Sequencing Data. Paul Agapow 2011/02/03
|
|
- Clarence Logan
- 5 years ago
- Views:
Transcription
1 Webservices for Next Generation Sequencing Data Paul Agapow 2011/02/03
2 Aims Assumed parameters: Must have a system for non-technical users to browse and manipulate their Next Generation Sequencing (NGS) data Should be free (realistic about budget) Should be extensible and open (customization & fixing bugs) Should have permissions (security, restrictions on viewing & editing) Should be a central shared system (probably web) Prefer something with an active community Prefer something written in a sane programing language with a sane API Prefer easy setup and little administration (less work)
3 Candidates GBrowse (GMOD NGS browsing & editing tool) jbrowse (port of GBrowse) Apollo (GMOD NGS project) GMOD Drupal (integrate GBrowse into Drupal) Lookseq (NGS tool from Sanger) Galaxy (bioinformatics workflow webtool incl. NGS)
4 What is GMOD? Generic Model Organism Database A set of software components for managing, visualizing & annotating genomic data (and some other stuff) "Common" database schema (Chado) A community at Not a LIMS system
5 GBrowse A genome viewer, allowing the viewing & manipulation of annotations Navigating Zooming Selecting tracks, data sources, displayed data Can add plugins for extra functionality (e.g. Blast, alignment, search). NGS tools to show quality & depth Demo at gbrowse/c_elegans/
6 GBrowse admin & use Free and open Installs via "standard Perl module build procedure" Connectivity to various databases (and schema) via adaptors, straight CGI Import NGS data from GFF, Samtools WebGBrowse for "no config" importing Security - none
7 GBrowse pros... Big, active community, active mailing lists, used by FlyBase, WormBase A lot of different programs, (almost) all use the same schema Generic Db schema, lots of adaptors Cool functionality Proven customizable and extensible
8 GBrowse cons Goddamn Perl A Perl attitude to functionality (scripts, config files, more scripts, more config files) A Perl attitude to errors (difficult to debug) No security builtin Did I mention Perl?
9 JBrowse A port of GBrowse, being even more AJAXy-ier: "Better" Processing NGS data can take a lot of memory Still based on Perl Demo at genomes/dmel/
10 Apollo Another GMOD tool: More downstream, more for genomic data browsing & editing Java app "Currently" looking at making it a part of JBrowse
11 GMOD Drupal "module for the Drupal CMS which simplifies programming bioinformatic Drupal modules" Implements subset of Chado Can make datasets private or public, select users for access Support for HPC (Condor) Users can upload FASTA files to act as query or database "Active"? (CSIRO supported) (Still using Perl underneath) More for blast and alignment than NGS
12 Lookseq "JavaScript-based viewer for DNA sequencing read alignments", "browsing and analysis of genome sequence data" technology agnostic emphasize browsing & zooming can see SNPs and depth and so on Visualize heterogenity Uses "basic SQL" Can directly uses SAM/BAM
13 Lookseq but... Extensible, but not actually extended? Documents & pages in some disarray (abandonware?) Frakking Perl
14 Galaxy "Genome analysis platform" Workflows (see next slide) A proper permission system: users, groups, datasets!, roles Python Download and run installation Part of GMOD?
15 Galaxy workflows Self-describing analyses and workflows History Non-destructive Can connect external datasources (and datatypes) Can function asynchronously Can use HPC Well-defined tool API
16
17 Galaxy tools To create a Galaxy tool: 1. Make a directory in ``galaxy/ tools`` 2. Make a configuration file 3. Add tool to Galaxy registry file 4. Restart Galaxy <tool id="fa_gc_content_1" name="compute GC content">! <description>for each sequence in a file</description>! <command interpreter="perl">toolexample.pl $input $output<! <inputs>!! <param format="fasta" name="input" type="data" label=! </inputs>! <outputs>!! <data format="tabular" name="output" />! </outputs>! <help>this tool computes GC content from a FASTA file.</he </tool> Can also add datatypes, data sources and visualizations
18 Galaxy for NGS "Tools" are wrappers around external, pre-existing software (dependency hell?) E.g. Bowtie, BWA, LASTZ, Megablast, SRMA, SAMtools Fastq as a lingua franca More of an integration and browsing tool than editing? Mainly reference mapping They sure do love them screencasts
19 Conclusions For usuability, if you can bear no access restrictions and using Perl: Lookseq or JBrowse. For extensibility, if a stepwise "tools" approach will do, and you can ask a little more of users: Galaxy. For rolling your own, if you have the time: use JBrowse code for UI.
NGS Data Visualization and Exploration Using IGV
1 What is Galaxy Galaxy for Bioinformaticians Galaxy for Experimental Biologists Using Galaxy for NGS Analysis NGS Data Visualization and Exploration Using IGV 2 What is Galaxy Galaxy for Bioinformaticians
More informationGenome Browser. Background & Strategy. Spring 2017 Faction II
Genome Browser Background & Strategy Spring 2017 Faction II Outline Beginning of the Last Phase Goals State of Art Applicable Genome Browsers Not So Genome Browsers Storing Data Strategy for the website
More informationWelcome to MAPHiTS (Mapping Analysis Pipeline for High-Throughput Sequences) tutorial page.
Welcome to MAPHiTS (Mapping Analysis Pipeline for High-Throughput Sequences) tutorial page. In this page you will learn to use the tools of the MAPHiTS suite. A little advice before starting : rename your
More informationUsing Galaxy to provide a NGS Analysis Platform
11/15/11 Using Galaxy to provide a NGS Analysis Platform Friedrich Miescher Institute - part of the Novartis Research Foundation - affiliated institute of Basel University - member of Swiss Institute of
More informationOur Task At Hand Aggregate data from every group
Where magical things happen Our Task At Hand Aggregate data from every group That s not too bad? Make it accessible to the public Just some basic HTML? Simple enough, right? Our Real Task Manage 1 million+
More informationChen lab workshop. Christian Frech
GBrowse Generic genome browser Chen lab workshop Christian Frech January 18, 2010 1 A generic genome browser why do we need it? Genome databases have similar requirements View DNA sequence and its associated
More informationJBrowse. To get started early: Double click VirtualBox on the desktop Click JBrowse 2016 Tutorial Click Start
JBrowse To get started early: Double click VirtualBox on the desktop Click JBrowse 2016 Tutorial Click Start JBrowse PAG 2015 Scott Cain GMOD Coordinator scott@scottcain.net What is GMOD? A set of interoperable
More informationGALAXY BIOINFORMATICS WORKFLOW ENVIRONMENT. Rutger Vos, 3 April 2012
GALAXY BIOINFORMATICS WORKFLOW ENVIRONMENT Rutger Vos, 3 April 2012 Overview Informatics in the post-genomic era The past (?) Analyses glued together using scripting languages, directly on the CLI or in
More informationGenome Browser Background and Strategy
Genome Browser Background and Strategy April 12th, 2017 BIOL 7210 - Faction I (Outbreak) - Genome Browser Group Adam Dabrowski Mrunal Dehankar Shareef Khalid Hubert Pan Ajay Ramakrishnan Ankit Srivastava
More informationGalaxy Platform For NGS Data Analyses
Galaxy Platform For NGS Data Analyses Weihong Yan wyan@chem.ucla.edu Collaboratory Web Site http://qcb.ucla.edu/collaboratory Collaboratory Workshops Workshop Outline ü Day 1 UCLA galaxy and user account
More informationHelpful Galaxy screencasts are available at:
This user guide serves as a simplified, graphic version of the CloudMap paper for applicationoriented end-users. For more details, please see the CloudMap paper. Video versions of these user guides and
More informationBackground and Strategy. Smitha, Adrian, Devin, Jeff, Ali, Sanjeev, Karthikeyan
Background and Strategy Smitha, Adrian, Devin, Jeff, Ali, Sanjeev, Karthikeyan What is a genome browser? A web/desktop based graphical tool for rapid and reliable display of any requested portion of the
More informationGalaxy workshop at the Winter School Igor Makunin
Galaxy workshop at the Winter School 2016 Igor Makunin i.makunin@uq.edu.au Winter school, UQ, July 6, 2016 Plan Overview of the Genomics Virtual Lab Introduce Galaxy, a web based platform for analysis
More informationGenome 373: Mapping Short Sequence Reads III. Doug Fowler
Genome 373: Mapping Short Sequence Reads III Doug Fowler What is Galaxy? Galaxy is a free, open source web platform for running all sorts of computational analyses including pretty much all of the sequencing-related
More informationNGS Analysis Using Galaxy
NGS Analysis Using Galaxy Sequences and Alignment Format Galaxy overview and Interface Get;ng Data in Galaxy Analyzing Data in Galaxy Quality Control Mapping Data History and workflow Galaxy Exercises
More informationCyverse tutorial 1 Logging in to Cyverse and data management. Open an Internet browser window and navigate to the Cyverse discovery environment:
Cyverse tutorial 1 Logging in to Cyverse and data management Open an Internet browser window and navigate to the Cyverse discovery environment: https://de.cyverse.org/de/ Click Log in with your CyVerse
More informationGenome Browser. Shruti Bhide Abhiram Das Khanjan Gandhi Viswateja Nelakuditi
Genome Browser Shruti Bhide Abhiram Das Khanjan Gandhi Viswateja Nelakuditi Present Scenario Need of Databases and Genome Browser Present Scenario Need of Databases and Genome Browser Put all the ingredients
More informationGalaxy. Daniel Blankenberg The Galaxy Team
Galaxy Daniel Blankenberg The Galaxy Team http://galaxyproject.org Overview What is Galaxy? What you can do in Galaxy analysis interface, tools and datasources data libraries workflows visualization sharing
More informationAnalyzing massive genomics datasets using Databricks Frank Austin Nothaft,
Analyzing massive genomics datasets using Databricks Frank Austin Nothaft, PhD frank.nothaft@databricks.com @fnothaft VISION Accelerate innovation by unifying data science, engineering and business PRODUCT
More informationGenome Browser. Background and Strategy
Genome Browser Background and Strategy Contents What is a genome browser? Purpose of a genome browser Examples Structure Extra Features Contents What is a genome browser? Purpose of a genome browser Examples
More informationUsing Galaxy to provide a NGS Analysis Platform GTC s NGS & Bioinformatics Summit Europe October 7-8, 2013 in Berlin, Germany.
Using Galaxy to provide a NGS Analysis Platform GTC s NGS & Bioinformatics Summit Europe October 7-8, 2013 in Berlin, Germany. (public version) Hans-Rudolf Hotz ( hrh@fmi.ch ) Friedrich Miescher Institute
More informationCross-Platform Parallels: Understanding SharePoint (Online) Through Notes-colored glasses
Cross-Platform Parallels: Understanding SharePoint (Online) Through Notes-colored glasses Presented by Ben Menesi Speaker Head of Product at Ytria IBM Notes Domino Admin & Dev. for the past 10 years Actually
More informationBioinformatics Services for HT Sequencing
Bioinformatics Services for HT Sequencing Tyler Backman, Rebecca Sun, Thomas Girke December 19, 2008 Bioinformatics Services for HT Sequencing Slide 1/18 Introduction People Service Overview and Rates
More information6.x-v0.2 Users Guide January 22, 2010
6.x-v0.2 Users Guide January 22, 2010 2009 Clemson University Genomics Institute TABLE OF CONTENTS License & Terms of Use... 3 1 INTRODUCTION... 4 1.1 WHY Use Tripal... 4 1.2 AUDIENCE... 4 1.3 DEPENDENCIES...
More informationUsing Pipeline Output Data for Whole Genome Alignment
Using Pipeline Output Data for Whole Genome Alignment FOR RESEARCH ONLY Topics 4 Introduction 4 Pipeline 4 Maq 4 GBrowse 4 Hardware Requirements 5 Workflow 6 Preparing to Run Maq 6 UNIX/Linux Environment
More informationLearn Well Technocraft
Getting Started with ASP.NET This module explains how to build and configure a simple ASP.NET application. Introduction to ASP.NET Web Applications Features of ASP.NET Configuring ASP.NET Applications
More informationAdvanced genome browsers: Integrated Genome Browser and others Heiko Muller Computational Research
Genomic Computing, DEIB, 4-7 March 2013 Advanced genome browsers: Integrated Genome Browser and others Heiko Muller Computational Research IIT@SEMM heiko.muller@iit.it List of Genome Browsers Alamut Annmap
More informationThe Galaxy Track Browser: Transforming the Genome Browser from Visualization Tool to Analysis Tool
The Galaxy Track Browser: Transforming the Genome Browser from Visualization Tool to Analysis Tool Jeremy Goecks * Kanwei Li Ω Dave Clements ℵ The Galaxy Team James Taylor ℇ Emory University Emory University
More informationToday's outline. Resources. Genome browser components. Genome browsers: Discovering biology through genomics. Genome browser tutorial materials
Today's outline Genome browsers: Discovering biology through genomics BaRC Hot Topics April 2013 George Bell, Ph.D. http://jura.wi.mit.edu/bio/education/hot_topics/ Genome browser introduction Popular
More informationMapping NGS reads for genomics studies
Mapping NGS reads for genomics studies Valencia, 28-30 Sep 2015 BIER Alejandro Alemán aaleman@cipf.es Genomics Data Analysis CIBERER Where are we? Fastq Sequence preprocessing Fastq Alignment BAM Visualization
More informationRNA-seq. Manpreet S. Katari
RNA-seq Manpreet S. Katari Evolution of Sequence Technology Normalizing the Data RPKM (Reads per Kilobase of exons per million reads) Score = R NT R = # of unique reads for the gene N = Size of the gene
More informationRNA-Seq in Galaxy: Tuxedo protocol. Igor Makunin, UQ RCC, QCIF
RNA-Seq in Galaxy: Tuxedo protocol Igor Makunin, UQ RCC, QCIF Acknowledgments Genomics Virtual Lab: gvl.org.au Galaxy for tutorials: galaxy-tut.genome.edu.au Galaxy Australia: galaxy-aust.genome.edu.au
More informationNGS : reads quality control
NGS : reads quality control Data used in this tutorials are available on https:/urgi.versailles.inra.fr/download/tuto/ngs-readsquality-control. Select genome solexa.fasta, illumina.fastq, solexa.fastq
More informationAccessible, Transparent and Reproducible Analysis with Galaxy
Accessible, Transparent and Reproducible Analysis with Galaxy Application of Next Generation Sequencing Technologies for Whole Transcriptome and Genome Analysis ABRF 2013 Saturday, March 2, 2013 Palm Springs,
More informationUsage of the Astro Runtime
A PPARC funded project Usage of the Astro Runtime Noel Winstanley nw@jb.man.ac.uk AstroGrid, Jodrell Bank, UK AstroGrid Workbench A Rich GUI Client for the VO http://www.astrogrid.org/desktop Workbench
More informationINTRODUCTION AUX FORMATS DE FICHIERS
INTRODUCTION AUX FORMATS DE FICHIERS Plan. Formats de séquences brutes.. Format fasta.2. Format fastq 2. Formats d alignements 2.. Format SAM 2.2. Format BAM 4. Format «Variant Calling» 4.. Format Varscan
More informationGenomic Files. University of Massachusetts Medical School. October, 2014
.. Genomic Files University of Massachusetts Medical School October, 2014 2 / 39. A Typical Deep-Sequencing Workflow Samples Fastq Files Fastq Files Sam / Bam Files Various files Deep Sequencing Further
More informationGeneric Model Organism Database. Lavanya Rishishwar
Generic Model Organism Database Lavanya Rishishwar Outline Purpose Genome database Basics of webserver & database GMOD 4/7/2016 Generic Model Organism Database 2 Presentation Assumption What do we understand:
More informationUsing the Galaxy Local Bioinformatics Cloud at CARC
Using the Galaxy Local Bioinformatics Cloud at CARC Lijing Bu Sr. Research Scientist Bioinformatics Specialist Center for Evolutionary and Theoretical Immunology (CETI) Department of Biology, University
More informationMin Wang. April, 2003
Development of a co-regulated gene expression analysis tool (CREAT) By Min Wang April, 2003 Project Documentation Description of CREAT CREAT (coordinated regulatory element analysis tool) are developed
More informationNoSQL Databases An efficient way to store and query heterogeneous astronomical data in DACE. Nicolas Buchschacher - University of Geneva - ADASS 2018
NoSQL Databases An efficient way to store and query heterogeneous astronomical data in DACE DACE https://dace.unige.ch Data and Analysis Center for Exoplanets. Facility to store, exchange and analyse data
More informationOur data for today is a small subset of Saimaa ringed seal RNA sequencing data (RNA_seq_reads.fasta). Let s first see how many reads are there:
Practical Course in Genome Bioinformatics 19.2.2016 (CORRECTED 22.2.2016) Exercises - Day 5 http://ekhidna.biocenter.helsinki.fi/downloads/teaching/spring2016/ Answer the 5 questions (Q1-Q5) according
More informationBovineMine Documentation
BovineMine Documentation Release 1.0 Deepak Unni, Aditi Tayal, Colin Diesh, Christine Elsik, Darren Hag Oct 06, 2017 Contents 1 Tutorial 3 1.1 Overview.................................................
More informationDr. Gabriela Salinas Dr. Orr Shomroni Kaamini Rhaithata
Analysis of RNA sequencing data sets using the Galaxy environment Dr. Gabriela Salinas Dr. Orr Shomroni Kaamini Rhaithata Microarray and Deep-sequencing core facility 30.10.2017 RNA-seq workflow I Hypothesis
More informationIntegrative Genomics Viewer. Prat Thiru
Integrative Genomics Viewer Prat Thiru 1 Overview User Interface Basics Browsing the Data Data Formats IGV Tools Demo Outline Based on ISMB 2010 Tutorial by Robinson and Thorvaldsdottir 2 Why IGV? IGV
More informationBuilding Geoprocessing Tools with Python: Beyond the Basics. Dave Wynne
Building Geoprocessing Tools with Python: Beyond the Basics Dave Wynne Building Geoprocessing Tools with Python: Getting Started Subhead Here This session will focus on creating polished, well-designed
More informationImporting your Exeter NGS data into Galaxy:
Importing your Exeter NGS data into Galaxy: The aim of this tutorial is to show you how to import your raw Illumina FASTQ files and/or assemblies and remapping files into Galaxy. As of 1 st July 2011 Illumina
More informationGetting Started. April Strand Life Sciences, Inc All rights reserved.
Getting Started April 2015 Strand Life Sciences, Inc. 2015. All rights reserved. Contents Aim... 3 Demo Project and User Interface... 3 Downloading Annotations... 4 Project and Experiment Creation... 6
More informationAnalyzing Variant Call results using EuPathDB Galaxy, Part II
Analyzing Variant Call results using EuPathDB Galaxy, Part II In this exercise, we will work in groups to examine the results from the SNP analysis workflow that we started yesterday. The first step is
More informationCopy Number Variations Detection - TD. Using Sequenza under Galaxy
Copy Number Variations Detection - TD Using Sequenza under Galaxy I. Data loading We will analyze the copy number variations of a human tumor (parotid gland carcinoma), limited to the chr17, from a WES
More informationBGGN-213: FOUNDATIONS OF BIOINFORMATICS (Lecture 14)
BGGN-213: FOUNDATIONS OF BIOINFORMATICS (Lecture 14) Genome Informatics (Part 1) https://bioboot.github.io/bggn213_f17/lectures/#14 Dr. Barry Grant Nov 2017 Overview: The purpose of this lab session is
More informationDatashield, Opal & Tools loading data, connection instance and running 3rd party tools
Datashield, Opal & Tools loading data, connection instance and running 3rd party tools Niels Hulstaert Niels.hulstaert@vib-ugent.be computational omics and systems biology group VIB / Ghent University,
More informationBioinformatics in next generation sequencing projects
Bioinformatics in next generation sequencing projects Rickard Sandberg Assistant Professor Department of Cell and Molecular Biology Karolinska Institutet March 2011 Once sequenced the problem becomes computational
More informationITMO Ecole de Bioinformatique Hands-on session: smallrna-seq N. Servant 21 rd November 2013
ITMO Ecole de Bioinformatique Hands-on session: smallrna-seq N. Servant 21 rd November 2013 1. Data and objectives We will use the data from GEO (GSE35368, Toedling, Servant et al. 2011). Two samples were
More informationNGS Data Analysis. Roberto Preste
NGS Data Analysis Roberto Preste 1 Useful info http://bit.ly/2r1y2dr Contacts: roberto.preste@gmail.com Slides: http://bit.ly/ngs-data 2 NGS data analysis Overview 3 NGS Data Analysis: the basic idea http://bit.ly/2r1y2dr
More informationTumor-Specific NeoAntigen Detector (TSNAD) v2.0 User s Manual
Tumor-Specific NeoAntigen Detector (TSNAD) v2.0 User s Manual Zhan Zhou, Xingzheng Lyu and Jingcheng Wu Zhejiang University, CHINA March, 2016 USER'S MANUAL TABLE OF CONTENTS 1 GETTING STARTED... 1 1.1
More informationHinri Kerstens. NGS pipeline using Broad's Cromwell
Hinri Kerstens NGS pipeline using Broad's Cromwell Introduction Princess Máxima Center is a organization fully specialized in pediatric oncology. By combining the best possible research and care, we will
More informationAPPLICATION USER GUIDE
APPLICATION USER GUIDE Application: FileManager Version: 3.2 Description: File Manager allows you to take full control of your website files. You can copy, move, delete, rename and edit files, create and
More informationHigh-throughput sequencing: Alignment and related topic. Simon Anders EMBL Heidelberg
High-throughput sequencing: Alignment and related topic Simon Anders EMBL Heidelberg Established platforms HTS Platforms Illumina HiSeq, ABI SOLiD, Roche 454 Newcomers: Benchtop machines 454 GS Junior,
More informationAEM Forms: Rest API Integration as a Datasource
AEM Forms: Rest API Integration as a Datasource Samit Narula, Technical Architect, Overview The Swagger (OpenAPI) specification is quite detailed and defines various directives, constraints, and configurations
More informationGenome Browser. Background and Strategy. 12 April 2010
Genome Browser Background and Strategy 12 April 2010 I. Background 1. Project definition 2. Survey of genome browsers II. Strategy Alejandro Caro, Chandni Desai, Neha Gupta, Jay Humphrey, Chengwei Luo,
More informationDecrypting your genome data privately in the cloud
Decrypting your genome data privately in the cloud Marc Sitges Data Manager@Made of Genes @madeofgenes The Human Genome 3.200 M (x2) Base pairs (bp) ~20.000 genes (~30%) (Exons ~1%) The Human Genome Project
More informationGenomic Files. University of Massachusetts Medical School. October, 2015
.. Genomic Files University of Massachusetts Medical School October, 2015 2 / 55. A Typical Deep-Sequencing Workflow Samples Fastq Files Fastq Files Sam / Bam Files Various files Deep Sequencing Further
More informationBruce Moore Fall 99 Internship September 23, 1999 Supervised by Dr. John P.
Bruce Moore Fall 99 Internship September 23, 1999 Supervised by Dr. John P. Russo Active Server Pages Active Server Pages are Microsoft s newest server-based technology for building dynamic and interactive
More informationreplace my_user_id in the commands with your actual user ID
Exercise 1. Alignment with TOPHAT Part 1. Prepare the working directory. 1. Find out the name of the computer that has been reserved for you (https://cbsu.tc.cornell.edu/ww/machines.aspx?i=57 ). Everyone
More informationCreating Web Mapping Applications. Nikki Golding
Creating Web Mapping Applications Nikki Golding Agenda Web Mapping and Map Services Fundamentals ArcGIS Web Mapping Applications - ArcGIS.com Viewer - ArcGIS Explorer Online - ArcGIS Viewer for Flex -
More informationCopyright 2014 Regents of the University of Minnesota
Quality Control of Illumina Data using Galaxy August 18, 2014 Contents 1 Introduction 2 1.1 What is Galaxy?..................................... 2 1.2 Galaxy at MSI......................................
More informationA Virtual Machine to teach NGS data analysis. Andreas Gisel CNR - ITB Bari, Italy
A Virtual Machine to teach NGS data analysis Andreas Gisel CNR - ITB Bari, Italy The Virtual Machine A virtual machine is a tightly isolated software container that can run its own operating systems and
More informationChIP-seq hands-on practical using Galaxy
ChIP-seq hands-on practical using Galaxy In this exercise we will cover some of the basic NGS analysis steps for ChIP-seq using the Galaxy framework: Quality control Mapping of reads using Bowtie2 Peak-calling
More informationGenomic Data Analysis Services Available for PL-Grid Users
Domain-oriented services and resources of Polish Infrastructure for Supporting Computational Science in the European Research Space PLGrid Plus Domain-oriented services and resources of Polish Infrastructure
More informationThese will serve as a basic guideline for read prep. This assumes you have demultiplexed Illumina data.
These will serve as a basic guideline for read prep. This assumes you have demultiplexed Illumina data. We have a few different choices for running jobs on DT2 we will explore both here. We need to alter
More informationEnvironmental Sample Classification E.S.C., Josh Katz and Kurt Zimmer
Environmental Sample Classification E.S.C., Josh Katz and Kurt Zimmer Goal: The task we were given for the bioinformatics capstone class was to construct an interface for the Pipas lab that integrated
More informationMaize genome sequence in FASTA format. Gene annotation file in gff format
Exercise 1. Using Tophat/Cufflinks to analyze RNAseq data. Step 1. One of CBSU BioHPC Lab workstations has been allocated for your workshop exercise. The allocations are listed on the workshop exercise
More informationIntroduction to Galaxy
Introduction to Galaxy Dr Jason Wong Prince of Wales Clinical School Introductory bioinformatics for human genomics workshop, UNSW Day 1 Thurs 28 th January 2016 Overview What is Galaxy? Description of
More informationLecture 12. Short read aligners
Lecture 12 Short read aligners Ebola reference genome We will align ebola sequencing data against the 1976 Mayinga reference genome. We will hold the reference gnome and all indices: mkdir -p ~/reference/ebola
More informationTutorial: Using BWA aligner to identify low-coverage genomes in metagenome sample Umer Zeeshan Ijaz
Tutorial: Using BWA aligner to identify low-coverage genomes in metagenome sample Umer Zeeshan Ijaz We will use NexteraXT_even_1ng_HISEQ_AGGCAGAA-CTCTCTAT dataset to identify the list of genomes with low
More informationGeneious 5.6 Quickstart Manual. Biomatters Ltd
Geneious 5.6 Quickstart Manual Biomatters Ltd October 15, 2012 2 Introduction This quickstart manual will guide you through the features of Geneious 5.6 s interface and help you orient yourself. You should
More informationde.nbi and its Galaxy interface for RNA-Seq
de.nbi and its Galaxy interface for RNA-Seq Jörg Fallmann Thanks to Björn Grüning (RBC-Freiburg) and Sarah Diehl (MPI-Freiburg) Institute for Bioinformatics University of Leipzig http://www.bioinf.uni-leipzig.de/
More informationManually Using Cpanel
How To Install Module Joomla 2.5 Template Manually Using Cpanel In this tutorial, we will show you how to manually install Joomla 2.5. At the time of this Now that you have download joomla, upload the
More informationAMGA metadata catalogue system
AMGA metadata catalogue system Hurng-Chun Lee ACGrid School, Hanoi, Vietnam www.eu-egee.org EGEE and glite are registered trademarks Outline AMGA overview AMGA Background and Motivation for AMGA Interface,
More informationGenome Browsers - The UCSC Genome Browser
Genome Browsers - The UCSC Genome Browser Background The UCSC Genome Browser is a well-curated site that provides users with a view of gene or sequence information in genomic context for a specific species,
More informationBiocomputing II Coursework guidance
Biocomputing II Coursework guidance I refer to the database layer as DB, the middle (business logic) layer as BL and the front end graphical interface with CGI scripts as (FE). Standardized file headers
More informationHymenopteraMine Documentation
HymenopteraMine Documentation Release 1.0 Aditi Tayal, Deepak Unni, Colin Diesh, Chris Elsik, Darren Hagen Apr 06, 2017 Contents 1 Welcome to HymenopteraMine 3 1.1 Overview of HymenopteraMine.....................................
More informationdbdeployer the future of MySQL sandboxes Giuseppe Maxia Software explorer
dbdeployer the future of MySQL sandboxes Giuseppe Maxia Software explorer About me Who's this guy? Giuseppe Maxia, a.k.a. "The Data Charmer" Software Explorer at VMware Several decades development and
More informationMagento Survey Extension User Guide
Magento Survey Extension User Guide Page 1 Table of Contents To Access Plugin, Activate API Key... 3 Create Questions... 5 Manage Survey... 6 Assign Question to Survey... 7 Reveal Survey In Three Ways...
More informationWeb page:
mirdeep* manual 2013-01-10 Jiyuan An, John Lai, Melanie Lehman, Colleen Nelson: Australian Prostate Cancer Research Center (APCRC-Q) and Institute of Health and Biomedical Innovation (IHBI), Queensland
More informationUsing Galaxy to provide Tools for the Analysis of diverse Local Datasets. 6 Key Insights
5/25/11 Using Galaxy to provide Tools for the Analysis of diverse Local Datasets 6 Key Insights Hans-Rudolf Hotz (hrh@fmi.ch) Friedrich Miescher Institute for Biomedical Research Basel, Switzerland background
More informationAutosave for Research Where to Start with Checkpoint/Restart
Autosave for Research Where to Start with Checkpoint/Restart Brandon Barker Computational Scientist Cornell University Center for Advanced Computing (CAC) brandon.barker@cornell.edu Workshop: High Performance
More informationIntroduction to Read Alignment. UCD Genome Center Bioinformatics Core Tuesday 15 September 2015
Introduction to Read Alignment UCD Genome Center Bioinformatics Core Tuesday 15 September 2015 From reads to molecules Why align? Individual A Individual B ATGATAGCATCGTCGGGTGTCTGCTCAATAATAGTGCCGTATCATGCTGGTGTTATAATCGCCGCATGACATGATCAATGG
More informationWorking with Feature Layers. Russell Brennan Gary MacDougall
Working with Feature Layers Russell Brennan Gary MacDougall Working with Feature Layers Session will focus on feature access and editing Highlight new features added over the last few releases Agenda Introduction
More informationHigh-throughput sequencing: Alignment and related topic. Simon Anders EMBL Heidelberg
High-throughput sequencing: Alignment and related topic Simon Anders EMBL Heidelberg Established platforms HTS Platforms Illumina HiSeq, ABI SOLiD, Roche 454 Newcomers: Benchtop machines: Illumina MiSeq,
More informationAllBio Tutorial. NGS data analysis for non-coding RNAs and small RNAs
AllBio Tutorial NGS data analysis for non-coding RNAs and small RNAs Aim of the Tutorial Non-coding RNA (ncrna) are functional RNA molecule that are not translated into a protein. ncrna genes include highly
More informationManual of mirdeepfinder for EST or GSS
Manual of mirdeepfinder for EST or GSS Index 1. Description 2. Requirement 2.1 requirement for Windows system 2.1.1 Perl 2.1.2 Install the module DBI 2.1.3 BLAST++ 2.2 Requirement for Linux System 2.2.1
More informationCLC Genomics Server. Administrator Manual
CLC Genomics Server Administrator Manual Administrator Manual for CLC Genomics Server 5.5 Windows, Mac OS X and Linux October 31, 2013 This software is for research purposes only. CLC bio Silkeborgvej
More informationPROCE55 Mobile: Web API App. Web API. https://www.rijksmuseum.nl/api/...
PROCE55 Mobile: Web API App PROCE55 Mobile with Test Web API App Web API App Example This example shows how to access a typical Web API using your mobile phone via Internet. The returned data is in JSON
More informationFrom the Schnable Lab:
From the Schnable Lab: Yang Zhang and Daniel Ngu s Pipeline for Processing RNA-seq Data (As of November 17, 2016) yzhang91@unl.edu dngu2@huskers.unl.edu Pre-processing the reads: The alignment software
More informationSequence Analysis Pipeline
Sequence Analysis Pipeline Transcript fragments 1. PREPROCESSING 2. ASSEMBLY (today) Removal of contaminants, vector, adaptors, etc Put overlapping sequence together and calculate bigger sequences 3. Analysis/Annotation
More informationAnnotating a Genome in PATRIC
Annotating a Genome in PATRIC The following step-by-step workflow is intended to help you learn how to navigate the new PATRIC workspace environment in order to annotate and browse your genome on the PATRIC
More informationExtract API: Build sophisticated data models with the Extract API
Welcome # T C 1 8 Extract API: Build sophisticated data models with the Extract API Justin Craycraft Senior Sales Consultant Tableau / Customer Consulting My Office Photo Used with permission Agenda 1)
More informationAn early challenge that LabKey users encounter is what is the best way to get their data into the server and what are the appropriate data types to
LabKey Data Models An early challenge that LabKey users encounter is what is the best way to get their data into the server and what are the appropriate data types to use Data in LabKey LabKey server offers
More information