Genomic Finishing & Consed

Transcription

1 Genomic Finishing & Consed

2 SEA stages of genomic analysis

3 Draft vs Finished Draft Sequence Single sequencing approach Limited human intervention Cheap, Fast Finished sequence Multiple approaches Human intervention required Slow, Expensive Suitable for computational annotation Suitable for Human annotation

4 Genomic assembly starts with Reads

5 Reads are assembled to make contigs Reads: CAGACGTGTCAGTCGACTCGATATACTGAGCTAGTCGACT TAGCTAGCCGGATAGTATTACCAGACGTGTCAGTCGACTCGATA CCAGATCGATCGATTCGCGATAGCTAGCCGGATAGTATTACCAGACGT Alignment CAGACGTGTCAGTCGACTCGATATACTGAGCTAGTCGACT TAGCTAGCCGGATAGTATTACCAGACGTGTCAGTCGACTCGATA CCAGATCGATCGATTCGCGATAGCTAGCCGGATAGTATTACCAGACGT Contig: Consensus CCAGATCGATCGATTCGCGATAGCTAGCCGGATAGTATTACCAGACGTTCAGTCGACTCGATATACTGAGCTAGTCGACT

6 Reads: basecalls and quality scores

7 Reads can come in pairs Two end reads Library of size selected DNA Known distance apart

8 Paired-end reads help in two ways If one member of the pair has unique sequence and the other member is repetitive, you have more information to help place the repeated read in the correct position? If one member of the pair is found in one contig and the other member of the pair is in a different contig you have information about how the two contigs relate to each other

9 Scaffolding Using paired ends to create order and orientation of contigs Contig 1 Contig 2 Contig 3 One scaffold with 2 gaps

10 Three levels or organization 1. Reads 1. Contigs 2. Scaffolds

11 Consed Consensus Editor Reads in Ace files Allows finishers to view, search and edit within the assembly with the goal of creating a final high quality sequence

12 Features of Consed 1. View Reads Contigs Scaffolds 2. Edit Change basecalls Add or remove reads from contigs Join or split contigs 3. Find Find problem areas Search for sequences

13 Viewing data in Consed Assembly view Aligned Reads Trace window

14 Assembly View View at the Scaffold level Fat grey bars are the contigs 10 kb Triangle Hats link endpoint of sequence pairs derived from the same subclone Red Triangles on the underside indicate inconsistent pairs wrong size and/or wrong orientation

15 Aligned Reads Top line is base coordinates of contig Next line is consensus Name of read on left, direction arrow, read sequence

16 Trace window Top line is base coordinates of contig and read Next line is consensus con Name of read on left, direction arrow Multiple reads opened and aligned

17 Consed practical advice Three button mouse is required Primary (Left) Click buttons & Select items Secondary (Right) Context Menu Middle (Scroll wheel) Add Tag, Open Trace, Paste selection

18 Confusing issues with Consed Pads * in consensus, placeholders Not exported to consensus Cannot be deleted

19 Confusing issues with Consed The tag trap If Consed appears to have frozen don t panic You probably tried to add a tag and need to tell consed which tag type Look for a window which says You must respond to this before doing anything else click on Cancel or Dismiss at bottom of window

20 Top window buttons Top buttons on window, minimize, maximize, close Close button does not always work Use button at the bottom of the window Cancel, Dismiss, OK, Yes, No

21 Questions?