Presentation Martin Randers

Size: px
Start display at page:

Download "Presentation Martin Randers"

Transcription

1 Presenttion Mrtin Rnders

2 Outline Introduction Algorithms Implementtion nd experiments Memory consumption Summry

3 Introduction

4 Introduction Evolution of species cn e modelled in trees Trees consist of nodes nd edges nodes divided into leves nd internl nodes edges connecting internl nodes re clled internl edges

5 The Qurtet Distnce A qurtet is set of four leves Cn hve four possile qurtet topologies c c d c d d c d Butterfly topologies Str topology The qurtet distnce etween pir of trees is the numer of qurtets with different topologies

6 Other Algorithms Previously: Binry trees lgorithms creted y Tsng O n 2 & Brodl et l. O n log n Now: Trees of ritrry degrees Generliztion of Tsngs lgorithm uses time O V d 2 V ' d ' 2 Generliztion of Brodl et l.'s lgorithm to trees of ounded degree uses time O d 9 n log n

7 Algorithms

8 Algorithms Wys to compute shred lef set sizes re presented in thesis Five lgorithms for computing the qurtet distnce designed nd implemented: Two center sed Two sed on edge climing One sed on node climing

9 Center Bsed Algorithms Oservtion: Ech triplet of leves hs unique internl node s center

10 Center Bsed Algorithms Oservtion: Ech triplet of leves hs unique internl node s center The center of, nd c c

11 Center Bsed Algorithms Oservtion: Ech triplet of leves hs unique internl node s center The center of, nd c c The topologies of qurtets contining the triplet esily determined from this center

12 Center Bsed Algorithms Oservtion: Ech triplet of leves hs unique internl node s center The center of, nd c c The topologies of qurtets contining the triplet esily determined from this center y x c

13 Center Bsed Algorithms Oservtion: Ech triplet of leves hs unique internl node s center The center of, nd c c The topologies of qurtets contining the triplet esily determined from this center y c x x y The topologies c c

14 First Center Bsed Algorithm O n 4 lgorithm: For ech triplet of leves: Find center of the triplet, in ech tree Determine topology of qurtets, in ech tree Compre topology of qurtets Uses spce O(n) to store topologies

15 Second Center Bsed Algorithm O n 3 lgorithm: Precompute shred lef set sizes For ech pir of leves: Find center of ech triplet contining the pir, in ech tree Use precomputed sizes to clculte numer of shred qurtets Uses spce to store shred lef set sizes O n 2

16 Hndling Str Qurtets Qurtets cn e divided into five ctegories: Q SS T,T ',Q SB T,T ',Q BS T,T ', Q B=B T,T ',Q B B T,T '

17 Hndling Str Qurtets Qurtets cn e divided into five ctegories: Q SS T,T ',Q SB T,T ',Q BS T,T ', Q B=B T,T ',Q B B T,T ' qdist T,T '

18 Hndling Str Qurtets Qurtets cn e divided into five ctegories: Q SS T,T ',Q SB T,T ',Q BS T,T ', Q B=B T,T ',Q B B T,T ' qdist T,T ' Oserve tht Q B=B T,T =Q BS T,T ' Q B=B T,T ' Q B B T,T ' Q B=B T ',T ' =Q SB T,T ' Q B=B T,T ' Q B B T,T '

19 Hndling Str Qurtets Qurtets cn e divided into five ctegories: Oserve tht Yielding Q SS T,T ',Q SB T,T ',Q BS T,T ', Q B=B T,T ',Q B B T,T ' qdist T,T ' Q B=B T,T =Q BS T,T ' Q B=B T,T ' Q B B T,T ' Q B=B T ',T ' =Q SB T,T ' Q B=B T,T ' Q B B T,T ' qdist T,T ' =Q B=B T,T Q B=B T ',T ' 2Q B=B T,T ' Q B B T,T '

20 Climing Associting qurtets to specific edges or nodes in the trees Clculte shred/nonshred qurtets y processing pirs of edges/nodes Importnt tht ech qurtet is climed y fixed numer of edges/nodes

21 Edge Climing Ech directed internl edge e clims ll utterfly qurtets where two leves re locted in two different sutrees in front of e, nd the other two re in the sutree ehind e e x c d

22 Edge Climing Ech directed internl edge e clims ll utterfly qurtets where two leves re locted in two different sutrees in front of e, nd the other two re in the sutree ehind e e x c d e clims cx nd dx, ut not cd

23 Edge Climing Ech directed internl edge e clims ll utterfly qurtets where two leves re locted in two different sutrees in front of e, nd the other two re in the sutree ehind e e x c d e clims cx nd dx, ut not cd Ech utterfly qurtet is climed y exctly two directed edges

24 Encoding The qurtets climed y ech edge cn e encoded s numer of triplets of sutrees (clims) The numer of shred nd nonshred qurtets in pir of clims cn e computed in time O(1) If e points to node of degree d, it tkes d 1 clims to encode the qurtets climed Processing ll pirs of clims tkes time 2 v V v' V ' id v d v 1 2 id v ' d v' 1 2 =O V V ' d 2 d ' 2

25 Expnsion First edge climing lgorithm: Expnd the trees to inry trees, nd define extended clims Compute shred lef set sizes Process ll pirs of extended clims If e points to node of degree d, it tkes d 1 extended clims to encode the qurtets climed Processing ll pirs of extended clims thus tkes time v V v' V ' id v d v id v ' d v' =O V V ' dd ' Uses spce O n 2 to store shred lef set sizes

26 Counting Insted of encoding, count numer of shred/nonshred qurtets climed y oth edges directly Done in three steps for pir of edges: i. Count too mny (some illegl ) ii. Deduct ll the illegl ones (some twice) iii. Add the ones tht were deducted twice If pir of edges points to nodes of internl degrees id nd id' respectively this cn e done in time O(idid')

27 Counting (cont) Second edge climing lgorithm: Compute shred lef set sizes of non lef sutrees Do the counting descried ove for ech pir of edges Doing precomputtions nd processing ll pirs of edges tkes time O n V V ' v V v ' V ' id 2 2 v id =O n v ' V V ' idid ' Uses spce O n V V ' sizes nd sizes of sutrees to store shred lef set

28 Node Climing Motivtion: A lot of redundnt computtions re done in the second edge climing lgorithm Ech internl node v clims ll utterfly qurtets climed y directed internl edges pointing to v Ech utterfly qurtet is climed y exctly two directed edges

29 Shred Qurtets Given pir of nodes v nd v' numer of sums cn e precomputed in time O id v id v' O id v id v ' nd spce These enles the numer of shred qurtets climed y oth nodes to e computed in time O id v id v '

30 Nonshred Qurtets By precomputing n dditionl sums O min {id v,id v ' } 2 in time O id v id v ' min {id v,id } v' it is lso possile to compute the numer of nonshred qurtets climed y the nodes in time O id v id v ' min {id v,id v ' }

31 The Algorithm Node climing lgorithm: Compute shred lef set sizes of non lef sutrees For ech pir of nodes: Do the precomputing descried ove Compute shred nd nonshred qurtets This tkes time O n V V ' min {id,id ' }... nd uses spce O n V V '

32 Implementtion & Experiments

33 Implementtion All of the presented lgorithms hve een implemented in Jv Tool, with optionl GUI, ville for downlod Experiments hs een performed using these implementtions

34 Experiments The correctness of lgorithms vlidted y compring results The lgorithms were run on four clsses of trees to investigte ctul running times: worst cse d ry rndom r8s sed

35 Experiments The correctness of lgorithms vlidted y compring results The lgorithms were run on four clsses of trees to investigte ctul running times: worst cse d ry rndom r8s sed

36 Exmple of Results

37 Compring the Algorithms

38 More Comprison

39 Anlysis of Results The symptotic performnce ws s expected The second edge climing nd the node climing re clerly fster thn the others. The node climing lgorithm ws chosen for the tool

40 Reducing Memory Consumption

41 Reducing Memory Consumption The work hs een focused t reducing running time, not memory consumption Reduction in memory from O n 2 to ws just yproduct of optimizing running time Cn further reduction e done, mye t the cost of dding running time? O n V V '

42 Importnt Fcts When processing pir of nodes it is necessry nd sufficient to know the shred lef set sizes of ll pirs of non lef sutrees of the nodes, nd the sizes of individul sutrees Implies tht trivil lower ound on memory consumption is O(n+id id') The chllenge:

43 Importnt Fcts When processing pir of nodes it is necessry nd sufficient to know the shred lef set sizes of ll pirs of non lef sutrees of the nodes, nd the sizes of individul sutrees Implies tht trivil lower ound on memory consumption is O(n+id id') The chllenge: The shred lef set sizes of sutrees re clculted using other shred lef set sizes, i.e. they re not independent

44 Bsic Ide The ide is inspired y the O(n log(n)) lgorithm:

45 Bsic Ide The ide is inspired y the O(n log(n)) lgorithm: Do numer of colorings of the leves in one tree

46 Bsic Ide The ide is inspired y the O(n log(n)) lgorithm: Do numer of colorings of the leves in one tree Build some structure sed on the other tree nd updte it when colors chnge

47 Coloring Let v e n internl node in tree T. T is sid to e colored ccording to v if the leves of ech non lef sutree of v re colored with the colors 1,...,id v, one for ech sutree, nd ll leves directly connected to v re colored with the color 0

48 Coloring Let v e n internl node in tree T. T is sid to e colored ccording to v if the leves of ech non lef sutree of v re colored with the colors 1,...,id v, one for ech sutree, nd ll leves directly connected to v re colored with the color 0 c v f g d e

49 Coloring Let v e n internl node in tree T. T is sid to e colored ccording to v if the leves of ech non lef sutree of v re colored with the colors 1,...,id v, one for ech sutree, nd ll leves directly connected to v re colored with the color 0 c f v color g v c f g 0,1,2,3 d e d e

50 Structure Root the other tree in n ritrry internl node, nd dd n rry to ech internl node with id v entries Color the leves in the rooted tree Initilize the entries in the rrys with the numer of leves of ech color directly connected to the node Updte the rrys depth first with the sum of the entries in the rrys of the children

51 Exmple d c r g e f

52 Exmple d c r g root r e f d c e f g

53 Exmple d c r g root r e f dd rrys d c e f g r g d c e f

54 Exmple d c r g root r e f dd rrys d c e f g r r g color leves g 0,1,2,3 d c e f d c e f

55 Exmple d c e f r g root dd rrys d c e f r g r r g color leves g 0,1,2,3 d c e f r g init rrys d c e f d c e f

56 Exmple d c r e f d c e f g r root dd rrys g color leves r init rrys g updte rrys d c e f d c e f r d c e f d c e f g r r g g 0,1,2,3

57 Anlysis Rooting cn e done once nd for ll in constnt time For ech node v in T: Coloring cn e done in time O(n) Adding rrys tkes time Updting rrys tkes time Spce consumption is O V ' id v O V ' id v O v ' V ' id v id v' =O V ' id v

58 Anlysis (cont) Computtion cn e done s efore, except the nodes must e hndled in n ordered wy The time to hndle ll pirs of nodes is O V V ' min {id,id ' } Totl complexities re thus: O V n V V ' min {id,id ' } time, nd O V ' id spce Note tht the roles of the trees cn e switched

59 Summry

60 Overview Presented here: The prolem Existing lgorithms A wy to void str qurtets The five lgorithms designed nd implemented

61 Overview Presented here: The prolem Existing lgorithms A wy to void str qurtets The five lgorithms designed nd implemented

62 Overview Presented here: The prolem Existing lgorithms A wy to void str qurtets The five lgorithms designed nd implemented Some of the experiments performed A wy to reduce the memory consumption of the fstest lgorithm (t performnce cost)

63 Additionl Work in Thesis Additionl work in the thesis: Wys to compute shred lef set sizes Generliztion of existing mesures Hndling non stndrd input trees Visuliztion Presenttion of tool Comprison with split distnce

64 The End

What are suffix trees?

What are suffix trees? Suffix Trees 1 Wht re suffix trees? Allow lgorithm designers to store very lrge mount of informtion out strings while still keeping within liner spce Allow users to serch for new strings in the originl

More information

Ma/CS 6b Class 1: Graph Recap

Ma/CS 6b Class 1: Graph Recap M/CS 6 Clss 1: Grph Recp By Adm Sheffer Course Detils Adm Sheffer. Office hour: Tuesdys 4pm. dmsh@cltech.edu TA: Victor Kstkin. Office hour: Tuesdys 7pm. 1:00 Mondy, Wednesdy, nd Fridy. http://www.mth.cltech.edu/~2014-15/2term/m006/

More information

2 Computing all Intersections of a Set of Segments Line Segment Intersection

2 Computing all Intersections of a Set of Segments Line Segment Intersection 15-451/651: Design & Anlysis of Algorithms Novemer 14, 2016 Lecture #21 Sweep-Line nd Segment Intersection lst chnged: Novemer 8, 2017 1 Preliminries The sweep-line prdigm is very powerful lgorithmic design

More information

COMP 423 lecture 11 Jan. 28, 2008

COMP 423 lecture 11 Jan. 28, 2008 COMP 423 lecture 11 Jn. 28, 2008 Up to now, we hve looked t how some symols in n lphet occur more frequently thn others nd how we cn sve its y using code such tht the codewords for more frequently occuring

More information

Information Retrieval and Organisation

Information Retrieval and Organisation Informtion Retrievl nd Orgnistion Suffix Trees dpted from http://www.mth.tu.c.il/~himk/seminr02/suffixtrees.ppt Dell Zhng Birkeck, University of London Trie A tree representing set of strings { } eef d

More information

Ma/CS 6b Class 1: Graph Recap

Ma/CS 6b Class 1: Graph Recap M/CS 6 Clss 1: Grph Recp By Adm Sheffer Course Detils Instructor: Adm Sheffer. TA: Cosmin Pohot. 1pm Mondys, Wednesdys, nd Fridys. http://mth.cltech.edu/~2015-16/2term/m006/ Min ook: Introduction to Grph

More information

Suffix trees, suffix arrays, BWT

Suffix trees, suffix arrays, BWT ALGORITHMES POUR LA BIO-INFORMATIQUE ET LA VISUALISATION COURS 3 Rluc Uricru Suffix trees, suffix rrys, BWT Bsed on: Suffix trees nd suffix rrys presenttion y Him Kpln Suffix trees course y Pco Gomez Liner-Time

More information

Slides for Data Mining by I. H. Witten and E. Frank

Slides for Data Mining by I. H. Witten and E. Frank Slides for Dt Mining y I. H. Witten nd E. Frnk Simplicity first Simple lgorithms often work very well! There re mny kinds of simple structure, eg: One ttriute does ll the work All ttriutes contriute eqully

More information

10.5 Graphing Quadratic Functions

10.5 Graphing Quadratic Functions 0.5 Grphing Qudrtic Functions Now tht we cn solve qudrtic equtions, we wnt to lern how to grph the function ssocited with the qudrtic eqution. We cll this the qudrtic function. Grphs of Qudrtic Functions

More information

Solving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence Winter 2016

Solving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence Winter 2016 Solving Prolems y Serching CS 486/686: Introduction to Artificil Intelligence Winter 2016 1 Introduction Serch ws one of the first topics studied in AI - Newell nd Simon (1961) Generl Prolem Solver Centrl

More information

From Dependencies to Evaluation Strategies

From Dependencies to Evaluation Strategies From Dependencies to Evlution Strtegies Possile strtegies: 1 let the user define the evlution order 2 utomtic strtegy sed on the dependencies: use locl dependencies to determine which ttriutes to compute

More information

ITEC2620 Introduction to Data Structures

ITEC2620 Introduction to Data Structures ITEC0 Introduction to Dt Structures Lecture 7 Queues, Priority Queues Queues I A queue is First-In, First-Out = FIFO uffer e.g. line-ups People enter from the ck of the line People re served (exit) from

More information

In the last lecture, we discussed how valid tokens may be specified by regular expressions.

In the last lecture, we discussed how valid tokens may be specified by regular expressions. LECTURE 5 Scnning SYNTAX ANALYSIS We know from our previous lectures tht the process of verifying the syntx of the progrm is performed in two stges: Scnning: Identifying nd verifying tokens in progrm.

More information

Tries. Yufei Tao KAIST. April 9, Y. Tao, April 9, 2013 Tries

Tries. Yufei Tao KAIST. April 9, Y. Tao, April 9, 2013 Tries Tries Yufei To KAIST April 9, 2013 Y. To, April 9, 2013 Tries In this lecture, we will discuss the following exct mtching prolem on strings. Prolem Let S e set of strings, ech of which hs unique integer

More information

Section 10.4 Hyperbolas

Section 10.4 Hyperbolas 66 Section 10.4 Hyperbols Objective : Definition of hyperbol & hyperbols centered t (0, 0). The third type of conic we will study is the hyperbol. It is defined in the sme mnner tht we defined the prbol

More information

6.3 Volumes. Just as area is always positive, so is volume and our attitudes towards finding it.

6.3 Volumes. Just as area is always positive, so is volume and our attitudes towards finding it. 6.3 Volumes Just s re is lwys positive, so is volume nd our ttitudes towrds finding it. Let s review how to find the volume of regulr geometric prism, tht is, 3-dimensionl oject with two regulr fces seprted

More information

P(r)dr = probability of generating a random number in the interval dr near r. For this probability idea to make sense we must have

P(r)dr = probability of generating a random number in the interval dr near r. For this probability idea to make sense we must have Rndom Numers nd Monte Crlo Methods Rndom Numer Methods The integrtion methods discussed so fr ll re sed upon mking polynomil pproximtions to the integrnd. Another clss of numericl methods relies upon using

More information

Solving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence

Solving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence Solving Prolems y Serching CS 486/686: Introduction to Artificil Intelligence 1 Introduction Serch ws one of the first topics studied in AI - Newell nd Simon (1961) Generl Prolem Solver Centrl component

More information

Fig.25: the Role of LEX

Fig.25: the Role of LEX The Lnguge for Specifying Lexicl Anlyzer We shll now study how to uild lexicl nlyzer from specifiction of tokens in the form of list of regulr expressions The discussion centers round the design of n existing

More information

If you are at the university, either physically or via the VPN, you can download the chapters of this book as PDFs.

If you are at the university, either physically or via the VPN, you can download the chapters of this book as PDFs. Lecture 5 Wlks, Trils, Pths nd Connectedness Reding: Some of the mteril in this lecture comes from Section 1.2 of Dieter Jungnickel (2008), Grphs, Networks nd Algorithms, 3rd edition, which is ville online

More information

CS311H: Discrete Mathematics. Graph Theory IV. A Non-planar Graph. Regions of a Planar Graph. Euler s Formula. Instructor: Işıl Dillig

CS311H: Discrete Mathematics. Graph Theory IV. A Non-planar Graph. Regions of a Planar Graph. Euler s Formula. Instructor: Işıl Dillig CS311H: Discrete Mthemtics Grph Theory IV Instructor: Işıl Dillig Instructor: Işıl Dillig, CS311H: Discrete Mthemtics Grph Theory IV 1/25 A Non-plnr Grph Regions of Plnr Grph The plnr representtion of

More information

CS201 Discussion 10 DRAWTREE + TRIES

CS201 Discussion 10 DRAWTREE + TRIES CS201 Discussion 10 DRAWTREE + TRIES DrwTree First instinct: recursion As very generic structure, we could tckle this problem s follows: drw(): Find the root drw(root) drw(root): Write the line for the

More information

I/O Efficient Dynamic Data Structures for Longest Prefix Queries

I/O Efficient Dynamic Data Structures for Longest Prefix Queries I/O Efficient Dynmic Dt Structures for Longest Prefix Queries Moshe Hershcovitch 1 nd Him Kpln 2 1 Fculty of Electricl Engineering, moshik1@gmil.com 2 School of Computer Science, himk@cs.tu.c.il, Tel Aviv

More information

Lecture 10 Evolutionary Computation: Evolution strategies and genetic programming

Lecture 10 Evolutionary Computation: Evolution strategies and genetic programming Lecture 10 Evolutionry Computtion: Evolution strtegies nd genetic progrmming Evolution strtegies Genetic progrmming Summry Negnevitsky, Person Eduction, 2011 1 Evolution Strtegies Another pproch to simulting

More information

Today. CS 188: Artificial Intelligence Fall Recap: Search. Example: Pancake Problem. Example: Pancake Problem. General Tree Search.

Today. CS 188: Artificial Intelligence Fall Recap: Search. Example: Pancake Problem. Example: Pancake Problem. General Tree Search. CS 88: Artificil Intelligence Fll 00 Lecture : A* Serch 9//00 A* Serch rph Serch Tody Heuristic Design Dn Klein UC Berkeley Multiple slides from Sturt Russell or Andrew Moore Recp: Serch Exmple: Pncke

More information

Suffix Tries. Slides adapted from the course by Ben Langmead

Suffix Tries. Slides adapted from the course by Ben Langmead Suffix Tries Slides dpted from the course y Ben Lngmed en.lngmed@gmil.com Indexing with suffixes Until now, our indexes hve een sed on extrcting sustrings from T A very different pproch is to extrct suffixes

More information

CS143 Handout 07 Summer 2011 June 24 th, 2011 Written Set 1: Lexical Analysis

CS143 Handout 07 Summer 2011 June 24 th, 2011 Written Set 1: Lexical Analysis CS143 Hndout 07 Summer 2011 June 24 th, 2011 Written Set 1: Lexicl Anlysis In this first written ssignment, you'll get the chnce to ply round with the vrious constructions tht come up when doing lexicl

More information

CSCI1950 Z Computa4onal Methods for Biology Lecture 2. Ben Raphael January 26, hhp://cs.brown.edu/courses/csci1950 z/ Outline

CSCI1950 Z Computa4onal Methods for Biology Lecture 2. Ben Raphael January 26, hhp://cs.brown.edu/courses/csci1950 z/ Outline CSCI1950 Z Comput4onl Methods for Biology Lecture 2 Ben Rphel Jnury 26, 2009 hhp://cs.brown.edu/courses/csci1950 z/ Outline Review of trees. Coun4ng fetures. Chrcter bsed phylogeny Mximum prsimony Mximum

More information

The Greedy Method. The Greedy Method

The Greedy Method. The Greedy Method Lists nd Itertors /8/26 Presenttion for use with the textook, Algorithm Design nd Applictions, y M. T. Goodrich nd R. Tmssi, Wiley, 25 The Greedy Method The Greedy Method The greedy method is generl lgorithm

More information

Compression Outline :Algorithms in the Real World. Lempel-Ziv Algorithms. LZ77: Sliding Window Lempel-Ziv

Compression Outline :Algorithms in the Real World. Lempel-Ziv Algorithms. LZ77: Sliding Window Lempel-Ziv Compression Outline 15-853:Algorithms in the Rel World Dt Compression III Introduction: Lossy vs. Lossless, Benchmrks, Informtion Theory: Entropy, etc. Proility Coding: Huffmn + Arithmetic Coding Applictions

More information

Intermediate Information Structures

Intermediate Information Structures CPSC 335 Intermedite Informtion Structures LECTURE 13 Suffix Trees Jon Rokne Computer Science University of Clgry Cnd Modified from CMSC 423 - Todd Trengen UMD upd Preprocessing Strings We will look t

More information

TO REGULAR EXPRESSIONS

TO REGULAR EXPRESSIONS Suject :- Computer Science Course Nme :- Theory Of Computtion DA TO REGULAR EXPRESSIONS Report Sumitted y:- Ajy Singh Meen 07000505 jysmeen@cse.iit.c.in BASIC DEINITIONS DA:- A finite stte mchine where

More information

PARALLEL AND DISTRIBUTED COMPUTING

PARALLEL AND DISTRIBUTED COMPUTING PARALLEL AND DISTRIBUTED COMPUTING 2009/2010 1 st Semester Teste Jnury 9, 2010 Durtion: 2h00 - No extr mteril llowed. This includes notes, scrtch pper, clcultor, etc. - Give your nswers in the ville spce

More information

ZZ - Advanced Math Review 2017

ZZ - Advanced Math Review 2017 ZZ - Advnced Mth Review Mtrix Multipliction Given! nd! find the sum of the elements of the product BA First, rewrite the mtrices in the correct order to multiply The product is BA hs order x since B is

More information

A Tautology Checker loosely related to Stålmarck s Algorithm by Martin Richards

A Tautology Checker loosely related to Stålmarck s Algorithm by Martin Richards A Tutology Checker loosely relted to Stålmrck s Algorithm y Mrtin Richrds mr@cl.cm.c.uk http://www.cl.cm.c.uk/users/mr/ University Computer Lortory New Museum Site Pemroke Street Cmridge, CB2 3QG Mrtin

More information

MTH 146 Conics Supplement

MTH 146 Conics Supplement 105- Review of Conics MTH 146 Conics Supplement In this section we review conics If ou ne more detils thn re present in the notes, r through section 105 of the ook Definition: A prol is the set of points

More information

Hyperbolas. Definition of Hyperbola

Hyperbolas. Definition of Hyperbola CHAT Pre-Clculus Hyperols The third type of conic is clled hyperol. For n ellipse, the sum of the distnces from the foci nd point on the ellipse is fixed numer. For hyperol, the difference of the distnces

More information

Lecture 7: Integration Techniques

Lecture 7: Integration Techniques Lecture 7: Integrtion Techniques Antiderivtives nd Indefinite Integrls. In differentil clculus, we were interested in the derivtive of given rel-vlued function, whether it ws lgeric, eponentil or logrithmic.

More information

2-3 search trees red-black BSTs B-trees

2-3 search trees red-black BSTs B-trees 2-3 serch trees red-lck BTs B-trees 3 2-3 tree llow 1 or 2 keys per node. 2-node: one key, two children. 3-node: two keys, three children. ymmetric order. Inorder trversl yields keys in scending order.

More information

Engineer To Engineer Note

Engineer To Engineer Note Engineer To Engineer Note EE-186 Technicl Notes on using Anlog Devices' DSP components nd development tools Contct our technicl support by phone: (800) ANALOG-D or e-mil: dsp.support@nlog.com Or visit

More information

Before We Begin. Introduction to Spatial Domain Filtering. Introduction to Digital Image Processing. Overview (1): Administrative Details (1):

Before We Begin. Introduction to Spatial Domain Filtering. Introduction to Digital Image Processing. Overview (1): Administrative Details (1): Overview (): Before We Begin Administrtive detils Review some questions to consider Winter 2006 Imge Enhncement in the Sptil Domin: Bsics of Sptil Filtering, Smoothing Sptil Filters, Order Sttistics Filters

More information

Outline. Introduction Suffix Trees (ST) Building STs in linear time: Ukkonen s algorithm Applications of ST

Outline. Introduction Suffix Trees (ST) Building STs in linear time: Ukkonen s algorithm Applications of ST Suffi Trees Outline Introduction Suffi Trees (ST) Building STs in liner time: Ukkonen s lgorithm Applictions of ST 2 3 Introduction Sustrings String is ny sequence of chrcters. Sustring of string S is

More information

COMBINATORIAL PATTERN MATCHING

COMBINATORIAL PATTERN MATCHING COMBINATORIAL PATTERN MATCHING Genomic Repets Exmple of repets: ATGGTCTAGGTCCTAGTGGTC Motivtion to find them: Genomic rerrngements re often ssocited with repets Trce evolutionry secrets Mny tumors re chrcterized

More information

5 Regular 4-Sided Composition

5 Regular 4-Sided Composition Xilinx-Lv User Guide 5 Regulr 4-Sided Composition This tutoril shows how regulr circuits with 4-sided elements cn be described in Lv. The type of regulr circuits tht re discussed in this tutoril re those

More information

CS481: Bioinformatics Algorithms

CS481: Bioinformatics Algorithms CS481: Bioinformtics Algorithms Cn Alkn EA509 clkn@cs.ilkent.edu.tr http://www.cs.ilkent.edu.tr/~clkn/teching/cs481/ EXACT STRING MATCHING Fingerprint ide Assume: We cn compute fingerprint f(p) of P in

More information

Engineer To Engineer Note

Engineer To Engineer Note Engineer To Engineer Note EE-169 Technicl Notes on using Anlog Devices' DSP components nd development tools Contct our technicl support by phone: (800) ANALOG-D or e-mil: dsp.support@nlog.com Or visit

More information

UT1553B BCRT True Dual-port Memory Interface

UT1553B BCRT True Dual-port Memory Interface UTMC APPICATION NOTE UT553B BCRT True Dul-port Memory Interfce INTRODUCTION The UTMC UT553B BCRT is monolithic CMOS integrted circuit tht provides comprehensive MI-STD- 553B Bus Controller nd Remote Terminl

More information

CSCI 104. Rafael Ferreira da Silva. Slides adapted from: Mark Redekopp and David Kempe

CSCI 104. Rafael Ferreira da Silva. Slides adapted from: Mark Redekopp and David Kempe CSCI 0 fel Ferreir d Silv rfsilv@isi.edu Slides dpted from: Mrk edekopp nd Dvid Kempe LOG STUCTUED MEGE TEES Series Summtion eview Let n = + + + + k $ = #%& #. Wht is n? n = k+ - Wht is log () + log ()

More information

Lexical Analysis. Amitabha Sanyal. (www.cse.iitb.ac.in/ as) Department of Computer Science and Engineering, Indian Institute of Technology, Bombay

Lexical Analysis. Amitabha Sanyal. (www.cse.iitb.ac.in/ as) Department of Computer Science and Engineering, Indian Institute of Technology, Bombay Lexicl Anlysis Amith Snyl (www.cse.iit.c.in/ s) Deprtment of Computer Science nd Engineering, Indin Institute of Technology, Bomy Septemer 27 College of Engineering, Pune Lexicl Anlysis: 2/6 Recp The input

More information

Dynamic Programming. Andreas Klappenecker. [partially based on slides by Prof. Welch] Monday, September 24, 2012

Dynamic Programming. Andreas Klappenecker. [partially based on slides by Prof. Welch] Monday, September 24, 2012 Dynmic Progrmming Andres Klppenecker [prtilly bsed on slides by Prof. Welch] 1 Dynmic Progrmming Optiml substructure An optiml solution to the problem contins within it optiml solutions to subproblems.

More information

Rational Numbers---Adding Fractions With Like Denominators.

Rational Numbers---Adding Fractions With Like Denominators. Rtionl Numbers---Adding Frctions With Like Denomintors. A. In Words: To dd frctions with like denomintors, dd the numertors nd write the sum over the sme denomintor. B. In Symbols: For frctions c nd b

More information

MATH 25 CLASS 5 NOTES, SEP

MATH 25 CLASS 5 NOTES, SEP MATH 25 CLASS 5 NOTES, SEP 30 2011 Contents 1. A brief diversion: reltively prime numbers 1 2. Lest common multiples 3 3. Finding ll solutions to x + by = c 4 Quick links to definitions/theorems Euclid

More information

Announcements. CS 188: Artificial Intelligence Fall Recap: Search. Today. Example: Pancake Problem. Example: Pancake Problem

Announcements. CS 188: Artificial Intelligence Fall Recap: Search. Today. Example: Pancake Problem. Example: Pancake Problem Announcements Project : erch It s live! Due 9/. trt erly nd sk questions. It s longer thn most! Need prtner? Come up fter clss or try Pizz ections: cn go to ny, ut hve priority in your own C 88: Artificil

More information

Transparent neutral-element elimination in MPI reduction operations

Transparent neutral-element elimination in MPI reduction operations Trnsprent neutrl-element elimintion in MPI reduction opertions Jesper Lrsson Träff Deprtment of Scientific Computing University of Vienn Disclimer Exploiting repetition nd sprsity in input for reducing

More information

CSCI 3130: Formal Languages and Automata Theory Lecture 12 The Chinese University of Hong Kong, Fall 2011

CSCI 3130: Formal Languages and Automata Theory Lecture 12 The Chinese University of Hong Kong, Fall 2011 CSCI 3130: Forml Lnguges nd utomt Theory Lecture 12 The Chinese University of Hong Kong, Fll 2011 ndrej Bogdnov In progrmming lnguges, uilding prse trees is significnt tsk ecuse prse trees tell us the

More information

CS321 Languages and Compiler Design I. Winter 2012 Lecture 5

CS321 Languages and Compiler Design I. Winter 2012 Lecture 5 CS321 Lnguges nd Compiler Design I Winter 2012 Lecture 5 1 FINITE AUTOMATA A non-deterministic finite utomton (NFA) consists of: An input lphet Σ, e.g. Σ =,. A set of sttes S, e.g. S = {1, 3, 5, 7, 11,

More information

cisc1110 fall 2010 lecture VI.2 call by value function parameters another call by value example:

cisc1110 fall 2010 lecture VI.2 call by value function parameters another call by value example: cisc1110 fll 2010 lecture VI.2 cll y vlue function prmeters more on functions more on cll y vlue nd cll y reference pssing strings to functions returning strings from functions vrile scope glol vriles

More information

this grammar generates the following language: Because this symbol will also be used in a later step, it receives the

this grammar generates the following language: Because this symbol will also be used in a later step, it receives the LR() nlysis Drwcks of LR(). Look-hed symols s eplined efore, concerning LR(), it is possile to consult the net set to determine, in the reduction sttes, for which symols it would e possile to perform reductions.

More information

An Algorithm for Enumerating All Maximal Tree Patterns Without Duplication Using Succinct Data Structure

An Algorithm for Enumerating All Maximal Tree Patterns Without Duplication Using Succinct Data Structure , Mrch 12-14, 2014, Hong Kong An Algorithm for Enumerting All Mximl Tree Ptterns Without Dupliction Using Succinct Dt Structure Yuko ITOKAWA, Tomoyuki UCHIDA nd Motoki SANO Astrct In order to extrct structured

More information

Mobile IP route optimization method for a carrier-scale IP network

Mobile IP route optimization method for a carrier-scale IP network Moile IP route optimiztion method for crrier-scle IP network Tkeshi Ihr, Hiroyuki Ohnishi, nd Ysushi Tkgi NTT Network Service Systems Lortories 3-9-11 Midori-cho, Musshino-shi, Tokyo 180-8585, Jpn Phone:

More information

Today. Search Problems. Uninformed Search Methods. Depth-First Search Breadth-First Search Uniform-Cost Search

Today. Search Problems. Uninformed Search Methods. Depth-First Search Breadth-First Search Uniform-Cost Search Uninformed Serch [These slides were creted by Dn Klein nd Pieter Abbeel for CS188 Intro to AI t UC Berkeley. All CS188 mterils re vilble t http://i.berkeley.edu.] Tody Serch Problems Uninformed Serch Methods

More information

From Indexing Data Structures to de Bruijn Graphs

From Indexing Data Structures to de Bruijn Graphs From Indexing Dt Structures to de Bruijn Grphs Bstien Czux, Thierry Lecroq, Eric Rivls LIRMM & IBC, Montpellier - LITIS Rouen June 1, 201 Czux, Lecroq, Rivls (LIRMM) Generlized Suffix Tree & DBG June 1,

More information

AI Adjacent Fields. This slide deck courtesy of Dan Klein at UC Berkeley

AI Adjacent Fields. This slide deck courtesy of Dan Klein at UC Berkeley AI Adjcent Fields Philosophy: Logic, methods of resoning Mind s physicl system Foundtions of lerning, lnguge, rtionlity Mthemtics Forml representtion nd proof Algorithms, computtion, (un)decidility, (in)trctility

More information

Position Heaps: A Simple and Dynamic Text Indexing Data Structure

Position Heaps: A Simple and Dynamic Text Indexing Data Structure Position Heps: A Simple nd Dynmic Text Indexing Dt Structure Andrzej Ehrenfeucht, Ross M. McConnell, Niss Osheim, Sung-Whn Woo Dept. of Computer Science, 40 UCB, University of Colordo t Boulder, Boulder,

More information

Regular Expression Matching with Multi-Strings and Intervals. Philip Bille Mikkel Thorup

Regular Expression Matching with Multi-Strings and Intervals. Philip Bille Mikkel Thorup Regulr Expression Mtching with Multi-Strings nd Intervls Philip Bille Mikkel Thorup Outline Definition Applictions Previous work Two new problems: Multi-strings nd chrcter clss intervls Algorithms Thompson

More information

CSc 453. Compilers and Systems Software. 4 : Lexical Analysis II. Department of Computer Science University of Arizona

CSc 453. Compilers and Systems Software. 4 : Lexical Analysis II. Department of Computer Science University of Arizona CSc 453 Compilers nd Systems Softwre 4 : Lexicl Anlysis II Deprtment of Computer Science University of Arizon collerg@gmil.com Copyright c 2009 Christin Collerg Implementing Automt NFAs nd DFAs cn e hrd-coded

More information

LECT-10, S-1 FP2P08, Javed I.

LECT-10, S-1 FP2P08, Javed I. A Course on Foundtions of Peer-to-Peer Systems & Applictions LECT-10, S-1 CS /799 Foundtion of Peer-to-Peer Applictions & Systems Kent Stte University Dept. of Computer Science www.cs.kent.edu/~jved/clss-p2p08

More information

Dr. D.M. Akbar Hussain

Dr. D.M. Akbar Hussain Dr. D.M. Akr Hussin Lexicl Anlysis. Bsic Ide: Red the source code nd generte tokens, it is similr wht humns will do to red in; just tking on the input nd reking it down in pieces. Ech token is sequence

More information

Orthogonal line segment intersection

Orthogonal line segment intersection Computtionl Geometry [csci 3250] Line segment intersection The prolem (wht) Computtionl Geometry [csci 3250] Orthogonl line segment intersection Applictions (why) Algorithms (how) A specil cse: Orthogonl

More information

arxiv: v2 [cs.dm] 17 May 2014

arxiv: v2 [cs.dm] 17 May 2014 EXTENDING ARTIAL RERESENTATIONS OF INTERVAL GRAHS. KLAVÍK, J. KRATOCHVÍL, Y. OTACHI, T. SAITOH, AND T. VYSKOČIL rxiv:1306.2182v2 [cs.dm] 17 My 2014 Astrct. Intervl grphs re intersection grphs of closed

More information

9.1 apply the distance and midpoint formulas

9.1 apply the distance and midpoint formulas 9.1 pply the distnce nd midpoint formuls DISTANCE FORMULA MIDPOINT FORMULA To find the midpoint between two points x, y nd x y 1 1,, we Exmple 1: Find the distnce between the two points. Then, find the

More information

Blackbaud s Mailwise Service Analyse Records Updated by MailWise

Blackbaud s Mailwise Service Analyse Records Updated by MailWise Blckud s Milwise Service Anlyse Records Updted y MilWise To nlyse the updtes tht hve een performed y the import, run the relevnt queries from the list elow. The queries selected depend on the MilWise Services

More information

CS 241. Fall 2017 Midterm Review Solutions. October 24, Bits and Bytes 1. 3 MIPS Assembler 6. 4 Regular Languages 7.

CS 241. Fall 2017 Midterm Review Solutions. October 24, Bits and Bytes 1. 3 MIPS Assembler 6. 4 Regular Languages 7. CS 241 Fll 2017 Midterm Review Solutions Octoer 24, 2017 Contents 1 Bits nd Bytes 1 2 MIPS Assemly Lnguge Progrmming 2 3 MIPS Assemler 6 4 Regulr Lnguges 7 5 Scnning 9 1 Bits nd Bytes 1. Give two s complement

More information

CSEP 573 Artificial Intelligence Winter 2016

CSEP 573 Artificial Intelligence Winter 2016 CSEP 573 Artificil Intelligence Winter 2016 Luke Zettlemoyer Problem Spces nd Serch slides from Dn Klein, Sturt Russell, Andrew Moore, Dn Weld, Pieter Abbeel, Ali Frhdi Outline Agents tht Pln Ahed Serch

More information

Typing with Weird Keyboards Notes

Typing with Weird Keyboards Notes Typing with Weird Keyords Notes Ykov Berchenko-Kogn August 25, 2012 Astrct Consider lnguge with n lphet consisting of just four letters,,,, nd. There is spelling rule tht sys tht whenever you see n next

More information

CSCE 531, Spring 2017, Midterm Exam Answer Key

CSCE 531, Spring 2017, Midterm Exam Answer Key CCE 531, pring 2017, Midterm Exm Answer Key 1. (15 points) Using the method descried in the ook or in clss, convert the following regulr expression into n equivlent (nondeterministic) finite utomton: (

More information

INTRODUCTION TO SIMPLICIAL COMPLEXES

INTRODUCTION TO SIMPLICIAL COMPLEXES INTRODUCTION TO SIMPLICIAL COMPLEXES CASEY KELLEHER AND ALESSANDRA PANTANO 0.1. Introduction. In this ctivity set we re going to introduce notion from Algebric Topology clled simplicil homology. The min

More information

Stack. A list whose end points are pointed by top and bottom

Stack. A list whose end points are pointed by top and bottom 4. Stck Stck A list whose end points re pointed by top nd bottom Insertion nd deletion tke plce t the top (cf: Wht is the difference between Stck nd Arry?) Bottom is constnt, but top grows nd shrinks!

More information

Simplifying Algebra. Simplifying Algebra. Curriculum Ready.

Simplifying Algebra. Simplifying Algebra. Curriculum Ready. Simplifying Alger Curriculum Redy www.mthletics.com This ooklet is ll out turning complex prolems into something simple. You will e le to do something like this! ( 9- # + 4 ' ) ' ( 9- + 7-) ' ' Give this

More information

Graphing Conic Sections

Graphing Conic Sections Grphing Conic Sections Definition of Circle Set of ll points in plne tht re n equl distnce, clled the rdius, from fixed point in tht plne, clled the center. Grphing Circle (x h) 2 + (y k) 2 = r 2 where

More information

Algorithm Design (5) Text Search

Algorithm Design (5) Text Search Algorithm Design (5) Text Serch Tkshi Chikym School of Engineering The University of Tokyo Text Serch Find sustring tht mtches the given key string in text dt of lrge mount Key string: chr x[m] Text Dt:

More information

Grade 7/8 Math Circles Geometric Arithmetic October 31, 2012

Grade 7/8 Math Circles Geometric Arithmetic October 31, 2012 Fculty of Mthemtics Wterloo, Ontrio N2L 3G1 Grde 7/8 Mth Circles Geometric Arithmetic Octoer 31, 2012 Centre for Eduction in Mthemtics nd Computing Ancient Greece hs given irth to some of the most importnt

More information

Definition of Regular Expression

Definition of Regular Expression Definition of Regulr Expression After the definition of the string nd lnguges, we re redy to descrie regulr expressions, the nottion we shll use to define the clss of lnguges known s regulr sets. Recll

More information

A Sparse Grid Representation for Dynamic Three-Dimensional Worlds

A Sparse Grid Representation for Dynamic Three-Dimensional Worlds A Sprse Grid Representtion for Dynmic Three-Dimensionl Worlds Nthn R. Sturtevnt Deprtment of Computer Science University of Denver Denver, CO, 80208 sturtevnt@cs.du.edu Astrct Grid representtions offer

More information

CSCI 446: Artificial Intelligence

CSCI 446: Artificial Intelligence CSCI 446: Artificil Intelligence Serch Instructor: Michele Vn Dyne [These slides were creted by Dn Klein nd Pieter Abbeel for CS188 Intro to AI t UC Berkeley. All CS188 mterils re vilble t http://i.berkeley.edu.]

More information

Phylogeny and Molecular Evolution

Phylogeny and Molecular Evolution Phylogeny nd Moleculr Evolution Chrcter Bsed Phylogeny 1/50 Credit Ron Shmir s lecture notes Notes by Nir Friedmn Dn Geiger, Shlomo Morn, Sgi Snir nd Ron Shmir Durbin et l. Jones nd Pevzner s presenttion

More information

SOME EXAMPLES OF SUBDIVISION OF SMALL CATEGORIES

SOME EXAMPLES OF SUBDIVISION OF SMALL CATEGORIES SOME EXAMPLES OF SUBDIVISION OF SMALL CATEGORIES MARCELLO DELGADO Abstrct. The purpose of this pper is to build up the bsic conceptul frmework nd underlying motivtions tht will llow us to understnd ctegoricl

More information

Determining Single Connectivity in Directed Graphs

Determining Single Connectivity in Directed Graphs Determining Single Connectivity in Directed Grphs Adm L. Buchsbum 1 Mrtin C. Crlisle 2 Reserch Report CS-TR-390-92 September 1992 Abstrct In this pper, we consider the problem of determining whether or

More information

Premaster Course Algorithms 1 Chapter 6: Shortest Paths. Christian Scheideler SS 2018

Premaster Course Algorithms 1 Chapter 6: Shortest Paths. Christian Scheideler SS 2018 Premster Course Algorithms Chpter 6: Shortest Pths Christin Scheieler SS 8 Bsic Grph Algorithms Overview: Shortest pths in DAGs Dijkstr s lgorithm Bellmn-For lgorithm Johnson s metho SS 8 Chpter 6 Shortest

More information

Implementing Automata. CSc 453. Compilers and Systems Software. 4 : Lexical Analysis II. Department of Computer Science University of Arizona

Implementing Automata. CSc 453. Compilers and Systems Software. 4 : Lexical Analysis II. Department of Computer Science University of Arizona Implementing utomt Sc 5 ompilers nd Systems Softwre : Lexicl nlysis II Deprtment of omputer Science University of rizon collerg@gmil.com opyright c 009 hristin ollerg NFs nd DFs cn e hrd-coded using this

More information

UNIT 11. Query Optimization

UNIT 11. Query Optimization UNIT Query Optimiztion Contents Introduction to Query Optimiztion 2 The Optimiztion Process: An Overview 3 Optimiztion in System R 4 Optimiztion in INGRES 5 Implementing the Join Opertors Wei-Png Yng,

More information

Alignment of Long Sequences. BMI/CS Spring 2012 Colin Dewey

Alignment of Long Sequences. BMI/CS Spring 2012 Colin Dewey Alignment of Long Sequences BMI/CS 776 www.biostt.wisc.edu/bmi776/ Spring 2012 Colin Dewey cdewey@biostt.wisc.edu Gols for Lecture the key concepts to understnd re the following how lrge-scle lignment

More information

ASTs, Regex, Parsing, and Pretty Printing

ASTs, Regex, Parsing, and Pretty Printing ASTs, Regex, Prsing, nd Pretty Printing CS 2112 Fll 2016 1 Algeric Expressions To strt, consider integer rithmetic. Suppose we hve the following 1. The lphet we will use is the digits {0, 1, 2, 3, 4, 5,

More information

Introduction to Integration

Introduction to Integration Introduction to Integrtion Definite integrls of piecewise constnt functions A constnt function is function of the form Integrtion is two things t the sme time: A form of summtion. The opposite of differentition.

More information

documents 1. Introduction

documents 1. Introduction www.ijcsi.org 4 Efficient structurl similrity computtion etween XML documents Ali Aïtelhdj Computer Science Deprtment, Fculty of Electricl Engineering nd Computer Science Mouloud Mmmeri University of Tizi-Ouzou

More information

Discussion 1 Recap. COP4600 Discussion 2 OS concepts, System call, and Assignment 1. Questions. Questions. Outline. Outline 10/24/2010

Discussion 1 Recap. COP4600 Discussion 2 OS concepts, System call, and Assignment 1. Questions. Questions. Outline. Outline 10/24/2010 COP4600 Discussion 2 OS concepts, System cll, nd Assignment 1 TA: Hufeng Jin hj0@cise.ufl.edu Discussion 1 Recp Introduction to C C Bsic Types (chr, int, long, flot, doule, ) C Preprocessors (#include,

More information

SIMPLIFYING ALGEBRA PASSPORT.

SIMPLIFYING ALGEBRA PASSPORT. SIMPLIFYING ALGEBRA PASSPORT www.mthletics.com.u This booklet is ll bout turning complex problems into something simple. You will be ble to do something like this! ( 9- # + 4 ' ) ' ( 9- + 7-) ' ' Give

More information

12-B FRACTIONS AND DECIMALS

12-B FRACTIONS AND DECIMALS -B Frctions nd Decimls. () If ll four integers were negtive, their product would be positive, nd so could not equl one of them. If ll four integers were positive, their product would be much greter thn

More information

OUTPUT DELIVERY SYSTEM

OUTPUT DELIVERY SYSTEM Differences in ODS formtting for HTML with Proc Print nd Proc Report Lur L. M. Thornton, USDA-ARS, Animl Improvement Progrms Lortory, Beltsville, MD ABSTRACT While Proc Print is terrific tool for dt checking

More information

Network Interconnection: Bridging CS 571 Fall Kenneth L. Calvert All rights reserved

Network Interconnection: Bridging CS 571 Fall Kenneth L. Calvert All rights reserved Network Interconnection: Bridging CS 57 Fll 6 6 Kenneth L. Clvert All rights reserved The Prolem We know how to uild (rodcst) LANs Wnt to connect severl LANs together to overcome scling limits Recll: speed

More information