Presentation Martin Randers
|
|
- Beverly Gibson
- 5 years ago
- Views:
Transcription
1 Presenttion Mrtin Rnders
2 Outline Introduction Algorithms Implementtion nd experiments Memory consumption Summry
3 Introduction
4 Introduction Evolution of species cn e modelled in trees Trees consist of nodes nd edges nodes divided into leves nd internl nodes edges connecting internl nodes re clled internl edges
5 The Qurtet Distnce A qurtet is set of four leves Cn hve four possile qurtet topologies c c d c d d c d Butterfly topologies Str topology The qurtet distnce etween pir of trees is the numer of qurtets with different topologies
6 Other Algorithms Previously: Binry trees lgorithms creted y Tsng O n 2 & Brodl et l. O n log n Now: Trees of ritrry degrees Generliztion of Tsngs lgorithm uses time O V d 2 V ' d ' 2 Generliztion of Brodl et l.'s lgorithm to trees of ounded degree uses time O d 9 n log n
7 Algorithms
8 Algorithms Wys to compute shred lef set sizes re presented in thesis Five lgorithms for computing the qurtet distnce designed nd implemented: Two center sed Two sed on edge climing One sed on node climing
9 Center Bsed Algorithms Oservtion: Ech triplet of leves hs unique internl node s center
10 Center Bsed Algorithms Oservtion: Ech triplet of leves hs unique internl node s center The center of, nd c c
11 Center Bsed Algorithms Oservtion: Ech triplet of leves hs unique internl node s center The center of, nd c c The topologies of qurtets contining the triplet esily determined from this center
12 Center Bsed Algorithms Oservtion: Ech triplet of leves hs unique internl node s center The center of, nd c c The topologies of qurtets contining the triplet esily determined from this center y x c
13 Center Bsed Algorithms Oservtion: Ech triplet of leves hs unique internl node s center The center of, nd c c The topologies of qurtets contining the triplet esily determined from this center y c x x y The topologies c c
14 First Center Bsed Algorithm O n 4 lgorithm: For ech triplet of leves: Find center of the triplet, in ech tree Determine topology of qurtets, in ech tree Compre topology of qurtets Uses spce O(n) to store topologies
15 Second Center Bsed Algorithm O n 3 lgorithm: Precompute shred lef set sizes For ech pir of leves: Find center of ech triplet contining the pir, in ech tree Use precomputed sizes to clculte numer of shred qurtets Uses spce to store shred lef set sizes O n 2
16 Hndling Str Qurtets Qurtets cn e divided into five ctegories: Q SS T,T ',Q SB T,T ',Q BS T,T ', Q B=B T,T ',Q B B T,T '
17 Hndling Str Qurtets Qurtets cn e divided into five ctegories: Q SS T,T ',Q SB T,T ',Q BS T,T ', Q B=B T,T ',Q B B T,T ' qdist T,T '
18 Hndling Str Qurtets Qurtets cn e divided into five ctegories: Q SS T,T ',Q SB T,T ',Q BS T,T ', Q B=B T,T ',Q B B T,T ' qdist T,T ' Oserve tht Q B=B T,T =Q BS T,T ' Q B=B T,T ' Q B B T,T ' Q B=B T ',T ' =Q SB T,T ' Q B=B T,T ' Q B B T,T '
19 Hndling Str Qurtets Qurtets cn e divided into five ctegories: Oserve tht Yielding Q SS T,T ',Q SB T,T ',Q BS T,T ', Q B=B T,T ',Q B B T,T ' qdist T,T ' Q B=B T,T =Q BS T,T ' Q B=B T,T ' Q B B T,T ' Q B=B T ',T ' =Q SB T,T ' Q B=B T,T ' Q B B T,T ' qdist T,T ' =Q B=B T,T Q B=B T ',T ' 2Q B=B T,T ' Q B B T,T '
20 Climing Associting qurtets to specific edges or nodes in the trees Clculte shred/nonshred qurtets y processing pirs of edges/nodes Importnt tht ech qurtet is climed y fixed numer of edges/nodes
21 Edge Climing Ech directed internl edge e clims ll utterfly qurtets where two leves re locted in two different sutrees in front of e, nd the other two re in the sutree ehind e e x c d
22 Edge Climing Ech directed internl edge e clims ll utterfly qurtets where two leves re locted in two different sutrees in front of e, nd the other two re in the sutree ehind e e x c d e clims cx nd dx, ut not cd
23 Edge Climing Ech directed internl edge e clims ll utterfly qurtets where two leves re locted in two different sutrees in front of e, nd the other two re in the sutree ehind e e x c d e clims cx nd dx, ut not cd Ech utterfly qurtet is climed y exctly two directed edges
24 Encoding The qurtets climed y ech edge cn e encoded s numer of triplets of sutrees (clims) The numer of shred nd nonshred qurtets in pir of clims cn e computed in time O(1) If e points to node of degree d, it tkes d 1 clims to encode the qurtets climed Processing ll pirs of clims tkes time 2 v V v' V ' id v d v 1 2 id v ' d v' 1 2 =O V V ' d 2 d ' 2
25 Expnsion First edge climing lgorithm: Expnd the trees to inry trees, nd define extended clims Compute shred lef set sizes Process ll pirs of extended clims If e points to node of degree d, it tkes d 1 extended clims to encode the qurtets climed Processing ll pirs of extended clims thus tkes time v V v' V ' id v d v id v ' d v' =O V V ' dd ' Uses spce O n 2 to store shred lef set sizes
26 Counting Insted of encoding, count numer of shred/nonshred qurtets climed y oth edges directly Done in three steps for pir of edges: i. Count too mny (some illegl ) ii. Deduct ll the illegl ones (some twice) iii. Add the ones tht were deducted twice If pir of edges points to nodes of internl degrees id nd id' respectively this cn e done in time O(idid')
27 Counting (cont) Second edge climing lgorithm: Compute shred lef set sizes of non lef sutrees Do the counting descried ove for ech pir of edges Doing precomputtions nd processing ll pirs of edges tkes time O n V V ' v V v ' V ' id 2 2 v id =O n v ' V V ' idid ' Uses spce O n V V ' sizes nd sizes of sutrees to store shred lef set
28 Node Climing Motivtion: A lot of redundnt computtions re done in the second edge climing lgorithm Ech internl node v clims ll utterfly qurtets climed y directed internl edges pointing to v Ech utterfly qurtet is climed y exctly two directed edges
29 Shred Qurtets Given pir of nodes v nd v' numer of sums cn e precomputed in time O id v id v' O id v id v ' nd spce These enles the numer of shred qurtets climed y oth nodes to e computed in time O id v id v '
30 Nonshred Qurtets By precomputing n dditionl sums O min {id v,id v ' } 2 in time O id v id v ' min {id v,id } v' it is lso possile to compute the numer of nonshred qurtets climed y the nodes in time O id v id v ' min {id v,id v ' }
31 The Algorithm Node climing lgorithm: Compute shred lef set sizes of non lef sutrees For ech pir of nodes: Do the precomputing descried ove Compute shred nd nonshred qurtets This tkes time O n V V ' min {id,id ' }... nd uses spce O n V V '
32 Implementtion & Experiments
33 Implementtion All of the presented lgorithms hve een implemented in Jv Tool, with optionl GUI, ville for downlod Experiments hs een performed using these implementtions
34 Experiments The correctness of lgorithms vlidted y compring results The lgorithms were run on four clsses of trees to investigte ctul running times: worst cse d ry rndom r8s sed
35 Experiments The correctness of lgorithms vlidted y compring results The lgorithms were run on four clsses of trees to investigte ctul running times: worst cse d ry rndom r8s sed
36 Exmple of Results
37 Compring the Algorithms
38 More Comprison
39 Anlysis of Results The symptotic performnce ws s expected The second edge climing nd the node climing re clerly fster thn the others. The node climing lgorithm ws chosen for the tool
40 Reducing Memory Consumption
41 Reducing Memory Consumption The work hs een focused t reducing running time, not memory consumption Reduction in memory from O n 2 to ws just yproduct of optimizing running time Cn further reduction e done, mye t the cost of dding running time? O n V V '
42 Importnt Fcts When processing pir of nodes it is necessry nd sufficient to know the shred lef set sizes of ll pirs of non lef sutrees of the nodes, nd the sizes of individul sutrees Implies tht trivil lower ound on memory consumption is O(n+id id') The chllenge:
43 Importnt Fcts When processing pir of nodes it is necessry nd sufficient to know the shred lef set sizes of ll pirs of non lef sutrees of the nodes, nd the sizes of individul sutrees Implies tht trivil lower ound on memory consumption is O(n+id id') The chllenge: The shred lef set sizes of sutrees re clculted using other shred lef set sizes, i.e. they re not independent
44 Bsic Ide The ide is inspired y the O(n log(n)) lgorithm:
45 Bsic Ide The ide is inspired y the O(n log(n)) lgorithm: Do numer of colorings of the leves in one tree
46 Bsic Ide The ide is inspired y the O(n log(n)) lgorithm: Do numer of colorings of the leves in one tree Build some structure sed on the other tree nd updte it when colors chnge
47 Coloring Let v e n internl node in tree T. T is sid to e colored ccording to v if the leves of ech non lef sutree of v re colored with the colors 1,...,id v, one for ech sutree, nd ll leves directly connected to v re colored with the color 0
48 Coloring Let v e n internl node in tree T. T is sid to e colored ccording to v if the leves of ech non lef sutree of v re colored with the colors 1,...,id v, one for ech sutree, nd ll leves directly connected to v re colored with the color 0 c v f g d e
49 Coloring Let v e n internl node in tree T. T is sid to e colored ccording to v if the leves of ech non lef sutree of v re colored with the colors 1,...,id v, one for ech sutree, nd ll leves directly connected to v re colored with the color 0 c f v color g v c f g 0,1,2,3 d e d e
50 Structure Root the other tree in n ritrry internl node, nd dd n rry to ech internl node with id v entries Color the leves in the rooted tree Initilize the entries in the rrys with the numer of leves of ech color directly connected to the node Updte the rrys depth first with the sum of the entries in the rrys of the children
51 Exmple d c r g e f
52 Exmple d c r g root r e f d c e f g
53 Exmple d c r g root r e f dd rrys d c e f g r g d c e f
54 Exmple d c r g root r e f dd rrys d c e f g r r g color leves g 0,1,2,3 d c e f d c e f
55 Exmple d c e f r g root dd rrys d c e f r g r r g color leves g 0,1,2,3 d c e f r g init rrys d c e f d c e f
56 Exmple d c r e f d c e f g r root dd rrys g color leves r init rrys g updte rrys d c e f d c e f r d c e f d c e f g r r g g 0,1,2,3
57 Anlysis Rooting cn e done once nd for ll in constnt time For ech node v in T: Coloring cn e done in time O(n) Adding rrys tkes time Updting rrys tkes time Spce consumption is O V ' id v O V ' id v O v ' V ' id v id v' =O V ' id v
58 Anlysis (cont) Computtion cn e done s efore, except the nodes must e hndled in n ordered wy The time to hndle ll pirs of nodes is O V V ' min {id,id ' } Totl complexities re thus: O V n V V ' min {id,id ' } time, nd O V ' id spce Note tht the roles of the trees cn e switched
59 Summry
60 Overview Presented here: The prolem Existing lgorithms A wy to void str qurtets The five lgorithms designed nd implemented
61 Overview Presented here: The prolem Existing lgorithms A wy to void str qurtets The five lgorithms designed nd implemented
62 Overview Presented here: The prolem Existing lgorithms A wy to void str qurtets The five lgorithms designed nd implemented Some of the experiments performed A wy to reduce the memory consumption of the fstest lgorithm (t performnce cost)
63 Additionl Work in Thesis Additionl work in the thesis: Wys to compute shred lef set sizes Generliztion of existing mesures Hndling non stndrd input trees Visuliztion Presenttion of tool Comprison with split distnce
64 The End
What are suffix trees?
Suffix Trees 1 Wht re suffix trees? Allow lgorithm designers to store very lrge mount of informtion out strings while still keeping within liner spce Allow users to serch for new strings in the originl
More informationMa/CS 6b Class 1: Graph Recap
M/CS 6 Clss 1: Grph Recp By Adm Sheffer Course Detils Adm Sheffer. Office hour: Tuesdys 4pm. dmsh@cltech.edu TA: Victor Kstkin. Office hour: Tuesdys 7pm. 1:00 Mondy, Wednesdy, nd Fridy. http://www.mth.cltech.edu/~2014-15/2term/m006/
More information2 Computing all Intersections of a Set of Segments Line Segment Intersection
15-451/651: Design & Anlysis of Algorithms Novemer 14, 2016 Lecture #21 Sweep-Line nd Segment Intersection lst chnged: Novemer 8, 2017 1 Preliminries The sweep-line prdigm is very powerful lgorithmic design
More informationCOMP 423 lecture 11 Jan. 28, 2008
COMP 423 lecture 11 Jn. 28, 2008 Up to now, we hve looked t how some symols in n lphet occur more frequently thn others nd how we cn sve its y using code such tht the codewords for more frequently occuring
More informationInformation Retrieval and Organisation
Informtion Retrievl nd Orgnistion Suffix Trees dpted from http://www.mth.tu.c.il/~himk/seminr02/suffixtrees.ppt Dell Zhng Birkeck, University of London Trie A tree representing set of strings { } eef d
More informationMa/CS 6b Class 1: Graph Recap
M/CS 6 Clss 1: Grph Recp By Adm Sheffer Course Detils Instructor: Adm Sheffer. TA: Cosmin Pohot. 1pm Mondys, Wednesdys, nd Fridys. http://mth.cltech.edu/~2015-16/2term/m006/ Min ook: Introduction to Grph
More informationSuffix trees, suffix arrays, BWT
ALGORITHMES POUR LA BIO-INFORMATIQUE ET LA VISUALISATION COURS 3 Rluc Uricru Suffix trees, suffix rrys, BWT Bsed on: Suffix trees nd suffix rrys presenttion y Him Kpln Suffix trees course y Pco Gomez Liner-Time
More informationSlides for Data Mining by I. H. Witten and E. Frank
Slides for Dt Mining y I. H. Witten nd E. Frnk Simplicity first Simple lgorithms often work very well! There re mny kinds of simple structure, eg: One ttriute does ll the work All ttriutes contriute eqully
More information10.5 Graphing Quadratic Functions
0.5 Grphing Qudrtic Functions Now tht we cn solve qudrtic equtions, we wnt to lern how to grph the function ssocited with the qudrtic eqution. We cll this the qudrtic function. Grphs of Qudrtic Functions
More informationSolving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence Winter 2016
Solving Prolems y Serching CS 486/686: Introduction to Artificil Intelligence Winter 2016 1 Introduction Serch ws one of the first topics studied in AI - Newell nd Simon (1961) Generl Prolem Solver Centrl
More informationFrom Dependencies to Evaluation Strategies
From Dependencies to Evlution Strtegies Possile strtegies: 1 let the user define the evlution order 2 utomtic strtegy sed on the dependencies: use locl dependencies to determine which ttriutes to compute
More informationITEC2620 Introduction to Data Structures
ITEC0 Introduction to Dt Structures Lecture 7 Queues, Priority Queues Queues I A queue is First-In, First-Out = FIFO uffer e.g. line-ups People enter from the ck of the line People re served (exit) from
More informationIn the last lecture, we discussed how valid tokens may be specified by regular expressions.
LECTURE 5 Scnning SYNTAX ANALYSIS We know from our previous lectures tht the process of verifying the syntx of the progrm is performed in two stges: Scnning: Identifying nd verifying tokens in progrm.
More informationTries. Yufei Tao KAIST. April 9, Y. Tao, April 9, 2013 Tries
Tries Yufei To KAIST April 9, 2013 Y. To, April 9, 2013 Tries In this lecture, we will discuss the following exct mtching prolem on strings. Prolem Let S e set of strings, ech of which hs unique integer
More informationSection 10.4 Hyperbolas
66 Section 10.4 Hyperbols Objective : Definition of hyperbol & hyperbols centered t (0, 0). The third type of conic we will study is the hyperbol. It is defined in the sme mnner tht we defined the prbol
More information6.3 Volumes. Just as area is always positive, so is volume and our attitudes towards finding it.
6.3 Volumes Just s re is lwys positive, so is volume nd our ttitudes towrds finding it. Let s review how to find the volume of regulr geometric prism, tht is, 3-dimensionl oject with two regulr fces seprted
More informationP(r)dr = probability of generating a random number in the interval dr near r. For this probability idea to make sense we must have
Rndom Numers nd Monte Crlo Methods Rndom Numer Methods The integrtion methods discussed so fr ll re sed upon mking polynomil pproximtions to the integrnd. Another clss of numericl methods relies upon using
More informationSolving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence
Solving Prolems y Serching CS 486/686: Introduction to Artificil Intelligence 1 Introduction Serch ws one of the first topics studied in AI - Newell nd Simon (1961) Generl Prolem Solver Centrl component
More informationFig.25: the Role of LEX
The Lnguge for Specifying Lexicl Anlyzer We shll now study how to uild lexicl nlyzer from specifiction of tokens in the form of list of regulr expressions The discussion centers round the design of n existing
More informationIf you are at the university, either physically or via the VPN, you can download the chapters of this book as PDFs.
Lecture 5 Wlks, Trils, Pths nd Connectedness Reding: Some of the mteril in this lecture comes from Section 1.2 of Dieter Jungnickel (2008), Grphs, Networks nd Algorithms, 3rd edition, which is ville online
More informationCS311H: Discrete Mathematics. Graph Theory IV. A Non-planar Graph. Regions of a Planar Graph. Euler s Formula. Instructor: Işıl Dillig
CS311H: Discrete Mthemtics Grph Theory IV Instructor: Işıl Dillig Instructor: Işıl Dillig, CS311H: Discrete Mthemtics Grph Theory IV 1/25 A Non-plnr Grph Regions of Plnr Grph The plnr representtion of
More informationCS201 Discussion 10 DRAWTREE + TRIES
CS201 Discussion 10 DRAWTREE + TRIES DrwTree First instinct: recursion As very generic structure, we could tckle this problem s follows: drw(): Find the root drw(root) drw(root): Write the line for the
More informationI/O Efficient Dynamic Data Structures for Longest Prefix Queries
I/O Efficient Dynmic Dt Structures for Longest Prefix Queries Moshe Hershcovitch 1 nd Him Kpln 2 1 Fculty of Electricl Engineering, moshik1@gmil.com 2 School of Computer Science, himk@cs.tu.c.il, Tel Aviv
More informationLecture 10 Evolutionary Computation: Evolution strategies and genetic programming
Lecture 10 Evolutionry Computtion: Evolution strtegies nd genetic progrmming Evolution strtegies Genetic progrmming Summry Negnevitsky, Person Eduction, 2011 1 Evolution Strtegies Another pproch to simulting
More informationToday. CS 188: Artificial Intelligence Fall Recap: Search. Example: Pancake Problem. Example: Pancake Problem. General Tree Search.
CS 88: Artificil Intelligence Fll 00 Lecture : A* Serch 9//00 A* Serch rph Serch Tody Heuristic Design Dn Klein UC Berkeley Multiple slides from Sturt Russell or Andrew Moore Recp: Serch Exmple: Pncke
More informationSuffix Tries. Slides adapted from the course by Ben Langmead
Suffix Tries Slides dpted from the course y Ben Lngmed en.lngmed@gmil.com Indexing with suffixes Until now, our indexes hve een sed on extrcting sustrings from T A very different pproch is to extrct suffixes
More informationCS143 Handout 07 Summer 2011 June 24 th, 2011 Written Set 1: Lexical Analysis
CS143 Hndout 07 Summer 2011 June 24 th, 2011 Written Set 1: Lexicl Anlysis In this first written ssignment, you'll get the chnce to ply round with the vrious constructions tht come up when doing lexicl
More informationCSCI1950 Z Computa4onal Methods for Biology Lecture 2. Ben Raphael January 26, hhp://cs.brown.edu/courses/csci1950 z/ Outline
CSCI1950 Z Comput4onl Methods for Biology Lecture 2 Ben Rphel Jnury 26, 2009 hhp://cs.brown.edu/courses/csci1950 z/ Outline Review of trees. Coun4ng fetures. Chrcter bsed phylogeny Mximum prsimony Mximum
More informationThe Greedy Method. The Greedy Method
Lists nd Itertors /8/26 Presenttion for use with the textook, Algorithm Design nd Applictions, y M. T. Goodrich nd R. Tmssi, Wiley, 25 The Greedy Method The Greedy Method The greedy method is generl lgorithm
More informationCompression Outline :Algorithms in the Real World. Lempel-Ziv Algorithms. LZ77: Sliding Window Lempel-Ziv
Compression Outline 15-853:Algorithms in the Rel World Dt Compression III Introduction: Lossy vs. Lossless, Benchmrks, Informtion Theory: Entropy, etc. Proility Coding: Huffmn + Arithmetic Coding Applictions
More informationIntermediate Information Structures
CPSC 335 Intermedite Informtion Structures LECTURE 13 Suffix Trees Jon Rokne Computer Science University of Clgry Cnd Modified from CMSC 423 - Todd Trengen UMD upd Preprocessing Strings We will look t
More informationTO REGULAR EXPRESSIONS
Suject :- Computer Science Course Nme :- Theory Of Computtion DA TO REGULAR EXPRESSIONS Report Sumitted y:- Ajy Singh Meen 07000505 jysmeen@cse.iit.c.in BASIC DEINITIONS DA:- A finite stte mchine where
More informationPARALLEL AND DISTRIBUTED COMPUTING
PARALLEL AND DISTRIBUTED COMPUTING 2009/2010 1 st Semester Teste Jnury 9, 2010 Durtion: 2h00 - No extr mteril llowed. This includes notes, scrtch pper, clcultor, etc. - Give your nswers in the ville spce
More informationZZ - Advanced Math Review 2017
ZZ - Advnced Mth Review Mtrix Multipliction Given! nd! find the sum of the elements of the product BA First, rewrite the mtrices in the correct order to multiply The product is BA hs order x since B is
More informationA Tautology Checker loosely related to Stålmarck s Algorithm by Martin Richards
A Tutology Checker loosely relted to Stålmrck s Algorithm y Mrtin Richrds mr@cl.cm.c.uk http://www.cl.cm.c.uk/users/mr/ University Computer Lortory New Museum Site Pemroke Street Cmridge, CB2 3QG Mrtin
More informationMTH 146 Conics Supplement
105- Review of Conics MTH 146 Conics Supplement In this section we review conics If ou ne more detils thn re present in the notes, r through section 105 of the ook Definition: A prol is the set of points
More informationHyperbolas. Definition of Hyperbola
CHAT Pre-Clculus Hyperols The third type of conic is clled hyperol. For n ellipse, the sum of the distnces from the foci nd point on the ellipse is fixed numer. For hyperol, the difference of the distnces
More informationLecture 7: Integration Techniques
Lecture 7: Integrtion Techniques Antiderivtives nd Indefinite Integrls. In differentil clculus, we were interested in the derivtive of given rel-vlued function, whether it ws lgeric, eponentil or logrithmic.
More information2-3 search trees red-black BSTs B-trees
2-3 serch trees red-lck BTs B-trees 3 2-3 tree llow 1 or 2 keys per node. 2-node: one key, two children. 3-node: two keys, three children. ymmetric order. Inorder trversl yields keys in scending order.
More informationEngineer To Engineer Note
Engineer To Engineer Note EE-186 Technicl Notes on using Anlog Devices' DSP components nd development tools Contct our technicl support by phone: (800) ANALOG-D or e-mil: dsp.support@nlog.com Or visit
More informationBefore We Begin. Introduction to Spatial Domain Filtering. Introduction to Digital Image Processing. Overview (1): Administrative Details (1):
Overview (): Before We Begin Administrtive detils Review some questions to consider Winter 2006 Imge Enhncement in the Sptil Domin: Bsics of Sptil Filtering, Smoothing Sptil Filters, Order Sttistics Filters
More informationOutline. Introduction Suffix Trees (ST) Building STs in linear time: Ukkonen s algorithm Applications of ST
Suffi Trees Outline Introduction Suffi Trees (ST) Building STs in liner time: Ukkonen s lgorithm Applictions of ST 2 3 Introduction Sustrings String is ny sequence of chrcters. Sustring of string S is
More informationCOMBINATORIAL PATTERN MATCHING
COMBINATORIAL PATTERN MATCHING Genomic Repets Exmple of repets: ATGGTCTAGGTCCTAGTGGTC Motivtion to find them: Genomic rerrngements re often ssocited with repets Trce evolutionry secrets Mny tumors re chrcterized
More information5 Regular 4-Sided Composition
Xilinx-Lv User Guide 5 Regulr 4-Sided Composition This tutoril shows how regulr circuits with 4-sided elements cn be described in Lv. The type of regulr circuits tht re discussed in this tutoril re those
More informationCS481: Bioinformatics Algorithms
CS481: Bioinformtics Algorithms Cn Alkn EA509 clkn@cs.ilkent.edu.tr http://www.cs.ilkent.edu.tr/~clkn/teching/cs481/ EXACT STRING MATCHING Fingerprint ide Assume: We cn compute fingerprint f(p) of P in
More informationEngineer To Engineer Note
Engineer To Engineer Note EE-169 Technicl Notes on using Anlog Devices' DSP components nd development tools Contct our technicl support by phone: (800) ANALOG-D or e-mil: dsp.support@nlog.com Or visit
More informationUT1553B BCRT True Dual-port Memory Interface
UTMC APPICATION NOTE UT553B BCRT True Dul-port Memory Interfce INTRODUCTION The UTMC UT553B BCRT is monolithic CMOS integrted circuit tht provides comprehensive MI-STD- 553B Bus Controller nd Remote Terminl
More informationCSCI 104. Rafael Ferreira da Silva. Slides adapted from: Mark Redekopp and David Kempe
CSCI 0 fel Ferreir d Silv rfsilv@isi.edu Slides dpted from: Mrk edekopp nd Dvid Kempe LOG STUCTUED MEGE TEES Series Summtion eview Let n = + + + + k $ = #%& #. Wht is n? n = k+ - Wht is log () + log ()
More informationLexical Analysis. Amitabha Sanyal. (www.cse.iitb.ac.in/ as) Department of Computer Science and Engineering, Indian Institute of Technology, Bombay
Lexicl Anlysis Amith Snyl (www.cse.iit.c.in/ s) Deprtment of Computer Science nd Engineering, Indin Institute of Technology, Bomy Septemer 27 College of Engineering, Pune Lexicl Anlysis: 2/6 Recp The input
More informationDynamic Programming. Andreas Klappenecker. [partially based on slides by Prof. Welch] Monday, September 24, 2012
Dynmic Progrmming Andres Klppenecker [prtilly bsed on slides by Prof. Welch] 1 Dynmic Progrmming Optiml substructure An optiml solution to the problem contins within it optiml solutions to subproblems.
More informationRational Numbers---Adding Fractions With Like Denominators.
Rtionl Numbers---Adding Frctions With Like Denomintors. A. In Words: To dd frctions with like denomintors, dd the numertors nd write the sum over the sme denomintor. B. In Symbols: For frctions c nd b
More informationMATH 25 CLASS 5 NOTES, SEP
MATH 25 CLASS 5 NOTES, SEP 30 2011 Contents 1. A brief diversion: reltively prime numbers 1 2. Lest common multiples 3 3. Finding ll solutions to x + by = c 4 Quick links to definitions/theorems Euclid
More informationAnnouncements. CS 188: Artificial Intelligence Fall Recap: Search. Today. Example: Pancake Problem. Example: Pancake Problem
Announcements Project : erch It s live! Due 9/. trt erly nd sk questions. It s longer thn most! Need prtner? Come up fter clss or try Pizz ections: cn go to ny, ut hve priority in your own C 88: Artificil
More informationTransparent neutral-element elimination in MPI reduction operations
Trnsprent neutrl-element elimintion in MPI reduction opertions Jesper Lrsson Träff Deprtment of Scientific Computing University of Vienn Disclimer Exploiting repetition nd sprsity in input for reducing
More informationCSCI 3130: Formal Languages and Automata Theory Lecture 12 The Chinese University of Hong Kong, Fall 2011
CSCI 3130: Forml Lnguges nd utomt Theory Lecture 12 The Chinese University of Hong Kong, Fll 2011 ndrej Bogdnov In progrmming lnguges, uilding prse trees is significnt tsk ecuse prse trees tell us the
More informationCS321 Languages and Compiler Design I. Winter 2012 Lecture 5
CS321 Lnguges nd Compiler Design I Winter 2012 Lecture 5 1 FINITE AUTOMATA A non-deterministic finite utomton (NFA) consists of: An input lphet Σ, e.g. Σ =,. A set of sttes S, e.g. S = {1, 3, 5, 7, 11,
More informationcisc1110 fall 2010 lecture VI.2 call by value function parameters another call by value example:
cisc1110 fll 2010 lecture VI.2 cll y vlue function prmeters more on functions more on cll y vlue nd cll y reference pssing strings to functions returning strings from functions vrile scope glol vriles
More informationthis grammar generates the following language: Because this symbol will also be used in a later step, it receives the
LR() nlysis Drwcks of LR(). Look-hed symols s eplined efore, concerning LR(), it is possile to consult the net set to determine, in the reduction sttes, for which symols it would e possile to perform reductions.
More informationAn Algorithm for Enumerating All Maximal Tree Patterns Without Duplication Using Succinct Data Structure
, Mrch 12-14, 2014, Hong Kong An Algorithm for Enumerting All Mximl Tree Ptterns Without Dupliction Using Succinct Dt Structure Yuko ITOKAWA, Tomoyuki UCHIDA nd Motoki SANO Astrct In order to extrct structured
More informationMobile IP route optimization method for a carrier-scale IP network
Moile IP route optimiztion method for crrier-scle IP network Tkeshi Ihr, Hiroyuki Ohnishi, nd Ysushi Tkgi NTT Network Service Systems Lortories 3-9-11 Midori-cho, Musshino-shi, Tokyo 180-8585, Jpn Phone:
More informationToday. Search Problems. Uninformed Search Methods. Depth-First Search Breadth-First Search Uniform-Cost Search
Uninformed Serch [These slides were creted by Dn Klein nd Pieter Abbeel for CS188 Intro to AI t UC Berkeley. All CS188 mterils re vilble t http://i.berkeley.edu.] Tody Serch Problems Uninformed Serch Methods
More informationFrom Indexing Data Structures to de Bruijn Graphs
From Indexing Dt Structures to de Bruijn Grphs Bstien Czux, Thierry Lecroq, Eric Rivls LIRMM & IBC, Montpellier - LITIS Rouen June 1, 201 Czux, Lecroq, Rivls (LIRMM) Generlized Suffix Tree & DBG June 1,
More informationAI Adjacent Fields. This slide deck courtesy of Dan Klein at UC Berkeley
AI Adjcent Fields Philosophy: Logic, methods of resoning Mind s physicl system Foundtions of lerning, lnguge, rtionlity Mthemtics Forml representtion nd proof Algorithms, computtion, (un)decidility, (in)trctility
More informationPosition Heaps: A Simple and Dynamic Text Indexing Data Structure
Position Heps: A Simple nd Dynmic Text Indexing Dt Structure Andrzej Ehrenfeucht, Ross M. McConnell, Niss Osheim, Sung-Whn Woo Dept. of Computer Science, 40 UCB, University of Colordo t Boulder, Boulder,
More informationRegular Expression Matching with Multi-Strings and Intervals. Philip Bille Mikkel Thorup
Regulr Expression Mtching with Multi-Strings nd Intervls Philip Bille Mikkel Thorup Outline Definition Applictions Previous work Two new problems: Multi-strings nd chrcter clss intervls Algorithms Thompson
More informationCSc 453. Compilers and Systems Software. 4 : Lexical Analysis II. Department of Computer Science University of Arizona
CSc 453 Compilers nd Systems Softwre 4 : Lexicl Anlysis II Deprtment of Computer Science University of Arizon collerg@gmil.com Copyright c 2009 Christin Collerg Implementing Automt NFAs nd DFAs cn e hrd-coded
More informationLECT-10, S-1 FP2P08, Javed I.
A Course on Foundtions of Peer-to-Peer Systems & Applictions LECT-10, S-1 CS /799 Foundtion of Peer-to-Peer Applictions & Systems Kent Stte University Dept. of Computer Science www.cs.kent.edu/~jved/clss-p2p08
More informationDr. D.M. Akbar Hussain
Dr. D.M. Akr Hussin Lexicl Anlysis. Bsic Ide: Red the source code nd generte tokens, it is similr wht humns will do to red in; just tking on the input nd reking it down in pieces. Ech token is sequence
More informationOrthogonal line segment intersection
Computtionl Geometry [csci 3250] Line segment intersection The prolem (wht) Computtionl Geometry [csci 3250] Orthogonl line segment intersection Applictions (why) Algorithms (how) A specil cse: Orthogonl
More informationarxiv: v2 [cs.dm] 17 May 2014
EXTENDING ARTIAL RERESENTATIONS OF INTERVAL GRAHS. KLAVÍK, J. KRATOCHVÍL, Y. OTACHI, T. SAITOH, AND T. VYSKOČIL rxiv:1306.2182v2 [cs.dm] 17 My 2014 Astrct. Intervl grphs re intersection grphs of closed
More information9.1 apply the distance and midpoint formulas
9.1 pply the distnce nd midpoint formuls DISTANCE FORMULA MIDPOINT FORMULA To find the midpoint between two points x, y nd x y 1 1,, we Exmple 1: Find the distnce between the two points. Then, find the
More informationBlackbaud s Mailwise Service Analyse Records Updated by MailWise
Blckud s Milwise Service Anlyse Records Updted y MilWise To nlyse the updtes tht hve een performed y the import, run the relevnt queries from the list elow. The queries selected depend on the MilWise Services
More informationCS 241. Fall 2017 Midterm Review Solutions. October 24, Bits and Bytes 1. 3 MIPS Assembler 6. 4 Regular Languages 7.
CS 241 Fll 2017 Midterm Review Solutions Octoer 24, 2017 Contents 1 Bits nd Bytes 1 2 MIPS Assemly Lnguge Progrmming 2 3 MIPS Assemler 6 4 Regulr Lnguges 7 5 Scnning 9 1 Bits nd Bytes 1. Give two s complement
More informationCSEP 573 Artificial Intelligence Winter 2016
CSEP 573 Artificil Intelligence Winter 2016 Luke Zettlemoyer Problem Spces nd Serch slides from Dn Klein, Sturt Russell, Andrew Moore, Dn Weld, Pieter Abbeel, Ali Frhdi Outline Agents tht Pln Ahed Serch
More informationTyping with Weird Keyboards Notes
Typing with Weird Keyords Notes Ykov Berchenko-Kogn August 25, 2012 Astrct Consider lnguge with n lphet consisting of just four letters,,,, nd. There is spelling rule tht sys tht whenever you see n next
More informationCSCE 531, Spring 2017, Midterm Exam Answer Key
CCE 531, pring 2017, Midterm Exm Answer Key 1. (15 points) Using the method descried in the ook or in clss, convert the following regulr expression into n equivlent (nondeterministic) finite utomton: (
More informationINTRODUCTION TO SIMPLICIAL COMPLEXES
INTRODUCTION TO SIMPLICIAL COMPLEXES CASEY KELLEHER AND ALESSANDRA PANTANO 0.1. Introduction. In this ctivity set we re going to introduce notion from Algebric Topology clled simplicil homology. The min
More informationStack. A list whose end points are pointed by top and bottom
4. Stck Stck A list whose end points re pointed by top nd bottom Insertion nd deletion tke plce t the top (cf: Wht is the difference between Stck nd Arry?) Bottom is constnt, but top grows nd shrinks!
More informationSimplifying Algebra. Simplifying Algebra. Curriculum Ready.
Simplifying Alger Curriculum Redy www.mthletics.com This ooklet is ll out turning complex prolems into something simple. You will e le to do something like this! ( 9- # + 4 ' ) ' ( 9- + 7-) ' ' Give this
More informationGraphing Conic Sections
Grphing Conic Sections Definition of Circle Set of ll points in plne tht re n equl distnce, clled the rdius, from fixed point in tht plne, clled the center. Grphing Circle (x h) 2 + (y k) 2 = r 2 where
More informationAlgorithm Design (5) Text Search
Algorithm Design (5) Text Serch Tkshi Chikym School of Engineering The University of Tokyo Text Serch Find sustring tht mtches the given key string in text dt of lrge mount Key string: chr x[m] Text Dt:
More informationGrade 7/8 Math Circles Geometric Arithmetic October 31, 2012
Fculty of Mthemtics Wterloo, Ontrio N2L 3G1 Grde 7/8 Mth Circles Geometric Arithmetic Octoer 31, 2012 Centre for Eduction in Mthemtics nd Computing Ancient Greece hs given irth to some of the most importnt
More informationDefinition of Regular Expression
Definition of Regulr Expression After the definition of the string nd lnguges, we re redy to descrie regulr expressions, the nottion we shll use to define the clss of lnguges known s regulr sets. Recll
More informationA Sparse Grid Representation for Dynamic Three-Dimensional Worlds
A Sprse Grid Representtion for Dynmic Three-Dimensionl Worlds Nthn R. Sturtevnt Deprtment of Computer Science University of Denver Denver, CO, 80208 sturtevnt@cs.du.edu Astrct Grid representtions offer
More informationCSCI 446: Artificial Intelligence
CSCI 446: Artificil Intelligence Serch Instructor: Michele Vn Dyne [These slides were creted by Dn Klein nd Pieter Abbeel for CS188 Intro to AI t UC Berkeley. All CS188 mterils re vilble t http://i.berkeley.edu.]
More informationPhylogeny and Molecular Evolution
Phylogeny nd Moleculr Evolution Chrcter Bsed Phylogeny 1/50 Credit Ron Shmir s lecture notes Notes by Nir Friedmn Dn Geiger, Shlomo Morn, Sgi Snir nd Ron Shmir Durbin et l. Jones nd Pevzner s presenttion
More informationSOME EXAMPLES OF SUBDIVISION OF SMALL CATEGORIES
SOME EXAMPLES OF SUBDIVISION OF SMALL CATEGORIES MARCELLO DELGADO Abstrct. The purpose of this pper is to build up the bsic conceptul frmework nd underlying motivtions tht will llow us to understnd ctegoricl
More informationDetermining Single Connectivity in Directed Graphs
Determining Single Connectivity in Directed Grphs Adm L. Buchsbum 1 Mrtin C. Crlisle 2 Reserch Report CS-TR-390-92 September 1992 Abstrct In this pper, we consider the problem of determining whether or
More informationPremaster Course Algorithms 1 Chapter 6: Shortest Paths. Christian Scheideler SS 2018
Premster Course Algorithms Chpter 6: Shortest Pths Christin Scheieler SS 8 Bsic Grph Algorithms Overview: Shortest pths in DAGs Dijkstr s lgorithm Bellmn-For lgorithm Johnson s metho SS 8 Chpter 6 Shortest
More informationImplementing Automata. CSc 453. Compilers and Systems Software. 4 : Lexical Analysis II. Department of Computer Science University of Arizona
Implementing utomt Sc 5 ompilers nd Systems Softwre : Lexicl nlysis II Deprtment of omputer Science University of rizon collerg@gmil.com opyright c 009 hristin ollerg NFs nd DFs cn e hrd-coded using this
More informationUNIT 11. Query Optimization
UNIT Query Optimiztion Contents Introduction to Query Optimiztion 2 The Optimiztion Process: An Overview 3 Optimiztion in System R 4 Optimiztion in INGRES 5 Implementing the Join Opertors Wei-Png Yng,
More informationAlignment of Long Sequences. BMI/CS Spring 2012 Colin Dewey
Alignment of Long Sequences BMI/CS 776 www.biostt.wisc.edu/bmi776/ Spring 2012 Colin Dewey cdewey@biostt.wisc.edu Gols for Lecture the key concepts to understnd re the following how lrge-scle lignment
More informationASTs, Regex, Parsing, and Pretty Printing
ASTs, Regex, Prsing, nd Pretty Printing CS 2112 Fll 2016 1 Algeric Expressions To strt, consider integer rithmetic. Suppose we hve the following 1. The lphet we will use is the digits {0, 1, 2, 3, 4, 5,
More informationIntroduction to Integration
Introduction to Integrtion Definite integrls of piecewise constnt functions A constnt function is function of the form Integrtion is two things t the sme time: A form of summtion. The opposite of differentition.
More informationdocuments 1. Introduction
www.ijcsi.org 4 Efficient structurl similrity computtion etween XML documents Ali Aïtelhdj Computer Science Deprtment, Fculty of Electricl Engineering nd Computer Science Mouloud Mmmeri University of Tizi-Ouzou
More informationDiscussion 1 Recap. COP4600 Discussion 2 OS concepts, System call, and Assignment 1. Questions. Questions. Outline. Outline 10/24/2010
COP4600 Discussion 2 OS concepts, System cll, nd Assignment 1 TA: Hufeng Jin hj0@cise.ufl.edu Discussion 1 Recp Introduction to C C Bsic Types (chr, int, long, flot, doule, ) C Preprocessors (#include,
More informationSIMPLIFYING ALGEBRA PASSPORT.
SIMPLIFYING ALGEBRA PASSPORT www.mthletics.com.u This booklet is ll bout turning complex problems into something simple. You will be ble to do something like this! ( 9- # + 4 ' ) ' ( 9- + 7-) ' ' Give
More information12-B FRACTIONS AND DECIMALS
-B Frctions nd Decimls. () If ll four integers were negtive, their product would be positive, nd so could not equl one of them. If ll four integers were positive, their product would be much greter thn
More informationOUTPUT DELIVERY SYSTEM
Differences in ODS formtting for HTML with Proc Print nd Proc Report Lur L. M. Thornton, USDA-ARS, Animl Improvement Progrms Lortory, Beltsville, MD ABSTRACT While Proc Print is terrific tool for dt checking
More informationNetwork Interconnection: Bridging CS 571 Fall Kenneth L. Calvert All rights reserved
Network Interconnection: Bridging CS 57 Fll 6 6 Kenneth L. Clvert All rights reserved The Prolem We know how to uild (rodcst) LANs Wnt to connect severl LANs together to overcome scling limits Recll: speed
More information