Genomic Finishing & Consed
|
|
- Daniela Walker
- 5 years ago
- Views:
Transcription
1 Genomic Finishing & Consed
2 SEA stages of genomic analysis
3 Draft vs Finished Draft Sequence Single sequencing approach Limited human intervention Cheap, Fast Finished sequence Multiple approaches Human intervention required Slow, Expensive Suitable for computational annotation Suitable for Human annotation
4 Genomic assembly starts with Reads
5 Reads are assembled to make contigs Reads: CAGACGTGTCAGTCGACTCGATATACTGAGCTAGTCGACT TAGCTAGCCGGATAGTATTACCAGACGTGTCAGTCGACTCGATA CCAGATCGATCGATTCGCGATAGCTAGCCGGATAGTATTACCAGACGT Alignment CAGACGTGTCAGTCGACTCGATATACTGAGCTAGTCGACT TAGCTAGCCGGATAGTATTACCAGACGTGTCAGTCGACTCGATA CCAGATCGATCGATTCGCGATAGCTAGCCGGATAGTATTACCAGACGT Contig: Consensus CCAGATCGATCGATTCGCGATAGCTAGCCGGATAGTATTACCAGACGTTCAGTCGACTCGATATACTGAGCTAGTCGACT
6 Reads: basecalls and quality scores
7 Reads can come in pairs Two end reads Library of size selected DNA Known distance apart
8 Paired-end reads help in two ways If one member of the pair has unique sequence and the other member is repetitive, you have more information to help place the repeated read in the correct position? If one member of the pair is found in one contig and the other member of the pair is in a different contig you have information about how the two contigs relate to each other
9 Scaffolding Using paired ends to create order and orientation of contigs Contig 1 Contig 2 Contig 3 One scaffold with 2 gaps
10 Three levels or organization 1. Reads 1. Contigs 2. Scaffolds
11 Consed Consensus Editor Reads in Ace files Allows finishers to view, search and edit within the assembly with the goal of creating a final high quality sequence
12 Features of Consed 1. View Reads Contigs Scaffolds 2. Edit Change basecalls Add or remove reads from contigs Join or split contigs 3. Find Find problem areas Search for sequences
13 Viewing data in Consed Assembly view Aligned Reads Trace window
14 Assembly View View at the Scaffold level Fat grey bars are the contigs 10 kb Triangle Hats link endpoint of sequence pairs derived from the same subclone Red Triangles on the underside indicate inconsistent pairs wrong size and/or wrong orientation
15 Aligned Reads Top line is base coordinates of contig Next line is consensus Name of read on left, direction arrow, read sequence
16 Trace window Top line is base coordinates of contig and read Next line is consensus con Name of read on left, direction arrow Multiple reads opened and aligned
17 Consed practical advice Three button mouse is required Primary (Left) Click buttons & Select items Secondary (Right) Context Menu Middle (Scroll wheel) Add Tag, Open Trace, Paste selection
18 Confusing issues with Consed Pads * in consensus, placeholders Not exported to consensus Cannot be deleted
19 Confusing issues with Consed The tag trap If Consed appears to have frozen don t panic You probably tried to add a tag and need to tell consed which tag type Look for a window which says You must respond to this before doing anything else click on Cancel or Dismiss at bottom of window
20 Top window buttons Top buttons on window, minimize, maximize, close Close button does not always work Use button at the bottom of the window Cancel, Dismiss, OK, Yes, No
21 Questions?
Last Update: 01/19/2017
USING CONSED GRAPHICALLY July 2014 1. STARTING... 2 2. RUN CONSED... 2 3. SCROLLING... 3 4. GO TO POSITION... 4 5. COLORS... 4 6. KEYBOARD USAGE... 5 7. HIGHLIGHTING READ NAMES... 5 8. DIMMING ENDS OF
More informationINTRODUCTION TO CONSED
INTRODUCTION TO CONSED OVERVIEW: Consed is a program that can be used to visually assemble and analyze sequence data. This introduction will take you through the basics of opening and operating within
More informationTour Guide for Windows and Macintosh
Tour Guide for Windows and Macintosh 2011 Gene Codes Corporation Gene Codes Corporation 775 Technology Drive, Suite 100A, Ann Arbor, MI 48108 USA phone 1.800.497.4939 or 1.734.769.7249 (fax) 1.734.769.7074
More informationTutorial. Aligning contigs manually using the Genome Finishing. Sample to Insight. February 6, 2019
Aligning contigs manually using the Genome Finishing Module February 6, 2019 Sample to Insight QIAGEN Aarhus Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 www.qiagenbioinformatics.com
More informationBarchard Introduction to SPSS Marks
Barchard Introduction to SPSS 22.0 3 Marks Purpose The purpose of this assignment is to introduce you to SPSS, the most commonly used statistical package in the social sciences. You will create a new data
More informationTutorial for Windows and Macintosh Assembly Strategies
Tutorial for Windows and Macintosh Assembly Strategies 2017 Gene Codes Corporation Gene Codes Corporation 525 Avis Drive, Ann Arbor, MI 48108 USA 1.800.497.4939 (USA) +1.734.769.7249 (elsewhere) +1.734.769.7074
More informationRelease Notes. Version Gene Codes Corporation
Version 4.10.1 Release Notes 2010 Gene Codes Corporation Gene Codes Corporation 775 Technology Drive, Ann Arbor, MI 48108 USA 1.800.497.4939 (USA) +1.734.769.7249 (elsewhere) +1.734.769.7074 (fax) www.genecodes.com
More informationTutorial: De Novo Assembly of Paired Data
: De Novo Assembly of Paired Data September 20, 2013 CLC bio Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 Fax: +45 86 20 12 22 www.clcbio.com support@clcbio.com : De Novo Assembly
More informationTutorial: How to use the Wheat TILLING database
Tutorial: How to use the Wheat TILLING database Last Updated: 9/7/16 1. Visit http://dubcovskylab.ucdavis.edu/wheat_blast to go to the BLAST page or click on the Wheat BLAST button on the homepage. 2.
More informationTutorial. De Novo Assembly of Paired Data. Sample to Insight. November 21, 2017
De Novo Assembly of Paired Data November 21, 2017 Sample to Insight QIAGEN Aarhus Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 www.qiagenbioinformatics.com AdvancedGenomicsSupport@qiagen.com
More informationBarchard Introduction to SPSS Marks
Barchard Introduction to SPSS 21.0 3 Marks Purpose The purpose of this assignment is to introduce you to SPSS, the most commonly used statistical package in the social sciences. You will create a new data
More informationCodonCode Aligner User Manual
CodonCode Aligner User Manual CodonCode Aligner User Manual Table of Contents About CodonCode Aligner...1 System Requirements...1 Licenses...1 Licenses for CodonCode Aligner...3 Demo Mode...3 Time-limited
More informationDrosophila Sequence Improvement Problem Set Prepared nd or updated by Andrew Nylander, Matt Dothager, William Barshop, Chris Shaffer and Wilson Leung
Drosophila Sequence Improvement Problem Set Prepared nd or updated by Andrew Nylander, Matt Dothager, William Barshop, Chris Shaffer and Wilson Leung Prerequisites: A Guide to Consed Introduction to Consed
More informationImporting sequence assemblies from BAM and SAM files
BioNumerics Tutorial: Importing sequence assemblies from BAM and SAM files 1 Aim With the BioNumerics BAM import routine, a sequence assembly in BAM or SAM format can be imported in BioNumerics. A BAM
More informationIntroduction to SPSS
Introduction to SPSS Purpose The purpose of this assignment is to introduce you to SPSS, the most commonly used statistical package in the social sciences. You will create a new data file and calculate
More informationTutorial for Windows and Macintosh SNP Hunting
Tutorial for Windows and Macintosh SNP Hunting 2010 Gene Codes Corporation Gene Codes Corporation 775 Technology Drive, Ann Arbor, MI 48108 USA 1.800.497.4939 (USA) +1.734.769.7249 (elsewhere) +1.734.769.7074
More informationGenome Assembly and De Novo RNAseq
Genome Assembly and De Novo RNAseq BMI 7830 Kun Huang Department of Biomedical Informatics The Ohio State University Outline Problem formulation Hamiltonian path formulation Euler path and de Bruijin graph
More informationMicrosoft Office 2010: Introductory Q&As Access Chapter 2
Microsoft Office 2010: Introductory Q&As Access Chapter 2 Is it necessary to close the Navigation Pane? (AC 78) No. It gives you more room for the query, however, so it is usually a good practice to hide
More informationTutorial for Windows and Macintosh. De Novo Sequence Assembly with Velvet
Tutorial for Windows and Macintosh De Novo Sequence Assembly with Velvet 2017 Gene Codes Corporation Gene Codes Corporation 525 Avis Drive, Ann Arbor, MI 48108 USA 1.800.497.4939 (USA) +1.734.769.7249
More informationGenome Browsers Guide
Genome Browsers Guide Take a Class This guide supports the Galter Library class called Genome Browsers. See our Classes schedule for the next available offering. If this class is not on our upcoming schedule,
More informationTitle:- Instructions to run GS Assembler and Mapper Course # BIOL 8803 Special Topic on Computational Genomics Assembly Group
Title:- Instructions to run GS Assembler and Mapper Course # BIOL 8803 Special Topic on Computational Genomics Assembly Group Contents 1. Genome Assembly... 3 1.0. Data and Projects... 3 1.1. GS De Novo
More informationThis is the opening view of blender.
This is the opening view of blender. Note that interacting with Blender is a little different from other programs that you may be used to. For example, left clicking won t select objects on the scene,
More informationTutorial for Windows and Macintosh SNP Hunting
Tutorial for Windows and Macintosh SNP Hunting 2017 Gene Codes Corporation Gene Codes Corporation 525 Avis Drive, Ann Arbor, MI 48108 USA 1.800.497.4939 (USA) +1.734.769.7249 (elsewhere) +1.734.769.7074
More informationTitle of Resource Introduction to SPSS 22.0: Assignment and Grading Rubric Kimberly A. Barchard. Author(s)
Title of Resource Introduction to SPSS 22.0: Assignment and Grading Rubric Kimberly A. Barchard Author(s) Leiszle Lapping-Carr Institution University of Nevada, Las Vegas Students learn the basics of SPSS,
More informationJoomla! 2.5.x Training Manual
Joomla! 2.5.x Training Manual 1 Joomla is an online content management system that keeps track of all content on your website including text, images, links, and documents. This manual includes several
More informationBrowser Exercises - I. Alignments and Comparative genomics
Browser Exercises - I Alignments and Comparative genomics 1. Navigating to the Genome Browser (GBrowse) Note: For this exercise use http://www.tritrypdb.org a. Navigate to the Genome Browser (GBrowse)
More informationRelationship Estimator
This is a small program that is intended to make the DNA Prediction Chart Spreadsheet a bit easier to use. It is based entirely on the data in this spreadsheet plus some interpolation of missing values.
More informationWorking with AppleScript
Tutorial for Macintosh Working with AppleScript 2011Gene Codes Corporation Gene Codes Corporation 775 Technology Drive, Ann Arbor, MI 48108 USA 1.800.497.4939 (USA) +1.734.769.7249 (elsewhere) +1.734.769.7074
More informationFor Research Use Only. Not for use in diagnostic procedures.
SMRT View Guide For Research Use Only. Not for use in diagnostic procedures. P/N 100-088-600-02 Copyright 2012, Pacific Biosciences of California, Inc. All rights reserved. Information in this document
More informationWebShare Cloud Basics
3D Laser Scanning WebShare Cloud Basics WebShare Cloud Instructions The purpose of this document is to walk you through the process of using WebShare Cloud if you have been invited to view information.
More informationAeries.net Student Information System Master Schedule User Manual April 18, 2010
Aeries.net Student Information System Master Schedule User Manual April 18, 2010 The Master Schedule is utilized to display and update the school s current master schedule in the MST table. When this form
More informationde novo assembly Simon Rasmussen 36626: Next Generation Sequencing analysis DTU Bioinformatics Next Generation Sequencing Analysis
de novo assembly Simon Rasmussen 36626: Next Generation Sequencing analysis DTU Bioinformatics 27626 - Next Generation Sequencing Analysis Generalized NGS analysis Data size Application Assembly: Compare
More informationUsing Microsoft Word. Text Editing
Using Microsoft Word A word processor is all about working with large amounts of text, so learning the basics of text editing is essential to being able to make the most of the program. The first thing
More informationDe novo genome assembly
BioNumerics Tutorial: De novo genome assembly 1 Aims This tutorial describes a de novo assembly of a Staphylococcus aureus genome, using single-end and pairedend reads generated by an Illumina R Genome
More informationPremiere Pro Desktop Layout (NeaseTV 2015 Layout)
Premiere Pro 2015 1. Contextually Sensitive Windows - Must be on the correct window in order to do some tasks 2. Contextually Sensitive Menus 3. 1 zillion ways to do something. No 2 people will do everything
More informationHighlight the s address (example: and go to the top of the page and click on Insert
Contents Linking an email address... 2 LINK AN IMAGE... 2 TO LINK TO A DOCUMENT... 3 How to update the Quick Links.... 6 Changing out a Quick link.... 9 LINKS Linking an email address Highlight the emails
More information1.0 Overview For content management, Joomla divides into some basic components: the Article
Joomla! 3.4.x Training Manual Joomla is an online content management system that keeps track of all content on your website including text, images, links, and documents. This manual includes several tutorials
More informationComparative Sequencing
Tutorial for Windows and Macintosh Comparative Sequencing 2017 Gene Codes Corporation Gene Codes Corporation 525 Avis Drive, Ann Arbor, MI 48108 USA 1.800.497.4939 (USA) +1.734.769.7249 (elsewhere) +1.734.769.7074
More information0.5 Graphing Piecewise-Defined Functions
0.5 Graphing Piecewise-Defined Functions To graph a piecewise-defined function, such as f(x) = { 3x + if x < x if x we must specify each piece of the function and the values of x to use for that particular
More informationAudacity Stereo Wave Recorder and Editor
Audacity Stereo Wave Recorder and Editor Here s a brief rundown on First connect the cable from the headphone jack on the boombox to the microphone jack on the front of the computer in your room. Next
More informationSequence comparison: Local alignment
Sequence comparison: Local alignment Genome 559: Introuction to Statistical an Computational Genomics Prof. James H. Thomas http://faculty.washington.eu/jht/gs559_217/ Review global alignment en traceback
More informationPerforming whole genome SNP analysis with mapping performed locally
BioNumerics Tutorial: Performing whole genome SNP analysis with mapping performed locally 1 Introduction 1.1 An introduction to whole genome SNP analysis A Single Nucleotide Polymorphism (SNP) is a variation
More informationDEPARTMENT OF HEALTH AND HUMAN SCIENCES HS900 RESEARCH METHODS
DEPARTMENT OF HEALTH AND HUMAN SCIENCES HS900 RESEARCH METHODS Using SPSS Topics addressed today: 1. Accessing data from CMR 2. Starting SPSS 3. Getting familiar with SPSS 4. Entering data 5. Saving data
More informationPanasonic VRF Software. New features of VRF software
Panasonic VRF Software New features of VRF software April 2013 1 Contents: Mounting scheme... 5 1. Import building scheme into software... 5 1.1. Export building scheme as DXF from AutoCAD... 5 1.2. Export
More informationMacVector for Mac OS X. Sequence Confirmation Tutorial
MacVector 11.0 for Mac OS X Sequence Confirmation Tutorial Copyright statement Copyright MacVector, Inc, 2009. All rights reserved. This document contains proprietary information of MacVector, Inc and
More informationCreating a Brochure. The right side of your Publisher screen will now change to Brochures.
Creating a Brochure Open Microsoft Publisher. You will see the Microsoft Publisher Task Pane on the left side of your screen. Click the Brochures selection in the Publication Types area. The right side
More informationMain Interface. Main Profiles Link to Program Normal Mode / Battle Mode Key Assignment. Macro Setting
A CONTENTS PAGE 01 PAGE 17 PAGE 23 PAGE 27 PAGE 28 Main Interface Main Profiles Link to Program Normal Mode / Battle Mode Key Assignment Macro Setting Macro Setting Interface Macro Manager Macro Record
More informationSolution Documentation - Graphical Process Editor
Documentation SAP Solution Manager 7.2 SPS 6 Document Version: 3.01 2018-01-15 Typographic Conventions Type Style Example Example EXAMPLE Example Example EXAMPLE Description Words or characters
More informationMeraculous De Novo Assembly of the Ariolimax dolichophallus Genome. Charles Cole, Jake Houser, Kyle McGovern, and Jennie Richardson
Meraculous De Novo Assembly of the Ariolimax dolichophallus Genome Charles Cole, Jake Houser, Kyle McGovern, and Jennie Richardson Meraculous Assembler Published by the US Department of Energy Joint Genome
More informationMitochondrial DNA Typing
Tutorial for Windows and Macintosh Mitochondrial DNA Typing 2007 Gene Codes Corporation Gene Codes Corporation 775 Technology Drive, Ann Arbor, MI 48108 USA 1.800.497.4939 (USA) +1.734.769.7249 (elsewhere)
More informationCourse Exercises for the Content Management System. Grazyna Whalley, Laurence Cornford June 2014 AP-CMS2.0. University of Sheffield
Course Exercises for the Content Management System. Grazyna Whalley, Laurence Cornford June 2014 AP-CMS2.0 University of Sheffield PART 1 1.1 Getting Started 1. Log on to the computer with your usual username
More informationMacVector for Mac OS X. The online updater for this release is MB in size
MacVector 17.0.3 for Mac OS X The online updater for this release is 143.5 MB in size You must be running MacVector 15.5.4 or later for this updater to work! System Requirements MacVector 17.0 is supported
More informationPress the Plus + key to zoom in. Press the Minus - key to zoom out. Scroll the mouse wheel away from you to zoom in; towards you to zoom out.
Navigate Around the Map Interactive maps provide many choices for displaying information, searching for more details, and moving around the map. Most navigation uses the mouse, but at times you may also
More informationFor Research Use Only. Not for use in diagnostic procedures.
SMRT View Guide For Research Use Only. Not for use in diagnostic procedures. P/N 100-088-600-03 Copyright 2012, Pacific Biosciences of California, Inc. All rights reserved. Information in this document
More informationGenome 373: Mapping Short Sequence Reads I. Doug Fowler
Genome 373: Mapping Short Sequence Reads I Doug Fowler Two different strategies for parallel amplification BRIDGE PCR EMULSION PCR Two different strategies for parallel amplification BRIDGE PCR EMULSION
More informationClassroom Performance System (CPS) Clickers Instructions I. CPS procedures if you choose to use all the options
Classroom Performance System (CPS) Clickers Instructions I CPS procedures if you choose to use all the options Before class Download software to your computer One-time activity Create your folder on local
More informationMitochondrial DNA Typing
Tutorial for Windows and Macintosh Mitochondrial DNA Typing 2017 Gene Codes Corporation Gene Codes Corporation 525 Avis Drive, Ann Arbor, MI 48108 USA 1.800.497.4939 (USA) +1.734.769.7249 (elsewhere) +1.734.769.7074
More informationGet comfortable using computers
Mouse A computer mouse lets us click buttons, pick options, highlight sections, access files and folders, move around your computer, and more. Think of it as your digital hand for operating a computer.
More informationTennessee Society Sons of the American Revolution On-Line Application Log Database
1) On the TNSSAR website (www.tnssar.org) click on "Site Links" in the menu. Then click on "Restricted Access" to go to the State & Chapter Officer Entry page (http://www.tnssar.org/archives/memberenter.html
More information1 User Guide. 1 Main screen
1 User Guide 1 Main screen The opening screen appears in figure 1. Please wait until the loading bar (as shown in the bottom left) has filled up and the text changed from loading to completed. From the
More informationDatawatch Monarch Release Notes Version July 9th, 2018
Datawatch Monarch Release Notes Version 15.1.0 July 9th, 2018 MONARCH CLASSIC (MONARCH CLASSIC & MONARCH COMPLETE) MOD-2941 MOD-3256 MOD-3285 MOD-3300 MOD-3304 MOD-3314 MOD-3323 MOD-3288 Legacy PDF engine
More informationDescription of a genome assembler: CABOG
Theo Zimmermann Description of a genome assembler: CABOG CABOG (Celera Assembler with the Best Overlap Graph) is an assembler built upon the Celera Assembler, which, at first, was designed for Sanger sequencing,
More informationGoogle Docs: Spreadsheet basics
Google Docs: Spreadsheet basics Once you know the basics on how to access, create, and edit Google Docs, read here to learn the basics that apply specifically to Google Docs spreadsheets. Create a spreadsheet
More informationBlender Lesson Ceramic Bowl
Blender Lesson Ceramic Bowl This lesson is going to show you how to create a ceramic looking bowl using the free program Blender. You will learn how to change the view, add, delete, scale and edit objects
More informationDEEP I R O N I C S O F T W A R E IMAGE SEARCH
I R O N I C S O F T W A R E DEEP IMAGE SEARCH, L t d email:i r o n i c s u p p o r t @ g m a i l. c o m w w w. i r o n i c s o f t w a r e. c o m INTRODUCTION Deep is an image browser and search tool.
More informationPerforming a resequencing assembly
BioNumerics Tutorial: Performing a resequencing assembly 1 Aim In this tutorial, we will discuss the different options to obtain statistics about the sequence read set data and assess the quality, and
More informationWhen we search a nucleic acid databases, there is no need for you to carry out your own six frame translation. Mascot always performs a 6 frame
1 When we search a nucleic acid databases, there is no need for you to carry out your own six frame translation. Mascot always performs a 6 frame translation on the fly. That is, 3 reading frames from
More informationGenome 559: Introduction to Statistical and Computational Genomics. Lecture15a Multiple Sequence Alignment Larry Ruzzo
Genome 559: Introduction to Statistical and Computational Genomics Lecture15a Multiple Sequence Alignment Larry Ruzzo 1 Multiple Alignment: Motivations Common structure, function, or origin may be only
More informationUsing Microsoft Word. Paragraph Formatting. Displaying Hidden Characters
Using Microsoft Word Paragraph Formatting Every time you press the full-stop key in a document, you are telling Word that you are finishing one sentence and starting a new one. Similarly, if you press
More informationMouseless Internet Browsing for Open V/Vmax Devices
Mouseless Internet Browsing for Open V/Vmax Devices Mouseless Browsing (MLB) is a technique that enables you to browse the Internet without using a mouse. This innovative functionality adds small boxes
More information2. Getting Started When you start GeoGebra, you will see a version of the following window. 1
Math 5335 Fall 2018 Lab #0: Installing and using GeoGebra This semester you will have a number of lab assignments which require you to use GeoGebra, a dynamic geometry program. GeoGebra lets you explore
More informationSIP User's Guide. Sitecore Intranet Portal. A Quick Guide to Using SIP. SIP User's Guide Rev:
Sitecore Intranet Portal SIP User's Guide Rev: 2009-01-20 Sitecore Intranet Portal SIP User's Guide A Quick Guide to Using SIP Table of Contents Chapter 1 Introduction... 3 Chapter 2 Creating and Editing
More information5. LAPTOP PROCEDURES
5. LAPTOP PROCEDURES Introduction This next section of the user guide will identify core essentials regarding your laptop turning it on, running the program, running the questionnaire, submitting the data,
More informationEE261 Computer Project 1: Using Mentor Graphics for Digital Simulation
EE261 Computer Project 1: Using Mentor Graphics for Digital Simulation Introduction In this project, you will begin to explore the digital simulation tools of the Mentor Graphics package available on the
More informationMorphEdit for Windows. Copyright 1994,1995,1996 PJA White
MorphEdit for Windows Copyright 1994,1995,1996 PJA White Table of Contents 1. INTRODUCTION... 1 2. REQUIREMENTS... 2 3. INSTALLATION... 3 4. STARTING THE EDITOR... 4 5. MODES OF OPERATION... 5 5.1 STAND-ALONE
More informationThreaded Hex Bolt Tutorial
1-(800) 877-2745 www.ashlar-vellum.com Tutorial Using Cobalt, Xenon, Argon Copyright 2009-2014 Vellum Investment Partners, LLC, DBA Ashlar-Vellum. All rights reserved. Ashlar-Vellum Cobalt, Xenon & Argon
More informationCreating a data file and entering data
4 Creating a data file and entering data There are a number of stages in the process of setting up a data file and analysing the data. The flow chart shown on the next page outlines the main steps that
More informationPreliminary Syllabus. Genomics. Introduction & Genome Assembly Sequence Comparison Gene Modeling Gene Function Identification
Preliminary Syllabus Sep 30 Oct 2 Oct 7 Oct 9 Oct 14 Oct 16 Oct 21 Oct 25 Oct 28 Nov 4 Nov 8 Introduction & Genome Assembly Sequence Comparison Gene Modeling Gene Function Identification OCTOBER BREAK
More informationDNA sequences obtained in section were assembled and edited using DNA
Sequetyper DNA sequences obtained in section 4.4.1.3 were assembled and edited using DNA Baser Sequence Assembler v4 (www.dnabaser.com). The consensus sequences were used to interrogate the GenBank database
More informationHOW TO MODIFY AN ASSIGNED COURSE PLAN
HOW TO MODIFY AN ASSIGNED COURSE PLAN TABLE OF CONTENTS Revision History... 2 Introduction and Purpose... 2 Related Policies, Regulations, Guiding Principles, and Common Practices... 2 Impacted Departments,
More informationVirtual Memory. Today. Segmentation Paging A good, if common example
Virtual Memory Today Segmentation Paging A good, if common example Virtual memory system Goals Transparency Programs should not know that memory is virtualized; the OS +HW multiplex memory among processes
More informationCustomizing your Homepage in D2L
Customizing your Homepage in D2L This tutorial will teach you how to create a homepage that suits your course. You ll learn how to change the colors, rearrange items, and add dynamic objects to the homepage
More informationRESEARCH DATABASE. When you come to the Marine Mammal Research Database, you will see a window like the one below.
RESEARCH DATABASE When you come to the Marine Mammal Research Database, you will see a window like the one below. Use bottom scroll bar to see more columns of information. An alternative to using the bottom
More informationAnnotating sequences in batch
BioNumerics Tutorial: Annotating sequences in batch 1 Aim The annotation application in BioNumerics has been designed for the annotation of coding regions on sequences. In this tutorial you will learn
More informationBLAST Exercise 2: Using mrna and EST Evidence in Annotation Adapted by W. Leung and SCR Elgin from Annotation Using mrna and ESTs by Dr. J.
BLAST Exercise 2: Using mrna and EST Evidence in Annotation Adapted by W. Leung and SCR Elgin from Annotation Using mrna and ESTs by Dr. J. Buhler Prerequisites: BLAST Exercise: Detecting and Interpreting
More informationGrading Schemas. Blackboard Learn Grade Center
Grading Schemas Blackboard Learn Grade Center Creating a Grading Schema... 1 Editing a Grading Schema... 3 Deleting a Grading Schema... 4 Copying a Grading Schema... 5 Assigning a Grading Schema to a Grade
More informationWord Processing: Basic Skills
Word Processing: Basic Skills Name: Main: The purpose of this exercise is to practice the word processing skills that you will need to use each time you produce a "best effort" draft of writing on the
More informationPennsbury G-Mail Composing and Sending Messages Compose
Pennsbury G-Mail Composing and Sending Messages From the main screen, click on the Compose button to begin drafting a new message: The new message window will appear. Enter the subject of the email on
More informationEntering and Confirming Results in Match Centre
1 Summary of how to enter results: Log in to Match Centre Click on the two crossed over tennis racquets Click on Dashboard at the top right of the page Click on YOUR PREVIOUS MATCH : Click on VIEW SCORECARD
More informationRESEARCH TOPIC IN BIOINFORMANTIC
RESEARCH TOPIC IN BIOINFORMANTIC GENOME ASSEMBLY Instructor: Dr. Yufeng Wu Noted by: February 25, 2012 Genome Assembly is a kind of string sequencing problems. As we all know, the human genome is very
More informationDevelopment Authority of the North Country (DANC) Internet Mapping Application Instructions Public Viewer 1. Purpose. 2. Logging-in. 3.
Development Authority of the North Country (DANC) Internet Mapping Application Instructions Public Viewer 1. Purpose The purpose of this document is to outline basic functionality of the DANC Internet
More informationMicrosoft Office 2010: Introductory Q&As Access Chapter 3
Microsoft Office 2010: Introductory Q&As Access Chapter 3 Is the form automatically saved the way the report was created when I used the Report Wizard? (AC 142) No. You will need to take specific actions
More information2013 edition (version 1.1)
2013 edition (version 1.1) Contents 1 Introduction... 3 2 Signing in to your Office 365 account... 3 2.1 Acceptable Use Policy and Terms of Use... 4 3 Setting your profile and options... 4 3.1 Settings:
More informationSecondary Contact Wizard
Secondary Contact Wizard Usage: There are two functions in Secondary Contact Wizard: Demote a set of contacts to Secondary Contacts under one Primary Contact, or Mass Promote all Secondary Contacts from
More informationA sequence assembly and editing program for efficient management of large projects
1991 Oxford University Press Nucleic Acids Research, Vol. 19, No. 14 3907-3911 A sequence assembly and editing program for efficient management of large projects Simon Dear and Rodger Staden* MRC Laboratory
More informationHow to use the Advanced Copy/Paste tool in SynthFont2
How to use the Advanced Copy/Paste tool in SynthFont2 This tool lets you copy, paste, move delete blocks of MIDI events between tracks. You can display this tool by pressing the button Copy/Paste to the
More informationPRINTING GROWER FIELD MAPS OFF THE WEB
PRINTING GROWER FIELD MAPS OFF THE WEB 12-01-09 I. FREE map printing options: A. Google Earth: Pros Very easy to use; easy to print map (either directly or via extraction to Word); easy to scale up or
More informationTutorials. Lesson 3 Work with Text
In this lesson you will learn how to: Add a border and shadow to the title. Add a block of freeform text. Customize freeform text. Tutorials Display dates with symbols. Annotate a symbol using symbol text.
More informationUsing Tab Stops in Microsoft Word
Using Tab Stops in Microsoft Word U 720 / 1 How to Set Up and Use Tab Stops to Align and Position Text on a Page If you ve tried to use tab stops to align text in Microsoft Word, there s every chance you
More informationMy Top 5 Formulas OutofhoursAdmin
CONTENTS INTRODUCTION... 2 MS OFFICE... 3 Which Version of Microsoft Office Do I Have?... 4 How To Customise Your Recent Files List... 5 How to recover an unsaved file in MS Office 2010... 7 TOP 5 FORMULAS...
More information