguge N. It is union, e.g., for lnguge it contins strings nd. L( ) L() U L() {,} Conctention: Given two RE M nd N, conctention opertor mkes new RE M.N. Which mens string is in the lnguge M.N if it is the conctention of ny two strings nd such tht is in lnguge M nd is in the lnguge N. e.g.: ( ). defines the lnguge contining nd. e.g.: S1 {, }, S {, } S1.S {,,, } 5 RE Opertions Repetition: Given RE M its repetition is M* (lso clled kleene closure). A string is in the lnguge M* if it is conctention of zero or more strings ll of which re in M. e.g.: * mtches,,,,,. * {}UUUU.. U * n 0 Bsiclly it is infinite set of union. Rememer ech element is finite conctention of strings. n e.g. ( )*,,,,,,,, 0 e.g. (0 1)*.0 0, 00,10,010, (Binry numers) 6 Compiler Construction F6S/Chpter

4 Dr. D.M. Akr Hussin RE Opertions *?? ( )* ()* ( )*,,,,,,, ()*,,,,,. * Hs the highest precedence then conctention nd lterntion Some short cuts (revitions): c mens (.) c ( ) mens ( ) [cd] men ( c d) [ - g] mens [cdefg] 7 RE Opertions Extension Why it is required: Exmple: * repetition zero or more, this could e prolem for nturl numers, we need to hve one instnce in which it gurntees tht we hve mtch, disllowing the empty string. Binry numer exmple: (0 1)* Although, we cn solve it y: (0 1) (0 1)*, 0, 00, 11,.. But this is simple sitution nd it is esy, ut things my not e tht simple in lnguge. So the solution is M + (M.M*). 8 Compiler Construction F6S/Chpter 4

5 Dr. D.M. Akr Hussin Extension RE Opertions Another Sitution Demnds: ny chrcter Common requirement is to hve mtch of ny chrcter in the lphet. Which mens we hve to literlly write ech chrcter with lterntion. The extension is to use met chrcter. period, which gives the option not to put every chrcter lterntive. Exmple:.*.* lest one. True for ll strings contining t 9 Rnge of Chrcters Usully we do like this for rnge of chrcters: c d.. z So the extension is [ - z] [0-9] Any Chrcter not in given set: It is not possile to get to sitution, where we hve RE for ll chrcters except one chrcter. Tilde or Crt cn e used. For exmple: ~ chrcter which is not ~( c) chrcter which is neither, or c. In Lex: ^, ^( c) Optionl Occurrence: M? (M ) 10 Compiler Construction F6S/Chpter 5

6 Dr. D.M. Akr Hussin RE Nottions An ordinry chrcter stnds for itself The empty string M N Alterntion choosing from M or N M.N / MN Conctention, n M followed y N M* Repetition zero or more times M + Repetition one or more times M? Optionl, Zero or one occurrence of M [-za-z] Chrcter set lterntion. Period, ny single chrcter except new line ~M /^M A chrcter which is not M (Tilde or Crt).+* Quottion, string in quotes stnds for itself literlly 11 Finite Automt RE re very convenient for specifying token, ut some formlism is required to implement it. Finite utomt is mthemticl wy of descriing mchines. In prticulr for the process of recognizing input tokens FA is the proper formlism. FA re the est construct to implement scnners. Forml Definition: FA is finite utomton with finite set of sttes. Edges led from one stte to other sttes. Ech edge is leled with symol. One is unique strt stte nd some re finl sttes. 1 Compiler Construction F6S/Chpter 6

7 Dr. D.M. Akr Hussin Finite Automt strt ccept letter [ za Z] digit [0 9] letter letter 1 Ole, Ole004 digit O 1 l e O 1 l e Exmple Finite Automt for Rel digit digit digit Compiler Construction F6S/Chpter 7

8 Dr. D.M. Akr Hussin Deterministic Finite Automt (DFA) In DFA no two edges leving from sme stte re leled with the sme symol. It follows: Strting from the strt stte utomton follows exctly one pth (edge) to get to the next stte. The edge hs to e leled with the input chrcter. After mking n trnsitions for n long chrcter string, if the utomton is in the finl stte. It ccepts it otherwise rejects. A - Z Fox exmple for n ID: A - Z Deterministic Finite Automt (DFA) Lst exmple hs no such provision for exmple if there is chrcter other thn lphet. A - Z A - Z 1 ID other other 0-9 error 16 Compiler Construction F6S/Chpter 8

9 Dr. D.M. Akr Hussin Exmples of DFA Signed nturl numer (+ -)?digit Signed numer (+ -)?digit.?digit Exmples of DFA * * 1 ( )* Compiler Construction F6S/Chpter 9

10 Dr. D.M. Akr Hussin DFA Conventions Error trnsitions re not explicitly shown. Input symols tht result in the sme trnsition re grouped together (this set cn even e given nme). Still not displyed: stopping conditions nd ctions. Principle of Longest Su-string (or Mximl Munch): o The DFA mtches the longest possile input string efore stopping. 19 Non Deterministic Finite Automt (NFA) DFA ctully does not represent every thing, it provide us n outline of its opertions. Mthemticlly, DFA must hve trnsition for every stte nd chrcter. Wht ction is to e tken when n error occurs. Wht ction is to e tken when n ccepting condition reched. 0 Compiler Construction F6S/Chpter 10

11 Dr. D.M. Akr Hussin Non Deterministic Finite Automt (NFA) 6 Bsiclly NFA is n utomton which hs choice of edges, leled with the sme symols to follow out of stte. Or it cn hve specil edge leled with tht cn e followed without eting ny symol from the input (without consulting the input) NFA Exmple Compiler Construction F6S/Chpter 11

12 Dr. D.M. Akr Hussin How to NFA Suppose we hve three tokens :, <, : : : < < How to NFA : : < < Suppose we hve tokens <, <>, < cn we do tht < < < > < <> < 4 Compiler Construction F6S/Chpter 1

13 Dr. D.M. Akr Hussin How to NFA Solution: < < > <> others < 5 How to NFA : : < < 6 Compiler Construction F6S/Chpter 1

14 Dr. D.M. Akr Hussin NFA [+ * *] The definition of NFA is similr ut we need to expnd the lphet set to include. 1 which cn e ccepted y ny of the Following sequences: NFA c RE ( c)* c c Compiler Construction F6S/Chpter 14

15 Dr. D.M. Akr Hussin RE to DFAs RE nd DFAs re equivlent. However RE re preferred over DFAs ecuse of their compctness in token description. Typiclly, scnner genertion strts with RE nd through DFAs finlly end with scnner progrm. Generlly, this trnsltion construct n intermedite construction using NFA which finlly construct the DFA. There is possiility of direct construction from RE to DFA ut generlly not preferred ecuse of complexity. RE NFA DFA PRO 9 Thomson Construction It construct mchine y using the trnsition to glue together the mchines for ech piece of RE, which corresponds to the whole expression. 0 Compiler Construction F6S/Chpter 15

16 Dr. D.M. Akr Hussin Thomson Construction Conctention: RE MN so Thomson construction follows: M M N Alterntion/Choice: RE M N so Thomson construction follows: M N 1 Thomson Construction Repetition: RE M* so Thomson construction follows: M Thomson construction is not unique, there re other possiilities e.g., for MN: M N However, it is only possile if the ccepting stte hs no trnsitions to other sttes. Compiler Construction F6S/Chpter 16

17 Dr. D.M. Akr Hussin Suset Construction (NFA to DFA) Oviously, first thing to remove is trnsitions nd second the multiple trnsitions from stte on single chrcter input. 1 For exmple: RE M* 4 closure of single stte S is set of sttes rechle y series of zero or more trnsitions nd denoted y S. 1 {1,, 4}, {}, {,, 4}, 4 {4} {1,, 4} {,, 4} Suset Construction Exmple RE * 1 {, 6, 1}, {}, {, 4}, 4 {4}, 5 {8, 5}, 6 {6} 7 {8, 7}, 8 {8} {, 6, 1} {, 4, 7, 8} {5, 8} 4 Compiler Construction F6S/Chpter 17

18 Dr. D.M. Akr Hussin Another Exmple (First NFA) RE ( )* Suset Construction 0 {0,1,,4,7} 1 {1,,4} {} {,6,1,,4,7} 4 {4} 5 {5,6,1,,4,7} 6 {6,1,,4,7} 7 {7} 8 {8} 9 {9} 10 {10} {0,1,,4,7} {1,,4,5,6,7} {1,,,4,6,7,8} {1,,4,5,6,7,9} {1,,4,5,6,7,10} 6 Compiler Construction F6S/Chpter 18

19 Dr. D.M. Akr Hussin Minimiztion of Sttes in DFA For *: We hve seen tht derivtion from RE to DFA result in more sttes (complex). Building scnner with more sttes is not going to e pprecited. But good news is tht FA theory sttes tht for given DFA there is n equivlent DFA contining minimum sttes. This minimum stte DFA is unique. 7 Minimiztion of Sttes in DFA Divide the given set of sttes into: Accepting sttes Not ccepting sttes ( )* Actul DFA 1 Minimized Version {1} {, } 8 Compiler Construction F6S/Chpter 19

20 Dr. D.M. Akr Hussin Exmple DFA for C comments other / * * / other other * / * * / other? 9 TINY DFA For Numers nd Identifiers digit INNUM white spce digit letter letter INID [other] [other] START DONE + - * / < ( ) ; 40 Compiler Construction F6S/Chpter 0

21 Dr. D.M. Akr Hussin TINY DFA For Scnner digit INNUM START white spce digit letter : letter INID INASSIGN [other] [other] DONE [other] { } other INCOMMENT other 41 Compiler Construction F6S/Chpter 1

Definition of Regular Expression

Definition of Regular Expression Definition of Regulr Expression After the definition of the string nd lnguges, we re redy to descrie regulr expressions, the nottion we shll use to define the clss of lnguges known s regulr sets. Recll

More information

In the last lecture, we discussed how valid tokens may be specified by regular expressions.

In the last lecture, we discussed how valid tokens may be specified by regular expressions. LECTURE 5 Scnning SYNTAX ANALYSIS We know from our previous lectures tht the process of verifying the syntx of the progrm is performed in two stges: Scnning: Identifying nd verifying tokens in progrm.

More information

Topic 2: Lexing and Flexing

Topic 2: Lexing and Flexing Topic 2: Lexing nd Flexing COS 320 Compiling Techniques Princeton University Spring 2016 Lennrt Beringer 1 2 The Compiler Lexicl Anlysis Gol: rek strem of ASCII chrcters (source/input) into sequence of

More information

Lexical Analysis: Constructing a Scanner from Regular Expressions

Lexical Analysis: Constructing a Scanner from Regular Expressions Lexicl Anlysis: Constructing Scnner from Regulr Expressions Gol Show how to construct FA to recognize ny RE This Lecture Convert RE to n nondeterministic finite utomton (NFA) Use Thompson s construction

More information

Fig.25: the Role of LEX

Fig.25: the Role of LEX The Lnguge for Specifying Lexicl Anlyzer We shll now study how to uild lexicl nlyzer from specifiction of tokens in the form of list of regulr expressions The discussion centers round the design of n existing

More information

CS 432 Fall Mike Lam, Professor a (bc)* Regular Expressions and Finite Automata

CS 432 Fall Mike Lam, Professor a (bc)* Regular Expressions and Finite Automata CS 432 Fll 2017 Mike Lm, Professor (c)* Regulr Expressions nd Finite Automt Compiltion Current focus "Bck end" Source code Tokens Syntx tree Mchine code chr dt[20]; int min() { flot x = 42.0; return 7;

More information

CS321 Languages and Compiler Design I. Winter 2012 Lecture 5

CS321 Languages and Compiler Design I. Winter 2012 Lecture 5 CS321 Lnguges nd Compiler Design I Winter 2012 Lecture 5 1 FINITE AUTOMATA A non-deterministic finite utomton (NFA) consists of: An input lphet Σ, e.g. Σ =,. A set of sttes S, e.g. S = {1, 3, 5, 7, 11,

More information

Reducing a DFA to a Minimal DFA

Reducing a DFA to a Minimal DFA Lexicl Anlysis - Prt 4 Reducing DFA to Miniml DFA Input: DFA IN Assume DFA IN never gets stuck (dd ded stte if necessry) Output: DFA MIN An equivlent DFA with the minimum numer of sttes. Hrry H. Porter,

More information

ΕΠΛ323 - Θεωρία και Πρακτική Μεταγλωττιστών

ΕΠΛ323 - Θεωρία και Πρακτική Μεταγλωττιστών ΕΠΛ323 - Θωρία και Πρακτική Μταγλωττιστών Lecture 3 Lexicl Anlysis Elis Athnsopoulos elisthn@cs.ucy.c.cy Recognition of Tokens if expressions nd reltionl opertors if è if then è then else è else relop

More information

CS412/413. Introduction to Compilers Tim Teitelbaum. Lecture 4: Lexical Analyzers 28 Jan 08

CS412/413. Introduction to Compilers Tim Teitelbaum. Lecture 4: Lexical Analyzers 28 Jan 08 CS412/413 Introduction to Compilers Tim Teitelum Lecture 4: Lexicl Anlyzers 28 Jn 08 Outline DFA stte minimiztion Lexicl nlyzers Automting lexicl nlysis Jlex lexicl nlyzer genertor CS 412/413 Spring 2008

More information

Languages. L((a (b)(c))*) = { ε,a,bc,aa,abc,bca,... } εw = wε = w. εabba = abbaε = abba. (a (b)(c)) *

Languages. L((a (b)(c))*) = { ε,a,bc,aa,abc,bca,... } εw = wε = w. εabba = abbaε = abba. (a (b)(c)) * Pln for Tody nd Beginning Next week Interpreter nd Compiler Structure, or Softwre Architecture Overview of Progrmming Assignments The MeggyJv compiler we will e uilding. Regulr Expressions Finite Stte

More information

CS143 Handout 07 Summer 2011 June 24 th, 2011 Written Set 1: Lexical Analysis

CS143 Handout 07 Summer 2011 June 24 th, 2011 Written Set 1: Lexical Analysis CS143 Hndout 07 Summer 2011 June 24 th, 2011 Written Set 1: Lexicl Anlysis In this first written ssignment, you'll get the chnce to ply round with the vrious constructions tht come up when doing lexicl

More information

Assignment 4. Due 09/18/17

Assignment 4. Due 09/18/17 Assignment 4. ue 09/18/17 1. ). Write regulr expressions tht define the strings recognized by the following finite utomt: b d b b b c c b) Write FA tht recognizes the tokens defined by the following regulr

More information

Finite Automata. Lecture 4 Sections Robb T. Koether. Hampden-Sydney College. Wed, Jan 21, 2015

Finite Automata. Lecture 4 Sections Robb T. Koether. Hampden-Sydney College. Wed, Jan 21, 2015 Finite Automt Lecture 4 Sections 3.6-3.7 Ro T. Koether Hmpden-Sydney College Wed, Jn 21, 2015 Ro T. Koether (Hmpden-Sydney College) Finite Automt Wed, Jn 21, 2015 1 / 23 1 Nondeterministic Finite Automt

More information

CS 430 Spring Mike Lam, Professor. Parsing

CS 430 Spring Mike Lam, Professor. Parsing CS 430 Spring 2015 Mike Lm, Professor Prsing Syntx Anlysis We cn now formlly descrie lnguge's syntx Using regulr expressions nd BNF grmmrs How does tht help us? Syntx Anlysis We cn now formlly descrie

More information

Compiler Construction D7011E

Compiler Construction D7011E Compiler Construction D7011E Lecture 3: Lexer genertors Viktor Leijon Slides lrgely y John Nordlnder with mteril generously provided y Mrk P. Jones. 1 Recp: Hndwritten Lexers: Don t require sophisticted

More information

Fall Compiler Principles Lecture 1: Lexical Analysis. Roman Manevich Ben-Gurion University of the Negev

Fall Compiler Principles Lecture 1: Lexical Analysis. Roman Manevich Ben-Gurion University of the Negev Fll 2016-2017 Compiler Principles Lecture 1: Lexicl Anlysis Romn Mnevich Ben-Gurion University of the Negev Agend Understnd role of lexicl nlysis in compiler Regulr lnguges reminder Lexicl nlysis lgorithms

More information

ΕΠΛ323 - Θεωρία και Πρακτική Μεταγλωττιστών. Lecture 3b Lexical Analysis Elias Athanasopoulos

ΕΠΛ323 - Θεωρία και Πρακτική Μεταγλωττιστών. Lecture 3b Lexical Analysis Elias Athanasopoulos ΕΠΛ323 - Θωρία και Πρακτική Μταγλωττιστών Lecture 3 Lexicl Anlysis Elis Athnsopoulos elisthn@cs.ucy.c.cy RecogniNon of Tokens if expressions nd relnonl opertors if è if then è then else è else relop è

More information

CSE 401 Midterm Exam 11/5/10 Sample Solution

CSE 401 Midterm Exam 11/5/10 Sample Solution Question 1. egulr expressions (20 points) In the Ad Progrmming lnguge n integer constnt contins one or more digits, but it my lso contin embedded underscores. Any underscores must be preceded nd followed

More information

Principles of Programming Languages

Principles of Programming Languages Principles of Progrmming Lnguges h"p://www.di.unipi.it/~ndre/did2c/plp- 14/ Prof. Andre Corrdini Deprtment of Computer Science, Pis Lesson 5! Gener;on of Lexicl Anlyzers Creting Lexicl Anlyzer with Lex

More information

CSc 453. Compilers and Systems Software. 4 : Lexical Analysis II. Department of Computer Science University of Arizona

CSc 453. Compilers and Systems Software. 4 : Lexical Analysis II. Department of Computer Science University of Arizona CSc 453 Compilers nd Systems Softwre 4 : Lexicl Anlysis II Deprtment of Computer Science University of Arizon collerg@gmil.com Copyright c 2009 Christin Collerg Implementing Automt NFAs nd DFAs cn e hrd-coded

More information

Lexical Analysis and Lexical Analyzer Generators

Lexical Analysis and Lexical Analyzer Generators 1 Lexicl Anlysis nd Lexicl Anlyzer Genertors Chpter 3 COP5621 Compiler Construction Copyright Roert vn Engelen, Florid Stte University, 2007-2009 2 The Reson Why Lexicl Anlysis is Seprte Phse Simplifies

More information

Scanner Termination. Multi Character Lookahead. to its physical end. Most parsers require an end of file token. Lex and Jlex automatically create an

Scanner Termination. Multi Character Lookahead. to its physical end. Most parsers require an end of file token. Lex and Jlex automatically create an Scnner Termintion A scnner reds input chrcters nd prtitions them into tokens. Wht hppens when the end of the input file is reched? It my be useful to crete n Eof pseudo-chrcter when this occurs. In Jv,

More information

Deterministic. Finite Automata. And Regular Languages. Fall 2018 Costas Busch - RPI 1

Deterministic. Finite Automata. And Regular Languages. Fall 2018 Costas Busch - RPI 1 Deterministic Finite Automt And Regulr Lnguges Fll 2018 Costs Busch - RPI 1 Deterministic Finite Automton (DFA) Input Tpe String Finite Automton Output Accept or Reject Fll 2018 Costs Busch - RPI 2 Trnsition

More information

Lexical Analysis. Amitabha Sanyal. (www.cse.iitb.ac.in/ as) Department of Computer Science and Engineering, Indian Institute of Technology, Bombay

Lexical Analysis. Amitabha Sanyal. (www.cse.iitb.ac.in/ as) Department of Computer Science and Engineering, Indian Institute of Technology, Bombay Lexicl Anlysis Amith Snyl (www.cse.iit.c.in/ s) Deprtment of Computer Science nd Engineering, Indin Institute of Technology, Bomy Septemer 27 College of Engineering, Pune Lexicl Anlysis: 2/6 Recp The input

More information

CSCE 531, Spring 2017, Midterm Exam Answer Key

CSCE 531, Spring 2017, Midterm Exam Answer Key CCE 531, pring 2017, Midterm Exm Answer Key 1. (15 points) Using the method descried in the ook or in clss, convert the following regulr expression into n equivlent (nondeterministic) finite utomton: (

More information

CMPSC 470: Compiler Construction

CMPSC 470: Compiler Construction CMPSC 47: Compiler Construction Plese complete the following: Midterm (Type A) Nme Instruction: Mke sure you hve ll pges including this cover nd lnk pge t the end. Answer ech question in the spce provided.

More information

Fall Compiler Principles Lecture 1: Lexical Analysis. Roman Manevich Ben-Gurion University

Fall Compiler Principles Lecture 1: Lexical Analysis. Roman Manevich Ben-Gurion University Fll 2014-2015 Compiler Principles Lecture 1: Lexicl Anlysis Romn Mnevich Ben-Gurion University Agend Understnd role of lexicl nlysis in compiler Lexicl nlysis theory Implementing professionl scnner vi

More information

Lexical analysis, scanners. Construction of a scanner

Lexical analysis, scanners. Construction of a scanner Lexicl nlysis scnners (NB. Pges 4-5 re for those who need to refresh their knowledge of DFAs nd NFAs. These re not presented during the lectures) Construction of scnner Tools: stte utomt nd trnsition digrms.

More information

TO REGULAR EXPRESSIONS

TO REGULAR EXPRESSIONS Suject :- Computer Science Course Nme :- Theory Of Computtion DA TO REGULAR EXPRESSIONS Report Sumitted y:- Ajy Singh Meen 07000505 jysmeen@cse.iit.c.in BASIC DEINITIONS DA:- A finite stte mchine where

More information

Example: Source Code. Lexical Analysis. The Lexical Structure. Tokens. What do we really care here? A Sample Toy Program:

Example: Source Code. Lexical Analysis. The Lexical Structure. Tokens. What do we really care here? A Sample Toy Program: Lexicl Anlysis Red source progrm nd produce list of tokens ( liner nlysis) source progrm The lexicl structure is specified using regulr expressions Other secondry tsks: (1) get rid of white spces (e.g.,

More information

Implementing Automata. CSc 453. Compilers and Systems Software. 4 : Lexical Analysis II. Department of Computer Science University of Arizona

Implementing Automata. CSc 453. Compilers and Systems Software. 4 : Lexical Analysis II. Department of Computer Science University of Arizona Implementing utomt Sc 5 ompilers nd Systems Softwre : Lexicl nlysis II Deprtment of omputer Science University of rizon collerg@gmil.com opyright c 009 hristin ollerg NFs nd DFs cn e hrd-coded using this

More information

Applied Databases. Sebastian Maneth. Lecture 13 Online Pattern Matching on Strings. University of Edinburgh - February 29th, 2016

Applied Databases. Sebastian Maneth. Lecture 13 Online Pattern Matching on Strings. University of Edinburgh - February 29th, 2016 Applied Dtses Lecture 13 Online Pttern Mtching on Strings Sestin Mneth University of Edinurgh - Ferury 29th, 2016 2 Outline 1. Nive Method 2. Automton Method 3. Knuth-Morris-Prtt Algorithm 4. Boyer-Moore

More information

Tries. Yufei Tao KAIST. April 9, Y. Tao, April 9, 2013 Tries

Tries. Yufei Tao KAIST. April 9, Y. Tao, April 9, 2013 Tries Tries Yufei To KAIST April 9, 2013 Y. To, April 9, 2013 Tries In this lecture, we will discuss the following exct mtching prolem on strings. Prolem Let S e set of strings, ech of which hs unique integer

More information

this grammar generates the following language: Because this symbol will also be used in a later step, it receives the

this grammar generates the following language: Because this symbol will also be used in a later step, it receives the LR() nlysis Drwcks of LR(). Look-hed symols s eplined efore, concerning LR(), it is possile to consult the net set to determine, in the reduction sttes, for which symols it would e possile to perform reductions.

More information

Theory of Computation CSE 105

Theory of Computation CSE 105 $ $ $ Theory of Computtion CSE 105 Regulr Lnguges Study Guide nd Homework I Homework I: Solutions to the following problems should be turned in clss on July 1, 1999. Instructions: Write your nswers clerly

More information

Quiz2 45mins. Personal Number: Problem 1. (20pts) Here is an Table of Perl Regular Ex

Quiz2 45mins. Personal Number: Problem 1. (20pts) Here is an Table of Perl Regular Ex Long Quiz2 45mins Nme: Personl Numer: Prolem. (20pts) Here is n Tle of Perl Regulr Ex Chrcter Description. single chrcter \s whitespce chrcter (spce, t, newline) \S non-whitespce chrcter \d digit (0-9)

More information

CMPT 379 Compilers. Lexical Analysis

CMPT 379 Compilers. Lexical Analysis CMPT 379 Compilers Anoop Srkr http://www.cs.sfu.c/~noop 9//7 Lexicl Anlysis Also clled scnning, tke input progrm string nd convert into tokens Exmple: T_DOUBLE ( doule ) T_IDENT ( f ) T_OP ( = ) doule

More information

2014 Haskell January Test Regular Expressions and Finite Automata

2014 Haskell January Test Regular Expressions and Finite Automata 0 Hskell Jnury Test Regulr Expressions nd Finite Automt This test comprises four prts nd the mximum mrk is 5. Prts I, II nd III re worth 3 of the 5 mrks vilble. The 0 Hskell Progrmming Prize will be wrded

More information

Compilation

Compilation Compiltion 0368-3133 Lecture 2: Lexicl Anlysis Nom Rinetzky 1 2 Lexicl Anlysis Modern Compiler Design: Chpter 2.1 3 Conceptul Structure of Compiler Compiler Source text txt Frontend Semntic Representtion

More information

CS 340, Fall 2014 Dec 11 th /13 th Final Exam Note: in all questions, the special symbol ɛ (epsilon) is used to indicate the empty string.

CS 340, Fall 2014 Dec 11 th /13 th Final Exam Note: in all questions, the special symbol ɛ (epsilon) is used to indicate the empty string. CS 340, Fll 2014 Dec 11 th /13 th Finl Exm Nme: Note: in ll questions, the specil symol ɛ (epsilon) is used to indicte the empty string. Question 1. [5 points] Consider the following regulr expression;

More information

CSCI 3130: Formal Languages and Automata Theory Lecture 12 The Chinese University of Hong Kong, Fall 2011

CSCI 3130: Formal Languages and Automata Theory Lecture 12 The Chinese University of Hong Kong, Fall 2011 CSCI 3130: Forml Lnguges nd utomt Theory Lecture 12 The Chinese University of Hong Kong, Fll 2011 ndrej Bogdnov In progrmming lnguges, uilding prse trees is significnt tsk ecuse prse trees tell us the

More information

Should be done. Do Soon. Structure of a Typical Compiler. Plan for Today. Lab hours and Office hours. Quiz 1 is due tonight, was posted Tuesday night

Should be done. Do Soon. Structure of a Typical Compiler. Plan for Today. Lab hours and Office hours. Quiz 1 is due tonight, was posted Tuesday night Should e done L hours nd Office hours Sign up for the miling list t, strting to send importnt info to list http://groups.google.com/group/cs453-spring-2011 Red Ch 1 nd skim Ch 2 through 2.6, red 3.3 nd

More information

ECE 468/573 Midterm 1 September 28, 2012

ECE 468/573 Midterm 1 September 28, 2012 ECE 468/573 Midterm 1 September 28, 2012 Nme:! Purdue emil:! Plese sign the following: I ffirm tht the nswers given on this test re mine nd mine lone. I did not receive help from ny person or mteril (other

More information

Compilers Spring 2013 PRACTICE Midterm Exam

Compilers Spring 2013 PRACTICE Midterm Exam Compilers Spring 2013 PRACTICE Midterm Exm This is full length prctice midterm exm. If you wnt to tke it t exm pce, give yourself 7 minutes to tke the entire test. Just like the rel exm, ech question hs

More information

CS 241. Fall 2017 Midterm Review Solutions. October 24, Bits and Bytes 1. 3 MIPS Assembler 6. 4 Regular Languages 7.

CS 241. Fall 2017 Midterm Review Solutions. October 24, Bits and Bytes 1. 3 MIPS Assembler 6. 4 Regular Languages 7. CS 241 Fll 2017 Midterm Review Solutions Octoer 24, 2017 Contents 1 Bits nd Bytes 1 2 MIPS Assemly Lnguge Progrmming 2 3 MIPS Assemler 6 4 Regulr Lnguges 7 5 Scnning 9 1 Bits nd Bytes 1. Give two s complement

More information

COS 333: Advanced Programming Techniques

COS 333: Advanced Programming Techniques COS 333: Advnced Progrmming Techniques Brin Kernighn wk@cs, www.cs.princeton.edu/~wk 311 CS Building 609-258-2089 (ut emil is lwys etter) TA's: Junwen Li, li@cs, CS 217,258-0451 Yong Wng,yongwng@cs, CS

More information

Scanner Termination. Multi Character Lookahead

Scanner Termination. Multi Character Lookahead If d.doublevlue() represents vlid integer, (int) d.doublevlue() will crete the pproprite integer vlue. If string representtion of n integer begins with ~ we cn strip the ~, convert to double nd then negte

More information

Suffix trees, suffix arrays, BWT

Suffix trees, suffix arrays, BWT ALGORITHMES POUR LA BIO-INFORMATIQUE ET LA VISUALISATION COURS 3 Rluc Uricru Suffix trees, suffix rrys, BWT Bsed on: Suffix trees nd suffix rrys presenttion y Him Kpln Suffix trees course y Pco Gomez Liner-Time

More information

ASTs, Regex, Parsing, and Pretty Printing

ASTs, Regex, Parsing, and Pretty Printing ASTs, Regex, Prsing, nd Pretty Printing CS 2112 Fll 2016 1 Algeric Expressions To strt, consider integer rithmetic. Suppose we hve the following 1. The lphet we will use is the digits {0, 1, 2, 3, 4, 5,

More information

CS481: Bioinformatics Algorithms

CS481: Bioinformatics Algorithms CS481: Bioinformtics Algorithms Cn Alkn EA509 clkn@cs.ilkent.edu.tr http://www.cs.ilkent.edu.tr/~clkn/teching/cs481/ EXACT STRING MATCHING Fingerprint ide Assume: We cn compute fingerprint f(p) of P in

More information

CS 340, Fall 2016 Sep 29th Exam 1 Note: in all questions, the special symbol ɛ (epsilon) is used to indicate the empty string.

CS 340, Fall 2016 Sep 29th Exam 1 Note: in all questions, the special symbol ɛ (epsilon) is used to indicate the empty string. CS 340, Fll 2016 Sep 29th Exm 1 Nme: Note: in ll questions, the speil symol ɛ (epsilon) is used to indite the empty string. Question 1. [10 points] Speify regulr expression tht genertes the lnguge over

More information

Lecture T1: Pattern Matching

Lecture T1: Pattern Matching Introduction to Theoreticl CS Lecture T: Pttern Mtchin Two fundmentl questions. Wht cn computer do? Wht cn computer do with limited resources? Generl pproch. Don t tlk out specific mchines or prolems.

More information

If you are at the university, either physically or via the VPN, you can download the chapters of this book as PDFs.

If you are at the university, either physically or via the VPN, you can download the chapters of this book as PDFs. Lecture 5 Wlks, Trils, Pths nd Connectedness Reding: Some of the mteril in this lecture comes from Section 1.2 of Dieter Jungnickel (2008), Grphs, Networks nd Algorithms, 3rd edition, which is ville online

More information

COS 333: Advanced Programming Techniques

COS 333: Advanced Programming Techniques COS 333: Advnced Progrmming Techniques How to find me wk@cs, www.cs.princeton.edu/~wk 311 CS Building 609-258-2089 (ut emil is lwys etter) TA's: Mtvey Arye (rye), Tom Jlin (tjlin), Nick Johnson (npjohnso)

More information

COMP 423 lecture 11 Jan. 28, 2008

COMP 423 lecture 11 Jan. 28, 2008 COMP 423 lecture 11 Jn. 28, 2008 Up to now, we hve looked t how some symols in n lphet occur more frequently thn others nd how we cn sve its y using code such tht the codewords for more frequently occuring

More information

CS 241 Week 4 Tutorial Solutions

CS 241 Week 4 Tutorial Solutions CS 4 Week 4 Tutoril Solutions Writing n Assemler, Prt & Regulr Lnguges Prt Winter 8 Assemling instrutions utomtilly. slt $d, $s, $t. Solution: $d, $s, nd $t ll fit in -it signed integers sine they re 5-it

More information

What are suffix trees?

What are suffix trees? Suffix Trees 1 Wht re suffix trees? Allow lgorithm designers to store very lrge mount of informtion out strings while still keeping within liner spce Allow users to serch for new strings in the originl

More information

COMBINATORIAL PATTERN MATCHING

COMBINATORIAL PATTERN MATCHING COMBINATORIAL PATTERN MATCHING Genomic Repets Exmple of repets: ATGGTCTAGGTCCTAGTGGTC Motivtion to find them: Genomic rerrngements re often ssocited with repets Trce evolutionry secrets Mny tumors re chrcterized

More information

Regular Expression Matching with Multi-Strings and Intervals. Philip Bille Mikkel Thorup

Regular Expression Matching with Multi-Strings and Intervals. Philip Bille Mikkel Thorup Regulr Expression Mtching with Multi-Strings nd Intervls Philip Bille Mikkel Thorup Outline Definition Applictions Previous work Two new problems: Multi-strings nd chrcter clss intervls Algorithms Thompson

More information

LR Parsing, Part 2. Constructing Parse Tables. Need to Automatically Construct LR Parse Tables: Action and GOTO Table

LR Parsing, Part 2. Constructing Parse Tables. Need to Automatically Construct LR Parse Tables: Action and GOTO Table TDDD55 Compilers nd Interpreters TDDB44 Compiler Construction LR Prsing, Prt 2 Constructing Prse Tles Prse tle construction Grmmr conflict hndling Ctegories of LR Grmmrs nd Prsers Peter Fritzson, Christoph

More information

Some Thoughts on Grad School. Undergraduate Compilers Review and Intro to MJC. Structure of a Typical Compiler. Lexing and Parsing

Some Thoughts on Grad School. Undergraduate Compilers Review and Intro to MJC. Structure of a Typical Compiler. Lexing and Parsing Undergrdute Compilers Review nd Intro to MJC Announcements Miling list is in full swing Tody Some thoughts on grd school Finish prsing Semntic nlysis Visitor pttern for bstrct syntx trees Some Thoughts

More information

Regular Expressions and Automata using Miranda

Regular Expressions and Automata using Miranda Regulr Expressions nd Automt using Mirnd Simon Thompson Computing Lortory Univerisity of Kent t Cnterury My 1995 Contents 1 Introduction ::::::::::::::::::::::::::::::::: 1 2 Regulr Expressions :::::::::::::::::::::::::::::

More information

Lecture T4: Pattern Matching

Lecture T4: Pattern Matching Introduction to Theoreticl CS Lecture T4: Pttern Mtching Two fundmentl questions. Wht cn computer do? How fst cn it do it? Generl pproch. Don t tlk bout specific mchines or problems. Consider miniml bstrct

More information

Sample Midterm Solutions COMS W4115 Programming Languages and Translators Monday, October 12, 2009

Sample Midterm Solutions COMS W4115 Programming Languages and Translators Monday, October 12, 2009 Deprtment of Computer cience Columbi University mple Midterm olutions COM W4115 Progrmming Lnguges nd Trnsltors Mondy, October 12, 2009 Closed book, no ids. ch question is worth 20 points. Question 5(c)

More information

CMSC 331 First Midterm Exam

CMSC 331 First Midterm Exam 0 00/ 1 20/ 2 05/ 3 15/ 4 15/ 5 15/ 6 20/ 7 30/ 8 30/ 150/ 331 First Midterm Exm 7 October 2003 CMC 331 First Midterm Exm Nme: mple Answers tudent ID#: You will hve seventy-five (75) minutes to complete

More information

Context-Free Grammars

Context-Free Grammars Context-Free Grmmrs Descriing Lnguges We've seen two models for the regulr lnguges: Finite utomt ccept precisely the strings in the lnguge. Regulr expressions descrie precisely the strings in the lnguge.

More information

Context-Free Grammars

Context-Free Grammars Context-Free Grmmrs Descriing Lnguges We've seen two models for the regulr lnguges: Finite utomt ccept precisely the strings in the lnguge. Regulr expressions descrie precisely the strings in the lnguge.

More information

12 <= rm <digit> 2 <= rm <no> 2 <= rm <no> <digit> <= rm <no> <= rm <number>

12 <= rm <digit> 2 <= rm <no> 2 <= rm <no> <digit> <= rm <no> <= rm <number> DDD16 Compilers nd Interpreters DDB44 Compiler Construction R Prsing Prt 1 R prsing concept Using prser genertor Prse ree Genertion Wht is R-prsing? eft-to-right scnning R Rigthmost derivtion in reverse

More information

Homework. Context Free Languages III. Languages. Plan for today. Context Free Languages. CFLs and Regular Languages. Homework #5 (due 10/22)

Homework. Context Free Languages III. Languages. Plan for today. Context Free Languages. CFLs and Regular Languages. Homework #5 (due 10/22) Homework Context Free Lnguges III Prse Trees nd Homework #5 (due 10/22) From textbook 6.4,b 6.5b 6.9b,c 6.13 6.22 Pln for tody Context Free Lnguges Next clss of lnguges in our quest! Lnguges Recll. Wht

More information

Dr. D.M. Akbar Hussain

Dr. D.M. Akbar Hussain 1 2 Compiler Construction F6S Lecture - 2 1 3 4 Compiler Construction F6S Lecture - 2 2 5 #include.. #include main() { char in; in = getch ( ); if ( isalpha (in) ) in = getch ( ); else error (); while

More information

CS 321 Programming Languages and Compilers. Bottom Up Parsing

CS 321 Programming Languages and Compilers. Bottom Up Parsing CS 321 Progrmming nguges nd Compilers Bottom Up Prsing Bottom-up Prsing: Shift-reduce prsing Grmmr H: fi ; fi b Input: ;;b hs prse tree ; ; b 2 Dt for Shift-reduce Prser Input string: sequence of tokens

More information

CS 236 Language and Computation. Alphabet. Definition. I.2.1. Formal Languages (10.1)

CS 236 Language and Computation. Alphabet. Definition. I.2.1. Formal Languages (10.1) C 236 Lnguge nd Computtion Course Notes Prt I: Grmmrs for Defining yntx (II) Chpter I.2: yntx nd Grmmrs (10, 12.1) Anton etzer (Bsed on ook drft y J. V. Tucker nd K. tephenson) Dept. of Computer cience,

More information

Information Retrieval and Organisation

Information Retrieval and Organisation Informtion Retrievl nd Orgnistion Suffix Trees dpted from http://www.mth.tu.c.il/~himk/seminr02/suffixtrees.ppt Dell Zhng Birkeck, University of London Trie A tree representing set of strings { } eef d

More information

Operator Precedence. Java CUP. E E + T T T * P P P id id id. Does a+b*c mean (a+b)*c or

Operator Precedence. Java CUP. E E + T T T * P P P id id id. Does a+b*c mean (a+b)*c or Opertor Precedence Most progrmming lnguges hve opertor precedence rules tht stte the order in which opertors re pplied (in the sence of explicit prentheses). Thus in C nd Jv nd CSX, +*c mens compute *c,

More information

2 Computing all Intersections of a Set of Segments Line Segment Intersection

2 Computing all Intersections of a Set of Segments Line Segment Intersection 15-451/651: Design & Anlysis of Algorithms Novemer 14, 2016 Lecture #21 Sweep-Line nd Segment Intersection lst chnged: Novemer 8, 2017 1 Preliminries The sweep-line prdigm is very powerful lgorithmic design

More information

Lexical Analysis. Role, Specification & Recognition Tool: LEX Construction: - RE to NFA to DFA to min-state DFA - RE to DFA

Lexical Analysis. Role, Specification & Recognition Tool: LEX Construction: - RE to NFA to DFA to min-state DFA - RE to DFA Lexicl Anlysis Role, Specifiction & Recognition Tool: LEX Construction: - RE to NFA to DFA to min-stte DFA - RE to DFA Conducting Lexicl Anlysis Techniques for specifying nd implementing lexicl nlyzers

More information

10/12/17. Motivating Example. Lexical and Syntax Analysis (2) Recursive-Descent Parsing. Recursive-Descent Parsing. Recursive-Descent Parsing

10/12/17. Motivating Example. Lexical and Syntax Analysis (2) Recursive-Descent Parsing. Recursive-Descent Parsing. Recursive-Descent Parsing Motivting Exmple Lexicl nd yntx Anlysis (2) In Text: Chpter 4 Consider the grmmr -> cad A -> b Input string: w = cd How to build prse tree top-down? 2 Initilly crete tree contining single node (the strt

More information

acronyms possibly used in this test: CFG :acontext free grammar CFSM :acharacteristic finite state machine DFA :adeterministic finite automata

acronyms possibly used in this test: CFG :acontext free grammar CFSM :acharacteristic finite state machine DFA :adeterministic finite automata EE573 Fll 2002, Exm open book, if question seems mbiguous, sk me to clrify the question. If my nswer doesn t stisfy you, plese stte your ssumptions. cronyms possibly used in this test: CFG :context free

More information

LEX5: Regexps to NFA. Lexical Analysis. CMPT 379: Compilers Instructor: Anoop Sarkar. anoopsarkar.github.io/compilers-class

LEX5: Regexps to NFA. Lexical Analysis. CMPT 379: Compilers Instructor: Anoop Sarkar. anoopsarkar.github.io/compilers-class LEX5: Regexps to NFA Lexicl Anlysis CMPT 379: Compilers Instructor: Anoop Srkr noopsrkr.github.io/compilers-clss Building Lexicl Anlyzer Token POern POern Regulr Expression Regulr Expression NFA NFA DFA

More information

Today. CS 188: Artificial Intelligence Fall Recap: Search. Example: Pancake Problem. Example: Pancake Problem. General Tree Search.

Today. CS 188: Artificial Intelligence Fall Recap: Search. Example: Pancake Problem. Example: Pancake Problem. General Tree Search. CS 88: Artificil Intelligence Fll 00 Lecture : A* Serch 9//00 A* Serch rph Serch Tody Heuristic Design Dn Klein UC Berkeley Multiple slides from Sturt Russell or Andrew Moore Recp: Serch Exmple: Pncke

More information

Stack. A list whose end points are pointed by top and bottom

Stack. A list whose end points are pointed by top and bottom 4. Stck Stck A list whose end points re pointed by top nd bottom Insertion nd deletion tke plce t the top (cf: Wht is the difference between Stck nd Arry?) Bottom is constnt, but top grows nd shrinks!

More information

CS201 Discussion 10 DRAWTREE + TRIES

CS201 Discussion 10 DRAWTREE + TRIES CS201 Discussion 10 DRAWTREE + TRIES DrwTree First instinct: recursion As very generic structure, we could tckle this problem s follows: drw(): Find the root drw(root) drw(root): Write the line for the

More information

Lecture 7: Integration Techniques

Lecture 7: Integration Techniques Lecture 7: Integrtion Techniques Antiderivtives nd Indefinite Integrls. In differentil clculus, we were interested in the derivtive of given rel-vlued function, whether it ws lgeric, eponentil or logrithmic.

More information

Algorithm Design (5) Text Search

Algorithm Design (5) Text Search Algorithm Design (5) Text Serch Tkshi Chikym School of Engineering The University of Tokyo Text Serch Find sustring tht mtches the given key string in text dt of lrge mount Key string: chr x[m] Text Dt:

More information

stack of states and grammar symbols Stack-Bottom marker C. Kessler, IDA, Linköpings universitet. 1. <list> -> <list>, <element> 2.

stack of states and grammar symbols Stack-Bottom marker C. Kessler, IDA, Linköpings universitet. 1. <list> -> <list>, <element> 2. TDDB9 Compilers nd Interpreters TDDB44 Compiler Construction LR Prsing Updted/New slide mteril 007: Pushdown Automton for LR-Prsing Finite-stte pushdown utomton contins lterntingly sttes nd symols in NUΣ

More information

Midterm I Solutions CS164, Spring 2006

Midterm I Solutions CS164, Spring 2006 Midterm I Solutions CS164, Spring 2006 Februry 23, 2006 Plese red ll instructions (including these) crefully. Write your nme, login, SID, nd circle the section time. There re 8 pges in this exm nd 4 questions,

More information

Solving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence Winter 2016

Solving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence Winter 2016 Solving Prolems y Serching CS 486/686: Introduction to Artificil Intelligence Winter 2016 1 Introduction Serch ws one of the first topics studied in AI - Newell nd Simon (1961) Generl Prolem Solver Centrl

More information

Midterm 2 Sample solution

Midterm 2 Sample solution Nme: Instructions Midterm 2 Smple solution CMSC 430 Introduction to Compilers Fll 2012 November 28, 2012 This exm contins 9 pges, including this one. Mke sure you hve ll the pges. Write your nme on the

More information

Suffix Tries. Slides adapted from the course by Ben Langmead

Suffix Tries. Slides adapted from the course by Ben Langmead Suffix Tries Slides dpted from the course y Ben Lngmed en.lngmed@gmil.com Indexing with suffixes Until now, our indexes hve een sed on extrcting sustrings from T A very different pproch is to extrct suffixes

More information

Scanning Theory and Practice

Scanning Theory and Practice CHAPTER 3 Scnning Theory nd Prctice 3.1 Overview The primry function of scnner is to red in chrcters from source file nd group them into tokens. A scnner is sometimes clled lexicl nlyzer or lexer. The

More information

Announcements. CS 188: Artificial Intelligence Fall Recap: Search. Today. Example: Pancake Problem. Example: Pancake Problem

Announcements. CS 188: Artificial Intelligence Fall Recap: Search. Today. Example: Pancake Problem. Example: Pancake Problem Announcements Project : erch It s live! Due 9/. trt erly nd sk questions. It s longer thn most! Need prtner? Come up fter clss or try Pizz ections: cn go to ny, ut hve priority in your own C 88: Artificil

More information

Intermediate Information Structures

Intermediate Information Structures CPSC 335 Intermedite Informtion Structures LECTURE 13 Suffix Trees Jon Rokne Computer Science University of Clgry Cnd Modified from CMSC 423 - Todd Trengen UMD upd Preprocessing Strings We will look t

More information

Control-Flow Analysis and Loop Detection

Control-Flow Analysis and Loop Detection ! Control-Flow Anlysis nd Loop Detection!Lst time! PRE!Tody! Control-flow nlysis! Loops! Identifying loops using domintors! Reducibility! Using loop identifiction to identify induction vribles CS553 Lecture

More information

CS311H: Discrete Mathematics. Graph Theory IV. A Non-planar Graph. Regions of a Planar Graph. Euler s Formula. Instructor: Işıl Dillig

CS311H: Discrete Mathematics. Graph Theory IV. A Non-planar Graph. Regions of a Planar Graph. Euler s Formula. Instructor: Işıl Dillig CS311H: Discrete Mthemtics Grph Theory IV Instructor: Işıl Dillig Instructor: Işıl Dillig, CS311H: Discrete Mthemtics Grph Theory IV 1/25 A Non-plnr Grph Regions of Plnr Grph The plnr representtion of

More information

AI Adjacent Fields. This slide deck courtesy of Dan Klein at UC Berkeley

AI Adjacent Fields. This slide deck courtesy of Dan Klein at UC Berkeley AI Adjcent Fields Philosophy: Logic, methods of resoning Mind s physicl system Foundtions of lerning, lnguge, rtionlity Mthemtics Forml representtion nd proof Algorithms, computtion, (un)decidility, (in)trctility

More information

Recognition of Tokens

Recognition of Tokens 42 Recognton o Tokens The queston s how to recognze the tokens? Exmple: ssume the ollowng grmmr rgment to generte specc lnguge: stmt expr expr then stmt expr then stmt else stmt term relop term term term

More information

Section 3.1: Sequences and Series

Section 3.1: Sequences and Series Section.: Sequences d Series Sequences Let s strt out with the definition of sequence: sequence: ordered list of numbers, often with definite pttern Recll tht in set, order doesn t mtter so this is one

More information

such that the S i cover S, or equivalently S

such that the S i cover S, or equivalently S MATH 55 Triple Integrls Fll 16 1. Definition Given solid in spce, prtition of consists of finite set of solis = { 1,, n } such tht the i cover, or equivlently n i. Furthermore, for ech i, intersects i

More information

Systems I. Logic Design I. Topics Digital logic Logic gates Simple combinational logic circuits

Systems I. Logic Design I. Topics Digital logic Logic gates Simple combinational logic circuits Systems I Logic Design I Topics Digitl logic Logic gtes Simple comintionl logic circuits Simple C sttement.. C = + ; Wht pieces of hrdwre do you think you might need? Storge - for vlues,, C Computtion

More information