Outline. Tiling, formally. Expression tile as rule. Statement tiles as rules. Function calls. CS 412 Introduction to Compilers
|
|
- Alban Edwards
- 5 years ago
- Views:
Transcription
1 CS 412 Introduction to Compilers Andrew Myers Cornell University Lectur8 Finishing genertion 9 Mr 01 Outline Tiling s syntx-directed trnsltion Implementing function clls Implementing functions Optimizing wy the pointer Dynmiclly-llocted structures strings nd rrys Register lloction the esy wy 2 Tiling, formlly Ech tile is relly n inference rule! Write e c (reg t) for c is vlid for IR expression e tht puts result into t Write s c for c is vlid for IR sttement s Trnsltion is not function of e/s mny possible trnsltions (unlike 6 e, 5 e, etc.) trnsltion reltion generlizes trnsltion function cn pply to erlier trnsltions too but less pyoff 3 Expression tile s rule t f ADD t 1 t 2 mov t f, t 1 dd t f, t 2 c 1 (reg t 1 ) e 2 c 2 (reg t 2 ) ADD(, e 2 ) c 1 ; c 2 ; mov t f, t 1 ; dd t f, t 2 (reg t f ) 4 Sttement tiles s rules c 1 (reg t 1 ) e 2 c 2 (reg t 2 ) (( ), e 2 ) c 1 ; c 2 ; mov [t 1 ], t 2 Function clls How to generte for function clls? Two kinds of IR sttements in cnonicl form t 1 t 2, e 2 op 1 (r/m32) + (, e 2 + CONST(k)) dd op 1, k CONST(k) r/m32 dest f EXP f Inference rules rot syntx-directed need heuristic or dynmic progrmming to choose 5 6 1
2 old Stck lyout current old current new dest f non-risc push push dd e, 4*n Two trnsltions RISC bp old ebp sub e, 4*n mov [e + 4],... mov [e + 4*n], dd e, 4*n 7 8? f Tiling cll push push dd e, 4*n Approch 1 don t fold e i into tile Downside genertes lot of extr temporries Approch 2 try to mtch e i ginst r/m32, tile e i seprtely if filure f push t n push t 1 dd e, 4*n Compiling function bodies How we compiled function body 5Z f () T = e [ = SEQ((RV, -Z e [), LABEL(epilogue)) 5Z f () = e [ = SEQ(EXP(-Z e [), LABEL(epilogue)) Vribles -Z v [ = TEMP(t v ) for -Z v [ = (TEMP(FP) + (4*i+4)) for rg. i -Z v [ = (NAME(v)) for globls Try it out f(x int, yint) = x + y 9 10 Abstrct ssembly for f f(x int, yint) = x + y RV FP 8 FP 12 Wht s missing here? 11 prev Stck setup Need to set up on entry prev. push ebp mov ebp,e sub e, 4*l mov e, ebp 12 new new prev prev. prev. new prev. new l 2
3 Function f push ebp mov ebp,e function prologue sub e, 4*l f_epilogue mov e, ebp function epilogue The Glory of CISC f push ebp mov ebp,e sub e, 4*l f_epilogue mov e, ebp enter 4*l, 0 f_epilogue leve Clling conventions Hve described stndrd C clling convention rguments pushed on, in reverse order cller clens up rguments stdcll cllee clens up. MIPS/Alph first 4/6 rguments pssed in registers Choice of cller- vs. cllee-sve cller-sve cller must sve registers if needed fter cll; usble freely (e[cd]x) cllee-sve function not llowed to chnge; to use, must be sved (e[sd]i, e[sb]p, ebx) 15 Optimizing wy ebp No need for pointer register! Ide mintin constnt offset k between pointer nd pointer Use RISC-style rgument pssing rther thn pushing rguments on All references to (FP+n) trnslted to opernd [e+(n+k)] insted of to [ebp+n] Advntge get whole extr register to use when llocting registers (7!) 16 prev. prev. prev Stck setup sub e, 4*l dd e, 4*l + 4*l prev prev. 17 prev new mx rg ce new (size 4*l) Cvets Get even fster (nd RISC-core) prologue nd epilogue thn with enter/leve but To void breking cllers, must sve ebp register if we wnt to use it (cllee-sve) Doesn t work if is truly vrible-sized lloc(n) cll in C lloctes n bytes on the compiler cnnot predict not problem in Iot rrys -llocted, hs constnt size 18 3
4 Dynmic structures Modern progrmming lnguges llow dynmiclly llocted dt structures strings, rrys, objects C chr *x = (chr *)mlloc(strlen(s) + 1); C++ Foo *f = new Foo(); Jv Foo f = new Foo(); String s = s1 + s2; Iot x rry[int] = new int[5] (0); String s = s1 + s2; 19 Progrm Hep Progrm hs 4 memory res segment, segment,, Two typicl virtul memory lyouts (depends on OS) 20 Object lloction Dynmic objects llocted in the rry cretion, string conctention mlloc(n) urns new chunk of n bytes, free(x) releses memory strting t x Globls stticlly llocted in dt segment globl vribles string constnts ssembler supports dt segment declrtions 21 rry[t] Iot dynmic structures.length elements of new T [n] ( e ) = mlloc(4*n + 4); () = n; = + 4; 1 = ; 2 = + 4*n; while ( 1!= 2 ) ( ( 1 ) = -Ze[; 1 = ); PA4 We give you newrry, newstring clls with grbge collection support (no free cll needed) 22 Trivil register lloction Cn convert bstrct ssembly to rel ssembly esily (but generte bd ) Allocte every temporry to loction in the current rther thn to register Every temporry stored in different plce - - no possibility of conflict Three registers needed to shuttle dt in nd out of (mx. # registers used by one instruction) e.g, ex, ecx, edx 23 Rewriting bstrct Given instruction, replce every temporry in instruction with one of three registers e[cd]x Add mov instructions before instruction to lod registers properly Add mov instructions fter instruction to put dt bck onto (if necessry) push t1 mov ex, [ - t1off]; push ex mov [+4], t3? dd t1, [ - 4]? 24 4
5 Result Simple wy to get working Code is longer thn necessry, slower Also cn llocte temporries to registers until registers run out (3 temporries on Pentium, 20+ on MIPS, Alph) Code genertion technique ctully used by some compilers when ll optimiztion turned off (-O0) Will use for Progrmming Assignment 4 Summry Complete genertion technique Use tiling to perform instruction selection Arguments mpped to loctions, to temporries Function generted by gluing prologue, epilogue onto body Dynmic structure lloction hndled by relying on lloction routines (mlloc) Sttic structures llocted by dt segment ssembler declrtions Allocte temporries to loctions to eliminte use of unbounded # of registers Shuttle temporries in nd out using e[cd]x regs Where we re High-level source Assembly 27 5
Outline CS 412/413. Function calls. Stack layout. Tiling a call. Two translations
CS 412/413 Introduction to Compilers nd Trnsltors Cornell University Andrew Myers Outline Implementing function clls Implementing functions Optimizing wy the pointer Dynmiclly-llocted structures strings
More informationCPSC 213. Polymorphism. Introduction to Computer Systems. Readings for Next Two Lectures. Back to Procedure Calls
Redings for Next Two Lectures Text CPSC 213 Switch Sttements, Understnding Pointers - 2nd ed: 3.6.7, 3.10-1st ed: 3.6.6, 3.11 Introduction to Computer Systems Unit 1f Dynmic Control Flow Polymorphism nd
More informationFrom Dependencies to Evaluation Strategies
From Dependencies to Evlution Strtegies Possile strtegies: 1 let the user define the evlution order 2 utomtic strtegy sed on the dependencies: use locl dependencies to determine which ttriutes to compute
More informationMIPS I/O and Interrupt
MIPS I/O nd Interrupt Review Floting point instructions re crried out on seprte chip clled coprocessor 1 You hve to move dt to/from coprocessor 1 to do most common opertions such s printing, clling functions,
More informationVirtual Machine (Part I)
Hrvrd University CS Fll 2, Shimon Schocken Virtul Mchine (Prt I) Elements of Computing Systems Virtul Mchine I (Ch. 7) Motivtion clss clss Min Min sttic sttic x; x; function function void void min() min()
More informationAllocator Basics. Dynamic Memory Allocation in the Heap (malloc and free) Allocator Goals: malloc/free. Internal Fragmentation
Alloctor Bsics Dynmic Memory Alloction in the Hep (mlloc nd free) Pges too corse-grined for llocting individul objects. Insted: flexible-sized, word-ligned blocks. Allocted block (4 words) Free block (3
More informationAgenda & Reading. Class Exercise. COMPSCI 105 SS 2012 Principles of Computer Science. Arrays
COMPSCI 5 SS Principles of Computer Science Arrys & Multidimensionl Arrys Agend & Reding Agend Arrys Creting & Using Primitive & Reference Types Assignments & Equlity Pss y Vlue & Pss y Reference Copying
More informationSome Thoughts on Grad School. Undergraduate Compilers Review and Intro to MJC. Structure of a Typical Compiler. Lexing and Parsing
Undergrdute Compilers Review nd Intro to MJC Announcements Miling list is in full swing Tody Some thoughts on grd school Finish prsing Semntic nlysis Visitor pttern for bstrct syntx trees Some Thoughts
More informationCS 241. Fall 2017 Midterm Review Solutions. October 24, Bits and Bytes 1. 3 MIPS Assembler 6. 4 Regular Languages 7.
CS 241 Fll 2017 Midterm Review Solutions Octoer 24, 2017 Contents 1 Bits nd Bytes 1 2 MIPS Assemly Lnguge Progrmming 2 3 MIPS Assemler 6 4 Regulr Lnguges 7 5 Scnning 9 1 Bits nd Bytes 1. Give two s complement
More informationCS 430 Spring Mike Lam, Professor. Parsing
CS 430 Spring 2015 Mike Lm, Professor Prsing Syntx Anlysis We cn now formlly descrie lnguge's syntx Using regulr expressions nd BNF grmmrs How does tht help us? Syntx Anlysis We cn now formlly descrie
More informationSample Midterm Solutions COMS W4115 Programming Languages and Translators Monday, October 12, 2009
Deprtment of Computer cience Columbi University mple Midterm olutions COM W4115 Progrmming Lnguges nd Trnsltors Mondy, October 12, 2009 Closed book, no ids. ch question is worth 20 points. Question 5(c)
More informationCS201 Discussion 10 DRAWTREE + TRIES
CS201 Discussion 10 DRAWTREE + TRIES DrwTree First instinct: recursion As very generic structure, we could tckle this problem s follows: drw(): Find the root drw(root) drw(root): Write the line for the
More informationVirtual Machine I: Stack Arithmetic
Virtul Mchine I: Stck Arithmetic Building Modern Computer From First Principles www.nnd2tetris.org Elements of Computing Systems, Nisn & Schocken, MIT Press, www.nnd2tetris.org, Chpter 7: Virtul Mchine
More informationMemory Management Functions
Meory Mngeent Functions Chpter 9 Meory Mngeent Process of binding vlues to eory loctions Vlues y be sttic or dynic Vlues re ssigned t different plces Sttic eory Run-tie stck Hep 1 Meory Mngeent Sttic Meory
More informationcisc1110 fall 2010 lecture VI.2 call by value function parameters another call by value example:
cisc1110 fll 2010 lecture VI.2 cll y vlue function prmeters more on functions more on cll y vlue nd cll y reference pssing strings to functions returning strings from functions vrile scope glol vriles
More informationWhere we are. Instruction selection. Abstract Assembly. CS 4120 Introduction to Compilers
Where we are CS 420 Introduction to Compilers Andrew Myers Cornell University Lecture 8: Instruction Selection 5 Oct 20 Intermediate code Canonical intermediate code Abstract assembly code Assembly code
More informationData Flow on a Queue Machine. Bruno R. Preiss. Copyright (c) 1987 by Bruno R. Preiss, P.Eng. All rights reserved.
Dt Flow on Queue Mchine Bruno R. Preiss 2 Outline Genesis of dt-flow rchitectures Sttic vs. dynmic dt-flow rchitectures Pseudo-sttic dt-flow execution model Some dt-flow mchines Simple queue mchine Prioritized
More informationStack. A list whose end points are pointed by top and bottom
4. Stck Stck A list whose end points re pointed by top nd bottom Insertion nd deletion tke plce t the top (cf: Wht is the difference between Stck nd Arry?) Bottom is constnt, but top grows nd shrinks!
More informationFig.25: the Role of LEX
The Lnguge for Specifying Lexicl Anlyzer We shll now study how to uild lexicl nlyzer from specifiction of tokens in the form of list of regulr expressions The discussion centers round the design of n existing
More information520 Principles of Programming Languages. Memory Management. Memory Management... 35: Garbage Collection
Dynmic Memory Mngement 50 Principles of Progrmming Lnguges 35: Grbge Collection Christin Collberg collberg@cs.rizon.edu Deprtment of Computer Science University of Arizon The run-time system linked in
More informationUnit #9 : Definite Integral Properties, Fundamental Theorem of Calculus
Unit #9 : Definite Integrl Properties, Fundmentl Theorem of Clculus Gols: Identify properties of definite integrls Define odd nd even functions, nd reltionship to integrl vlues Introduce the Fundmentl
More informationGeometric transformations
Geometric trnsformtions Computer Grphics Some slides re bsed on Shy Shlom slides from TAU mn n n m m T A,,,,,, 2 1 2 22 12 1 21 11 Rows become columns nd columns become rows nm n n m m A,,,,,, 1 1 2 22
More informationLanguages. L((a (b)(c))*) = { ε,a,bc,aa,abc,bca,... } εw = wε = w. εabba = abbaε = abba. (a (b)(c)) *
Pln for Tody nd Beginning Next week Interpreter nd Compiler Structure, or Softwre Architecture Overview of Progrmming Assignments The MeggyJv compiler we will e uilding. Regulr Expressions Finite Stte
More informationMidterm 2 Sample solution
Nme: Instructions Midterm 2 Smple solution CMSC 430 Introduction to Compilers Fll 2012 November 28, 2012 This exm contins 9 pges, including this one. Mke sure you hve ll the pges. Write your nme on the
More informationDiscussion 1 Recap. COP4600 Discussion 2 OS concepts, System call, and Assignment 1. Questions. Questions. Outline. Outline 10/24/2010
COP4600 Discussion 2 OS concepts, System cll, nd Assignment 1 TA: Hufeng Jin hj0@cise.ufl.edu Discussion 1 Recp Introduction to C C Bsic Types (chr, int, long, flot, doule, ) C Preprocessors (#include,
More informationECE 468/573 Midterm 1 September 28, 2012
ECE 468/573 Midterm 1 September 28, 2012 Nme:! Purdue emil:! Plese sign the following: I ffirm tht the nswers given on this test re mine nd mine lone. I did not receive help from ny person or mteril (other
More informationPage 1. Memory Allocation and Usage CSE 361S. Different free lists for different size classes
Keeping Trck o Free Blocks Method 1: : Implicit list using lengths -- links ll blocks Memory Alloction nd Usge Method : : Explicit list mong the ree blocks using pointers within the ree blocks CSE 361S
More informationCreating Flexible Interfaces. Friday, 24 April 2015
Creting Flexible Interfces 1 Requests, not Objects Domin objects re esy to find but they re not t the design center of your ppliction. Insted, they re trp for the unwry. Sequence digrms re vehicle for
More informationIn the last lecture, we discussed how valid tokens may be specified by regular expressions.
LECTURE 5 Scnning SYNTAX ANALYSIS We know from our previous lectures tht the process of verifying the syntx of the progrm is performed in two stges: Scnning: Identifying nd verifying tokens in progrm.
More informationPointers and Arrays. More Pointer Examples. Pointers CS 217
Pointers nd Arrs CS 21 1 2 Pointers More Pointer Emples Wht is pointer A vrile whose vlue is the ddress of nother vrile p is pointer to vrile v Opertions &: ddress of (reference) *: indirection (dereference)
More information10/12/17. Motivating Example. Lexical and Syntax Analysis (2) Recursive-Descent Parsing. Recursive-Descent Parsing. Recursive-Descent Parsing
Motivting Exmple Lexicl nd yntx Anlysis (2) In Text: Chpter 4 Consider the grmmr -> cad A -> b Input string: w = cd How to build prse tree top-down? 2 Initilly crete tree contining single node (the strt
More informationLists in Lisp and Scheme
Lists in Lisp nd Scheme Lists in Lisp nd Scheme Lists re Lisp s fundmentl dt structures, ut there re others Arrys, chrcters, strings, etc. Common Lisp hs moved on from eing merely LISt Processor However,
More informationMid-term exam. Scores. Fall term 2012 KAIST EE209 Programming Structures for EE. Thursday Oct 25, Student's name: Student ID:
Fll term 2012 KAIST EE209 Progrmming Structures for EE Mid-term exm Thursdy Oct 25, 2012 Student's nme: Student ID: The exm is closed book nd notes. Red the questions crefully nd focus your nswers on wht
More informationSymbol Table management
TDDD Compilers nd interpreters TDDB44 Compiler Construction Symol Tles Symol Tles in the Compiler Symol Tle mngement source progrm Leicl nlysis Syntctic nlysis Semntic nlysis nd Intermedite code gen Code
More informationReference types and their characteristics Class Definition Constructors and Object Creation Special objects: Strings and Arrays
Objects nd Clsses Reference types nd their chrcteristics Clss Definition Constructors nd Object Cretion Specil objects: Strings nd Arrys OOAD 1999/2000 Cludi Niederée, Jochim W. Schmidt Softwre Systems
More informationFunctor (1A) Young Won Lim 10/5/17
Copyright (c) 2016-2017 Young W. Lim. Permission is grnted to copy, distribute nd/or modify this document under the terms of the GNU Free Documenttion License, Version 1.2 or ny lter version published
More informationScanner Termination. Multi Character Lookahead. to its physical end. Most parsers require an end of file token. Lex and Jlex automatically create an
Scnner Termintion A scnner reds input chrcters nd prtitions them into tokens. Wht hppens when the end of the input file is reched? It my be useful to crete n Eof pseudo-chrcter when this occurs. In Jv,
More informationFunctor (1A) Young Won Lim 8/2/17
Copyright (c) 2016-2017 Young W. Lim. Permission is grnted to copy, distribute nd/or modify this document under the terms of the GNU Free Documenttion License, Version 1.2 or ny lter version published
More informationCOMBINATORIAL PATTERN MATCHING
COMBINATORIAL PATTERN MATCHING Genomic Repets Exmple of repets: ATGGTCTAGGTCCTAGTGGTC Motivtion to find them: Genomic rerrngements re often ssocited with repets Trce evolutionry secrets Mny tumors re chrcterized
More informationStack Manipulation. Other Issues. How about larger constants? Frame Pointer. PowerPC. Alternative Architectures
Other Issues Stck Mnipultion support for procedures (Refer to section 3.6), stcks, frmes, recursion mnipulting strings nd pointers linkers, loders, memory lyout Interrupts, exceptions, system clls nd conventions
More informationReadings : Computer Networking. Outline. The Next Internet: More of the Same? Required: Relevant earlier meeting:
Redings 15-744: Computer Networking L-14 Future Internet Architecture Required: Servl pper Extr reding on Mobility First Relevnt erlier meeting: CCN -> Nmed Dt Network 2 Outline The Next Internet: More
More informationOutlines. Dynamic Memory Dynamic Memory Dynamic Memory The malloc Package. malloc Example
Outlines Dynmic Memory Alloc@on CSCI 01: Mchine Architecture nd Orgniz@on Bsic concepts Implicit free lists Explicit free lists Pen- Chung Yew Deprtment Computer Science nd Engineering University of Minnesot
More informationSmall Business Networking
Why network is n essentil productivity tool for ny smll business Effective technology is essentil for smll businesses looking to increse the productivity of their people nd processes. Introducing technology
More informationCS412/CS413. Introduction to Compilers Tim Teitelbaum. Lecture 21: Generating Pentium Code 10 March 08
CS412/CS413 Introduction to Compilers Tim Teitelbaum Lecture 21: Generating Pentium Code 10 March 08 CS 412/413 Spring 2008 Introduction to Compilers 1 Simple Code Generation Three-address code makes it
More informationCOMP 423 lecture 11 Jan. 28, 2008
COMP 423 lecture 11 Jn. 28, 2008 Up to now, we hve looked t how some symols in n lphet occur more frequently thn others nd how we cn sve its y using code such tht the codewords for more frequently occuring
More information! Smaller, simpler, subcomponent of program! Provides abstraction. n hide low-level details, give high-level structure
Function Chpte 1 Functions Oiginl slides fom Gegoy Byd, Noth Colin Stte Univesity Modified slides by Chis Wilcox, Colodo Stte Univesity! Smlle, simple, subcomponent of pogm! Povides bstction n hide lo-level
More informationIntroduction to Computer Science, Shimon Schocken, IDC Herzliya. Lecture Writing Classes
Introduction to Computer Science, Shimon Schocken, IDC Herzliy Lecture 5.1-5.2 Writing Clsses Writing Clsses, Shimon Schocken IDC Herzliy, www.ro2cs.com slide 1 Clsses Two viewpos on es: Client view: how
More informationSmall Business Networking
Why network is n essentil productivity tool for ny smll business Effective technology is essentil for smll businesses looking to increse the productivity of their people nd business. Introducing technology
More informationVariables vs. Registers/Memory. Simple Approach. Register Allocation. Interference Graph. Register Allocation Algorithm CS412/CS413
Variables vs. Registers/Memory CS412/CS413 Introduction to Compilers Tim Teitelbaum Lecture 33: Register Allocation 18 Apr 07 Difference between IR and assembly code: IR (and abstract assembly) manipulate
More informationData sharing in OpenMP
Dt shring in OpenMP Polo Burgio polo.burgio@unimore.it Outline Expressing prllelism Understnding prllel threds Memory Dt mngement Dt cluses Synchroniztion Brriers, locks, criticl sections Work prtitioning
More informationLecture 7: Building 3D Models (Part 1) Prof Emmanuel Agu. Computer Science Dept. Worcester Polytechnic Institute (WPI)
Computer Grphics (CS 4731) Lecture 7: Building 3D Models (Prt 1) Prof Emmnuel Agu Computer Science Dept. Worcester Polytechnic Institute (WPI) Stndrd d Unit itvectors Define y i j 1,0,0 0,1,0 k i k 0,0,1
More informationProcess Layout and Function Calls
Process Layout and Function Calls CS 6 Spring 07 / 8 Process Layout in Memory Stack grows towards decreasing addresses. is initialized at run-time. Heap grow towards increasing addresses. is initialized
More informationControl-Flow Analysis and Loop Detection
! Control-Flow Anlysis nd Loop Detection!Lst time! PRE!Tody! Control-flow nlysis! Loops! Identifying loops using domintors! Reducibility! Using loop identifiction to identify induction vribles CS553 Lecture
More informationSmall Business Networking
Why network is n essentil productivity tool for ny smll business Effective technology is essentil for smll businesses looking to increse the productivity of their people nd processes. Introducing technology
More informationCSc 453. Compilers and Systems Software. 4 : Lexical Analysis II. Department of Computer Science University of Arizona
CSc 453 Compilers nd Systems Softwre 4 : Lexicl Anlysis II Deprtment of Computer Science University of Arizon collerg@gmil.com Copyright c 2009 Christin Collerg Implementing Automt NFAs nd DFAs cn e hrd-coded
More informationbox Boxes and Arrows 3 true 7.59 'X' An object is drawn as a box that contains its data members, for example:
Boxes nd Arrows There re two kinds of vriles in Jv: those tht store primitive vlues nd those tht store references. Primitive vlues re vlues of type long, int, short, chr, yte, oolen, doule, nd flot. References
More informationLING/C SC/PSYC 438/538. Lecture 21 Sandiway Fong
LING/C SC/PSYC 438/538 Lecture 21 Sndiwy Fong Tody's Topics Homework 8 Review Optionl Homework 9 (mke up on Homework 7) Homework 8 Review Question1: write Prolog regulr grmmr for the following lnguge:
More informationUNIT 11. Query Optimization
UNIT Query Optimiztion Contents Introduction to Query Optimiztion 2 The Optimiztion Process: An Overview 3 Optimiztion in System R 4 Optimiztion in INGRES 5 Implementing the Join Opertors Wei-Png Yng,
More informationCS481: Bioinformatics Algorithms
CS481: Bioinformtics Algorithms Cn Alkn EA509 clkn@cs.ilkent.edu.tr http://www.cs.ilkent.edu.tr/~clkn/teching/cs481/ EXACT STRING MATCHING Fingerprint ide Assume: We cn compute fingerprint f(p) of P in
More informationW4118: PC Hardware and x86. Junfeng Yang
W4118: PC Hardware and x86 Junfeng Yang A PC How to make it do something useful? 2 Outline PC organization x86 instruction set gcc calling conventions PC emulation 3 PC board 4 PC organization One or more
More informationShould be done. Do Soon. Structure of a Typical Compiler. Plan for Today. Lab hours and Office hours. Quiz 1 is due tonight, was posted Tuesday night
Should e done L hours nd Office hours Sign up for the miling list t, strting to send importnt info to list http://groups.google.com/group/cs453-spring-2011 Red Ch 1 nd skim Ch 2 through 2.6, red 3.3 nd
More informationMATH 2530: WORKSHEET 7. x 2 y dz dy dx =
MATH 253: WORKSHT 7 () Wrm-up: () Review: polr coordintes, integrls involving polr coordintes, triple Riemnn sums, triple integrls, the pplictions of triple integrls (especilly to volume), nd cylindricl
More informationSmall Business Networking
Why network is n essentil productivity tool for ny smll business Effective technology is essentil for smll businesses looking to increse the productivity of their people nd business. Introducing technology
More informationSolution of Linear Algebraic Equations using the Gauss-Jordan Method
Solution of Liner Algebric Equtions using the Guss-Jordn Method Populr pproch for solving liner equtions The Guss Jordn method depends on two properties of liner equtions: Scling one or more of ny of the
More informationPresentation Martin Randers
Presenttion Mrtin Rnders Outline Introduction Algorithms Implementtion nd experiments Memory consumption Summry Introduction Introduction Evolution of species cn e modelled in trees Trees consist of nodes
More informationQuiz2 45mins. Personal Number: Problem 1. (20pts) Here is an Table of Perl Regular Ex
Long Quiz2 45mins Nme: Personl Numer: Prolem. (20pts) Here is n Tle of Perl Regulr Ex Chrcter Description. single chrcter \s whitespce chrcter (spce, t, newline) \S non-whitespce chrcter \d digit (0-9)
More informationSmall Business Networking
Why network is n essentil productivity tool for ny smll business Effective technology is essentil for smll businesses looking to increse the productivity of their people nd business. Introducing technology
More informationSmall Business Networking
Why network is n essentil productivity tool for ny smll business Effective technology is essentil for smll businesses looking to increse the productivity of their people nd processes. Introducing technology
More informationScope, Functions, and Storage Management
Scope, Functions, nd Storge Mngement Block-structured lnguges nd stck storge In-le Blocks (previous set of overheds) ctivtion records storge for locl, glol vriles First-order functions (previous set of
More informationPage. Harsh Reality. Dynamic Memory Allocation. Malloc Package. Process Memory Image. Assumptions. Malloc Example
Hrsh Relity Memory Mtters Memory is not unbounded It must be llocted nd mnged 1 Mny lictions re memory dominted Esecilly those bsed on comlex, grh lgorithms Memory referencing bugs esecilly ernicious Effects
More informationSmall Business Networking
Why network is n essentil productivity tool for ny smll business Effective technology is essentil for smll businesses looking to increse the productivity of their people nd processes. Introducing technology
More informationCS 432 Fall Mike Lam, Professor a (bc)* Regular Expressions and Finite Automata
CS 432 Fll 2017 Mike Lm, Professor (c)* Regulr Expressions nd Finite Automt Compiltion Current focus "Bck end" Source code Tokens Syntx tree Mchine code chr dt[20]; int min() { flot x = 42.0; return 7;
More informationSection 10.4 Hyperbolas
66 Section 10.4 Hyperbols Objective : Definition of hyperbol & hyperbols centered t (0, 0). The third type of conic we will study is the hyperbol. It is defined in the sme mnner tht we defined the prbol
More informationArrays as functions. Types. Multidimensional Arrays (row major, column major form) Java arrays
Louden Chpters 6,9 Types Dt Types nd Abstrct Dt Types 1 Arrys s functons f: U -> V (f U s ordnl type) f() rry C rrys types cn be wthout szes rry vrbles must hve fxed sze rry_mx( [], sze) // prmeters re
More informationAssembly Language: Function Calls" Goals of this Lecture"
Assembly Language: Function Calls" 1 Goals of this Lecture" Help you learn:" Function call problems:" Calling and urning" Passing parameters" Storing local variables" Handling registers without interference"
More informationImplementing Automata. CSc 453. Compilers and Systems Software. 4 : Lexical Analysis II. Department of Computer Science University of Arizona
Implementing utomt Sc 5 ompilers nd Systems Softwre : Lexicl nlysis II Deprtment of omputer Science University of rizon collerg@gmil.com opyright c 009 hristin ollerg NFs nd DFs cn e hrd-coded using this
More informationTransparent neutral-element elimination in MPI reduction operations
Trnsprent neutrl-element elimintion in MPI reduction opertions Jesper Lrsson Träff Deprtment of Scientific Computing University of Vienn Disclimer Exploiting repetition nd sprsity in input for reducing
More informationCOMPUTER SCIENCE 123. Foundations of Computer Science. 6. Tuples
COMPUTER SCIENCE 123 Foundtions of Computer Science 6. Tuples Summry: This lecture introduces tuples in Hskell. Reference: Thompson Sections 5.1 2 R.L. While, 2000 3 Tuples Most dt comes with structure
More informationEngineer-to-Engineer Note
Engineer-to-Engineer Note EE-069 Technicl notes on using Anlog Devices DSPs, processors nd development tools Visit our Web resources http://www.nlog.com/ee-notes nd http://www.nlog.com/processors or e-mil
More informationWinter Compiler Construction T11 Activation records + Introduction to x86 assembly. Today. Tips for PA4. Today:
Winter 2006-2007 Compiler Construction T11 Activation records + Introduction to x86 assembly Mooly Sagiv and Roman Manevich School of Computer Science Tel-Aviv University Today ic IC Language Lexical Analysis
More informationKeeping Track of Free Blocks The course that gives CMU its Zip! Dynamic Memory Allocation II Nov 7, Allocating From Explicit Free Lists
Dynmic Memory Alloction II Nov 7, 2002 clss22.ppt 15-213 The course tht gives CMU its Zip! Topics Explicit doubly-linked ree lists Segregted ree lists Grbge collection Memory-relted perils nd pitlls Keeping
More informationEpson Projector Content Manager Operation Guide
Epson Projector Content Mnger Opertion Guide Contents 2 Introduction to the Epson Projector Content Mnger Softwre 3 Epson Projector Content Mnger Fetures... 4 Setting Up the Softwre for the First Time
More informationpdfapilot Server 2 Manual
pdfpilot Server 2 Mnul 2011 by clls softwre gmbh Schönhuser Allee 6/7 D 10119 Berlin Germny info@cllssoftwre.com www.cllssoftwre.com Mnul clls pdfpilot Server 2 Pge 2 clls pdfpilot Server 2 Mnul Lst modified:
More informationCaches I. CSE 351 Autumn 2018
Cches I CSE 351 Autumn 2018 Instructors: Mx Willsey Luis Ceze Teching Assistnts: Britt Henderson Luks Joswik Josie Lee Wei Lin Dniel Snitkovsky Luis Veg Kory Wtson Ivy Yu Alt text: I looked t some of the
More informationCMSC 331 First Midterm Exam
0 00/ 1 20/ 2 05/ 3 15/ 4 15/ 5 15/ 6 20/ 7 30/ 8 30/ 150/ 331 First Midterm Exm 7 October 2003 CMC 331 First Midterm Exm Nme: mple Answers tudent ID#: You will hve seventy-five (75) minutes to complete
More informationx86 assembly CS449 Spring 2016
x86 assembly CS449 Spring 2016 CISC vs. RISC CISC [Complex instruction set Computing] - larger, more feature-rich instruction set (more operations, addressing modes, etc.). slower clock speeds. fewer general
More informationReducing Costs with Duck Typing. Structural
Reducing Costs with Duck Typing Structurl 1 Duck Typing In computer progrmming with object-oriented progrmming lnguges, duck typing is lyer of progrmming lnguge nd design rules on top of typing. Typing
More informationCaches I. CSE 351 Autumn Instructor: Justin Hsia
L01: Intro, L01: L16: Combintionl Introduction Cches I Logic CSE369, CSE351, Autumn 2016 Cches I CSE 351 Autumn 2016 Instructor: Justin Hsi Teching Assistnts: Chris M Hunter Zhn John Kltenbch Kevin Bi
More informationLecture Outline. Code Generation. Lecture 30. Example of a Stack Machine Program. Stack Machines
Lecture Outline Code Generation Lecture 30 (based on slides by R. Bodik) Stack machines The MIPS assembly language The x86 assembly language A simple source language Stack-machine implementation of the
More informationInformation Retrieval and Organisation
Informtion Retrievl nd Orgnistion Suffix Trees dpted from http://www.mth.tu.c.il/~himk/seminr02/suffixtrees.ppt Dell Zhng Birkeck, University of London Trie A tree representing set of strings { } eef d
More information1 Quad-Edge Construction Operators
CS48: Computer Grphics Hndout # Geometric Modeling Originl Hndout #5 Stnford University Tuesdy, 8 December 99 Originl Lecture #5: 9 November 99 Topics: Mnipultions with Qud-Edge Dt Structures Scribe: Mike
More informationMA1008. Calculus and Linear Algebra for Engineers. Course Notes for Section B. Stephen Wills. Department of Mathematics. University College Cork
MA1008 Clculus nd Liner Algebr for Engineers Course Notes for Section B Stephen Wills Deprtment of Mthemtics University College Cork s.wills@ucc.ie http://euclid.ucc.ie/pges/stff/wills/teching/m1008/ma1008.html
More informationCS321 Languages and Compiler Design I. Winter 2012 Lecture 5
CS321 Lnguges nd Compiler Design I Winter 2012 Lecture 5 1 FINITE AUTOMATA A non-deterministic finite utomton (NFA) consists of: An input lphet Σ, e.g. Σ =,. A set of sttes S, e.g. S = {1, 3, 5, 7, 11,
More informationSmall Business Networking
Why network is n essentil productivity tool for ny smll business Effective technology is essentil for smll businesses looking to increse the productivity of their people nd business. Introducing technology
More informationSystems Architecture I
Systems Architecture I Topics Assemblers, Linkers, and Loaders * Alternative Instruction Sets ** *This lecture was derived from material in the text (sec. 3.8-3.9). **This lecture was derived from material
More informationCaches I. CSE 351 Spring Instructor: Ruth Anderson
L16: Cches I Cches I CSE 351 Spring 2017 Instructor: Ruth Anderson Teching Assistnts: Dyln Johnson Kevin Bi Linxing Preston Jing Cody Ohlsen Yufng Sun Joshu Curtis L16: Cches I Administrivi Homework 3,
More informationLexical Analysis. Amitabha Sanyal. (www.cse.iitb.ac.in/ as) Department of Computer Science and Engineering, Indian Institute of Technology, Bombay
Lexicl Anlysis Amith Snyl (www.cse.iit.c.in/ s) Deprtment of Computer Science nd Engineering, Indin Institute of Technology, Bomy Septemer 27 College of Engineering, Pune Lexicl Anlysis: 2/6 Recp The input
More informationCode Generation. Lecture 30
Code Generation Lecture 30 (based on slides by R. Bodik) 11/14/06 Prof. Hilfinger CS164 Lecture 30 1 Lecture Outline Stack machines The MIPS assembly language The x86 assembly language A simple source
More informationLecture Overview. Knowledge-based systems in Bioinformatics, 1MB602. Procedural abstraction. The sum procedure. Integration as a procedure
Lecture Overview Knowledge-bsed systems in Bioinformtics, MB6 Scheme lecture Procedurl bstrction Higher order procedures Procedures s rguments Procedures s returned vlues Locl vribles Dt bstrction Compound
More information10.5 Graphing Quadratic Functions
0.5 Grphing Qudrtic Functions Now tht we cn solve qudrtic equtions, we wnt to lern how to grph the function ssocited with the qudrtic eqution. We cll this the qudrtic function. Grphs of Qudrtic Functions
More information