CSE 111 Bio: Program Design I Lecture 4: Variables, Functions, Strings, Genbank
|
|
- Merryl Webster
- 5 years ago
- Views:
Transcription
1 CSE 111 Bio: Program Design I Lecture 4: Variables, Functions, Strings, Genbank Randall Munoe, XKCD Robert Sloan (CS) & Rachel Poretsky (Bio) University of Illinois, Chicago September 7, 2017
2 At end of this code, y will have what value? y = y = y * 2 A. 2 B. 6 C. 8 D. 12 E. This code will cause an error
3 Code x = 7 print(x) x = x + 1 print(x) y = x - 3 print(x) print(y) At the end of running this code, what will appear from the print statements in the execution window? D. This will cause an error E. I don t know A B C
4 Survey! Survey URL: CS 111 Green:
5 Alternate Problem if not taking survey: Evaluate in your head; check with computer when done: 1.5 ** * / / // // % % % % % % 7
6 Order of common binary operations Things in ()s first. Use ()s whenever you are in the slightest doubt Next ** (exponentiation) Next *, /, and // Lastly + and
7 Order of common operations Things in ()s first. Use ()s whenever you are in the slightest doubt Next ** (exponentiation) Next *, /, and // //?! Lastly + and
8 Division of integers: / vs. // Recall from reading that / is ordinary division, and // is floored division Does it work with integers?
9 What is printed print(6 + 1 * 3) A. 9 B. 21 C. Some other value
10 Brief first look at Functions Much more to come!
11 Defining your own functions def triple(x): return 3 * x Notice the indentation Done using tab and absolutely necessary! x triple 3 * x
12 Functions can have more than one line def triple(x): return 3 * x x triple 3 * x def triple(x) : myanswer = 3 * x return myanswer
13 Docstrings def triple(x): ''' Input is number x, returns 3*x ''' return 3 * x Teaching your program to talk to you Can access via help(triple); then type q to get back to main Python prompt 3 single or double quotes just fine (but watch out for editor trying to give you an even number like 4 marks!) Use docstrings!
14 Comments # Tripling program # Authors: Rachel and Bob # Date: August 52, 2017 def triple(x): ''' Input is number x, returns 3*x ''' # Comments begin with a hash mark return 3 * x
15 Which of these Python 3 programs will print out an "A"? def print_a(): '''I claim to print A''' print("a") A def print_a(): '''I claim to print A''' print "A" B def print_a(): '''I claim to print A''' print("b") C D. None of the above
16 Strings, strings, strings!
17 Strings Are really key data type for many parts of biology DNA sequences: Monster long strings of A's, C's, T's, and G's Protein: Monster long sequence of amino acids. For computation, the 20 amino acids are each represented as a string More later
18 Python awesome language for working with strings Python happy to have strings in 'these' or "these" or even '''these''', making it much simpler to deal with embedded quote characters such as '''I t has been disputed at what period of time the causes of variability, whatever they may be, generally act; whether during the early or late period of development of the embryo, or at the instant of conception. Geoffroy St Hilaire's experiments show that unnatural treatment of the embryo causes monstrosities; and monstrosities cannot be separated by any clear line of distinction from mere variations..''' Python can handle carriage returns in strings
19 paragraph1 = ''' WHEN we look to the individuals of the same variety or subvariety of our older cultivated plants and animals, one of the first points which strikes us, is, that they generally differ much more from each other, than do the individuals of any one species or variety in a state of nature. When we reflect on the vast diversity of the plants and animals which have been cultivated, and which have varied during all ages under the most different climates and treatment, I think we are driven to conclude that this greater variability is simply due to our domestic productions having been raised under conditions of life not so uniform as, and somewhat different from, those to which the parentspecies have been exposed under nature. There is, also, I think, some probability in the view propounded by Andrew Knight, that this variability may be partly connected with excess of food. It seems pretty clear that organic beings must be exposed during several generations to the new conditions of life to cause any appreciable amount of variation; and that when the organisation has once begun to vary, it generally continues to vary for many generations. No case is on record of a variable being ceasing to be variable under cultivation. Our oldest cultivated plants, such as wheat, still often yield new varieties: our oldest domesticated animals are still capable of rapid improvement or modification..'''
20 String String: any sequence of characters enclosed in single, double, or triple quotes Beginning and ending quote marks need to match Can use either 3 single quotes ''' or 3 double quotes for triple quotes Convention: Docstrings are in triple quotes Example of a sequence Other important kind of sequence is list (coming soon)
21 Which is a valid Python string? A. "Admiral Grace Hopper" B. "Admiral Grace Hopper' C. Admiral Grace Hopper D. "Admiral Grace Hopper' " E. Both A and D
22 Things we can do with strings Find their length, using the built-in Python function len In [1]: my_dna="aatgccgtgctt" In [2]: len(my_dna) Out[2]: 12 In [3]: len("hi there") Out[3]: 8 String arithmetic: + à concatenation; * à repeat (as we saw last time) In [4]: "The DNA string we're working with is: " + my_dna Out[4]: The DNA string we're working with is: AATGCCGTGCTT' In [5]: 2 * my_dna Out[5]: ' AATGCCGTGCTTAATGCCGTGCTT'
23 Arithmetic limited to + and integer * >>> my_dna / 1 Traceback (most recent call last): File "<stdin>", line 1, in <module> TypeError: unsupported operand type(s) for /: 'str' and 'int' >>> 3.0 * my_dna Also Barf Importance of types: floats are not integers, and multiplication of int by string makes some sense, but multiplication of float by string makes no sense
24 Using strings: slicing (first look) >>> mydna = "AATGCCGTGCTT" A A T G C C G T G C T T >>> mydna[0:4] 'AATG' >>> mydna[3:7] 'GCCG
25 Introduction to GenBank GenBank is a public database of nucleotide sequences and supporting information It is hosted at the National Center for Biotechnology Information (NCBI), associated with the US National Institutes of Health (NIH)
26 Introduction to GenBank or
27
CSE 111 Bio: Program Design I Lecture 5: More Strings, Intro Lists, Translation & Central Dogma of Biology
CSE 111 Bio: Program Design I Lecture 5: More Strings, Intro Lists, Translation & Central Dogma of Biology Robert Sloan (CS) & Rachel Poretsky (Bio) University of Illinois, Chicago September 12, 2017 What
More informationCSE 111 Bio: Program Design I Lecture 3: Python Basics & More Bio
Theresa McCracken @McHumor.com CSE 111 Bio: Program Design I Lecture 3: Python Basics & More Bio Robert Sloan (CS) & Rachel Poretsky (Bio) University of Illinois, Chicago August 31, 2017 DNA sequencing
More informationCSE 111 Bio: Program Design I Lecture 13: BLAST, while loops. Bob Sloan (CS) & Rachel Poretsky (Bio) University of Illinois, Chicago October 10, 2017
CSE 111 Bio: Program Design I Lecture 13: BLAST, while loops Bob Sloan (CS) & Rachel Poretsky (Bio) University of Illinois, Chicago October 10, 2017 Grace Hopper Celebration of Women in Computing Apply
More informationNot-So-Mini-Lecture 6. Modules & Scripts
Not-So-Mini-Lecture 6 Modules & Scripts Interactive Shell vs. Modules Launch in command line Type each line separately Python executes as you type Write in a code editor We use Atom Editor But anything
More informationPython Programming. Introduction Part II
Python Programming Introduction Part II Type Conversion One data type > another data type Example: int > float, int > string. >>> a = 5.5 >>> b = int(a) >>> print(b) 5 >>>> print(a) 5.5 Conversion from
More informationPractical Programming, 2nd Edition
Extracted from: Practical Programming, 2nd Edition An Introduction to Computer Science Using Python 3 This PDF file contains pages extracted from Practical Programming, 2nd Edition, published by the Pragmatic
More informationENGR 101 Engineering Design Workshop
ENGR 101 Engineering Design Workshop Lecture 2: Variables, Statements/Expressions, if-else Edgardo Molina City College of New York Literals, Variables, Data Types, Statements and Expressions Python as
More information\n is used in a string to indicate the newline character. An expression produces data. The simplest expression
Chapter 1 Summary Comments are indicated by a hash sign # (also known as the pound or number sign). Text to the right of the hash sign is ignored. (But, hash loses its special meaning if it is part of
More informationLecture 4. Defining Functions
Lecture 4 Defining Functions Academic Integrity Quiz Reading quiz about the course AI policy Go to http://www.cs.cornell.edu/courses/cs11110/ Click Academic Integrity in side bar Read and take quiz in
More informationGetting Started Values, Expressions, and Statements CS GMU
Getting Started Values, Expressions, and Statements CS 112 @ GMU Topics where does code go? values and expressions variables and assignment 2 where does code go? we can use the interactive Python interpreter
More informationCSE 111 Bio: Program Design I Lecture7: Condi/onal statements, genes and metabolism
CSE 111 Bio: Program Design I Lecture7: Condi/onal statements, genes and metabolism Robert Sloan (CS) & Rachel Poretsky (Bio) University of Illinois, Chicago September 19, 2017 return vs. print example
More informationMEIN 50010: Python Introduction
: Python Fabian Sievers Higgins Lab, Conway Institute University College Dublin Wednesday, 2017-10-04 Outline Goals Teach basic programming concepts Apply these concepts using Python Use Python Packages
More informationAt full speed with Python
At full speed with Python João Ventura v0.1 Contents 1 Introduction 2 2 Installation 3 2.1 Installing on Windows............................ 3 2.2 Installing on macos............................. 5 2.3
More informationCS177 Python Programming. Recitation 2 - Computing with Numbers
CS177 Python Programming Recitation 2 - Computing with Numbers Outline Data types. Variables Math library. Range Function What is data (in the context of programming)? Values that are stored and manipulated
More informationCOMP 204: Sets, Commenting & Exceptions
COMP 204: Sets, Commenting & Exceptions Yue Li based on material from Mathieu Blanchette, Carlos Oliver Gonzalez and Christopher Cameron 1/29 Outline Quiz 14 review Set Commenting code Bugs 2/29 Quiz 15
More information61A Lecture 2. Friday, August 28, 2015
61A Lecture 2 Friday, August 28, 2015 Names, Assignment, and User-Defined Functions (Demo) Types of Expressions Primitive expressions: 2 add 'hello' Number or Numeral Name String Call expressions: max
More informationIntroduction to Python (All the Basic Stuff)
Introduction to Python (All the Basic Stuff) 1 Learning Objectives Python program development Command line, IDEs, file editing Language fundamentals Types & variables Expressions I/O Control flow Functions
More informationIntroduction to Python Code Quality
Introduction to Python Code Quality Clarity and readability are important (easter egg: type import this at the Python prompt), as well as extensibility, meaning code that can be easily enhanced and extended.
More informationGetting Started with Python
Fundamentals of Programming (Python) Getting Started with Python Sina Sajadmanesh Sharif University of Technology Some slides have been adapted from Python Programming: An Introduction to Computer Science
More informationExpressions. Eric Roberts Handout #3 CSCI 121 January 30, 2019 Expressions. Grace Murray Hopper. Arithmetic Expressions.
Eric Roberts Handout #3 CSCI 121 January 30, 2019 Expressions Grace Murray Hopper Expressions Eric Roberts CSCI 121 January 30, 2018 Grace Hopper was one of the pioneers of modern computing, working with
More informationFun with functions! Built-in and user-defined functions
Fun with functions! A function is a block of code that performs a single action that can be reused indefinitely. They provide a great way of breaking code into smaller reusable pieces. And they're fun!
More informationCS 141, Lecture 3. Please login to the Math/Programming profile, and look for IDLE (3.4 or the unnumbered. <-- fine <-- fine <-- broken
CS 141, Lecture 3 Please login to the Math/Programming profile, and look for IDLE (3.4 or the unnumbered one are fine)
More informationControl Structures 1 / 17
Control Structures 1 / 17 Structured Programming Any algorithm can be expressed by: Sequence - one statement after another Selection - conditional execution (not conditional jumping) Repetition - loops
More informationPython Class-Lesson1 Instructor: Yao
Python Class-Lesson1 Instructor: Yao What is Python? Python is an interpreted, object-oriented, high-level programming language with dynamic semantics. Its high-level built in data structures, combined
More informationChapter 3 : Informatics Practices. Class XI ( As per CBSE Board) Python Fundamentals. Visit : python.mykvs.in for regular updates
Chapter 3 : Informatics Practices Class XI ( As per CBSE Board) Python Fundamentals Introduction Python 3.0 was released in 2008. Although this version is supposed to be backward incompatibles, later on
More informationLecture 4: Basic I/O
Lecture 4: Basic I/O CS1068+ Introductory Programming in Python Dr Kieran T. Herley Department of Computer Science University College Cork 2017-2018 KH (21/09/17) Lecture 4: Basic I/O 2017-2018 1 / 20
More informationFundamentals of Programming (Python) Getting Started with Programming
Fundamentals of Programming (Python) Getting Started with Programming Ali Taheri Sharif University of Technology Some slides have been adapted from Python Programming: An Introduction to Computer Science
More informationPython for Non-programmers
Python for Non-programmers A Gentle Introduction 1 Yann Tambouret Scientific Computing and Visualization Information Services & Technology Boston University 111 Cummington St. yannpaul@bu.edu Winter 2013
More informationCOMP 204: Sets, Commenting & Exceptions
COMP 204: Sets, Commenting & Exceptions Material from Carlos G. Oliver, Christopher J.F. Cameron October 12, 2018 1/31 Reminder CSUS is holding a midterm review session on Monday, October 15th, from 6-9pm.
More informationChapter 1 Summary. Chapter 2 Summary. end of a string, in which case the string can span multiple lines.
Chapter 1 Summary Comments are indicated by a hash sign # (also known as the pound or number sign). Text to the right of the hash sign is ignored. (But, hash loses its special meaning if it is part of
More informationIntroduction to Computation for the Humanities and Social Sciences. CS 3 Chris Tanner
Introduction to Computation for the Humanities and Social Sciences CS 3 Chris Tanner Lecture 4 Python: Variables, Operators, and Casting Lecture 4 [People] need to learn code, man I m sick with the Python.
More informationLecture 3. Functions & Modules
Lecture 3 Functions & Modules Labs this Week Lab 1 is due at the beginning of your lab If it is not yet by then, you cannot get credit Only exception is for students who added late (Those students should
More informationA Brief Introduction to Python
A Brief Introduction to Python Python is an interpreted language, meaning that a program, i.e., the interpreter, is used to execute your commands one after the other. The commands can be entered interactively
More informationProfessor: Sana Odeh Lecture 3 Python 3.1 Variables, Primitive Data Types & arithmetic operators
1 Professor: Sana Odeh odeh@courant.nyu.edu Lecture 3 Python 3.1 Variables, Primitive Data Types & arithmetic operators Review What s wrong with this line of code? print( He said Hello ) What s wrong with
More informationFunctions and Decomposition
Unit 4 Functions and Decomposition Learning Outcomes Design and implement functions to carry out a particular task. Begin to evaluate when it is necessary to split some work into functions. Locate the
More informationCMPT 120 Basics of Python. Summer 2012 Instructor: Hassan Khosravi
CMPT 120 Basics of Python Summer 2012 Instructor: Hassan Khosravi Python A simple programming language to implement your ideas Design philosophy emphasizes code readability Implementation of Python was
More informationInteractive use. $ python. >>> print 'Hello, world!' Hello, world! >>> 3 $ Ctrl-D
1/60 Interactive use $ python Python 2.7.5 (default, Mar 9 2014, 22:15:05) [GCC 4.2.1 Compatible Apple LLVM 5.0 (clang-500.0.68)] on darwin Type "help", "copyright", "credits" or "license" for more information.
More informationHow To Think Like A Computer Scientist, chapter 3; chapter 6, sections
6.189 Day 3 Today there are no written exercises. Turn in your code tomorrow, stapled together, with your name and the file name in comments at the top as detailed in the Day 1 exercises. Readings How
More informationA Little Python Part 1. Introducing Programming with Python
A Little Python Part 1 Introducing Programming with Python Preface Not a complete course in a programming language Many details can t be covered Need to learn as you go My programming style is not considered
More informationChapter 2 Getting Started with Python
Chapter 2 Getting Started with Python Introduction Python Programming language was developed by Guido Van Rossum in February 1991. It is based on or influenced with two programming languages: 1. ABC language,
More informationPRG PROGRAMMING ESSENTIALS. Lecture 2 Program flow, Conditionals, Loops
PRG PROGRAMMING ESSENTIALS 1 Lecture 2 Program flow, Conditionals, Loops https://cw.fel.cvut.cz/wiki/courses/be5b33prg/start Michal Reinštein Czech Technical University in Prague, Faculty of Electrical
More informationAnnouncements for this Lecture
Lecture 6 Objects Announcements for this Lecture Last Call Quiz: About the Course Take it by tomorrow Also remember survey Assignment 1 Assignment 1 is live Posted on web page Due Thur, Sep. 18 th Due
More informationHere n is a variable name. The value of that variable is 176.
UNIT II DATA, EXPRESSIONS, STATEMENTS 9 Python interpreter and interactive mode; values and types: int, float, boolean, string, and list; variables, expressions, statements, tuple assignment, precedence
More informationConstants. Variables, Expressions, and Statements. Variables. x = 12.2 y = 14 x = 100. Chapter
Variables, Expressions, and Statements Chapter 2 Unless otherwise noted, the content of this course material is licensed under a Creative Commons Attribution 3.0 License. http://creativecommons.org/licenses/by/3.0/.
More informationCSE 111 Bio: Program Design I Lecture 12: more loops, files. Bob Sloan (CS) & Rachel Poretsky (Bio) University of Illinois, Chicago October 5, 201u
CSE 111 Bio: Program Design I Lecture 12: more loops, files Bob Sloan (CS) & Rachel Poretsky (Bio) University of Illinois, Chicago October 5, 201u LogisIcs Notes: Reading Reminder: Reading for class are
More informationIntro to Programming. Unit 7. What is Programming? What is Programming? Intro to Programming
Intro to Programming Unit 7 Intro to Programming 1 What is Programming? 1. Programming Languages 2. Markup vs. Programming 1. Introduction 2. Print Statement 3. Strings 4. Types and Values 5. Math Externals
More informationInteractive use. $ python. >>> print 'Hello, world!' Hello, world! >>> 3 $ Ctrl-D
1/58 Interactive use $ python Python 2.7.5 (default, Mar 9 2014, 22:15:05) [GCC 4.2.1 Compatible Apple LLVM 5.0 (clang-500.0.68)] on darwin Type "help", "copyright", "credits" or "license" for more information.
More informationBasic Data Types and Operators CS 8: Introduction to Computer Science, Winter 2019 Lecture #2
Basic Data Types and Operators CS 8: Introduction to Computer Science, Winter 2019 Lecture #2 Ziad Matni, Ph.D. Dept. of Computer Science, UCSB Your Instructor Your instructor: Ziad Matni, Ph.D(zee-ahd
More informationSpring 2017 CS 1110/1111 Exam 1
CS 1110/1111 Spring 2017 Exam 1 page 1 of 6 Spring 2017 CS 1110/1111 Exam 1 Bubble in your computing ID in the footer of this page. We use an optical scanner to read it, so fill in the bubbles darkly.
More informationage = 23 age = age + 1 data types Integers Floating-point numbers Strings Booleans loosely typed age = In my 20s
Intro to Python Python Getting increasingly more common Designed to have intuitive and lightweight syntax In this class, we will be using Python 3.x Python 2.x is still very popular, and the differences
More informationCS2304: Python for Java Programmers. CS2304: Sequences and Collections
CS2304: Sequences and Collections Sequences In Python A sequence type in python supports: The in membership operator. The len() function. Slicing like we saw with strings, s[1:3]. And is iterable (for
More informationENGG1811 Computing for Engineers Week 1 Introduction to Programming and Python
ENGG1811 Computing for Engineers Week 1 Introduction to Programming and Python ENGG1811 UNSW, CRICOS Provider No: 00098G W4 Computers have changed engineering http://www.noendexport.com/en/contents/48/410.html
More informationLecture 3. Input, Output and Data Types
Lecture 3 Input, Output and Data Types Goals for today Variable Types Integers, Floating-Point, Strings, Booleans Conversion between types Operations on types Input/Output Some ways of getting input, and
More information7. (2 pts) str( str( b ) ) str '4' will not compile (single, double, or triple quotes
For the following questions, use these variable definitions a = 45 b = 4 c = 39999 d = "7" What is the value and type of each of the following expressions or, if it won't compile, circle that answer type
More informationIntroduction to Scientific Python, CME 193 Jan. 9, web.stanford.edu/~ermartin/teaching/cme193-winter15
1 LECTURE 1: INTRO Introduction to Scientific Python, CME 193 Jan. 9, 2014 web.stanford.edu/~ermartin/teaching/cme193-winter15 Eileen Martin Some slides are from Sven Schmit s Fall 14 slides 2 Course Details
More informationProgramming in Python 3
Programming in Python 3 Programming transforms your computer from a home appliance to a power tool Al Sweigart, The invent with Python Blog Programming Introduction Write programs that solve a problem
More informationPython Intro GIS Week 1. Jake K. Carr
GIS 5222 Week 1 Why Python It s simple and easy to learn It s free - open source! It s cross platform IT S expandable!! Why Python: Example Consider having to convert 1,000 shapefiles into feature classes
More informationCSE : Python Programming. Homework 5 and Projects. Announcements. Course project: Overview. Course Project: Grading criteria
CSE 399-004: Python Programming Lecture 5: Course project and Exceptions February 12, 2007 Announcements Still working on grading Homeworks 3 and 4 (and 2 ) Homework 5 will be out by tomorrow morning I
More informationIntro to AI & Intro to Python
CS311: Artificial Intelligence Intro to AI & Intro to Python CS311 David Kauchak Spring 2013 http://www.bbspot.com/comics/pc-weenies/2008/02/3248.php Adapted from notes from: Sara Owsley Sood Who are you
More informationfrom scratch A primer for scientists working with Next-Generation- Sequencing data Chapter 1 Text output and manipulation
from scratch A primer for scientists working with Next-Generation- Sequencing data Chapter 1 Text output and manipulation Chapter 1: text output and manipulation In this unit you will learn how to write
More informationVariables, Expressions, and Statements
Variables, Expressions, and Statements Chapter 2 Python for Informatics: Exploring Information www.pythonlearn.com Constants Fixed values such as numbers, letters, and strings are called constants because
More informationCSC 148 Lecture 3. Dynamic Typing, Scoping, and Namespaces. Recursion
CSC 148 Lecture 3 Dynamic Typing, Scoping, and Namespaces Recursion Announcements Python Ramp Up Session Monday June 1st, 1 5pm. BA3195 This will be a more detailed introduction to the Python language
More informationA simple interpreted language
Copyright Software Carpentry 2010 This work is licensed under the Creative Commons Attribution License See http://software-carpentry.org/license.html for more information. A simple interpreted language
More informationCIS192 Python Programming. Robert Rand. August 27, 2015
CIS192 Python Programming Introduction Robert Rand University of Pennsylvania August 27, 2015 Robert Rand (University of Pennsylvania) CIS 192 August 27, 2015 1 / 30 Outline 1 Logistics Grading Office
More informationLecture 3. Functions & Modules
Lecture 3 Functions & Modules Labs this Week Lab 1 is due at the beginning of your lab If it is not yet by then, you cannot get credit Only exception is for students who added late (Those students should
More informationCS 1110 Prelim 2 November 6th, 2012
CS 1110 Prelim 2 November 6th, 2012 This 90-minute exam has 6 questions worth a total of 100 points. Scan the whole test before starting. Budget your time wisely. Use the back of the pages if you need
More informationPython for Analytics. Python Fundamentals RSI Chapters 1 and 2
Python for Analytics Python Fundamentals RSI Chapters 1 and 2 Learning Objectives Theory: You should be able to explain... General programming terms like source code, interpreter, compiler, object code,
More informationBCH339N Systems Biology/Bioinformatics Spring 2018 Marcotte A Python programming primer
BCH339N Systems Biology/Bioinformatics Spring 2018 Marcotte A Python programming primer Python: named after Monty Python s Flying Circus (designed to be fun to use) Python documentation: http://www.python.org/doc/
More information1 Lecture 3: Python Variables and Syntax
L3 June 9, 2017 1 Lecture 3: Python Variables and Syntax CSCI 1360E: Foundations for Informatics and Analytics 1.1 Overview and Objectives In this lecture, we ll get into more detail on Python variables,
More informationLists How lists are like strings
Lists How lists are like strings A Python list is a new type. Lists allow many of the same operations as strings. (See the table in Section 4.6 of the Python Standard Library Reference for operations supported
More informationCSCI 121: Anatomy of a Python Script
CSCI 121: Anatomy of a Python Script Python Scripts We start by a Python script: A text file containing lines of Python code. Each line is a Python statement. The Python interpreter (the python3 command)
More informationLecture 3: Functions & Modules (Sections ) CS 1110 Introduction to Computing Using Python
http://www.cs.cornell.edu/courses/cs1110/2019sp Lecture 3: Functions & Modules (Sections 3.1-3.3) CS 1110 Introduction to Computing Using Python [E. Andersen, A. Bracy, D. Gries, L. Lee, S. Marschner,
More information06/11/2014. Subjects. CS Applied Robotics Lab Gerardo Carmona :: makeroboticsprojects.com June / ) Beginning with Python
CS95003 - Applied Robotics Lab Gerardo Carmona :: makeroboticsprojects.com June / 2014 Subjects 1) Beginning with Python 2) Variables 3) Strings 4) Basic arithmetic operators 5) Flow control 6) Comparison
More informationIntroductory Linux Course. Python I. Martin Dahlö UPPMAX. Author: Nina Fischer. Dept. for Cell and Molecular Biology, Uppsala University
Introductory Linux Course Martin Dahlö UPPMAX Author: Nina Fischer Dept. for Cell and Molecular Biology, Uppsala University August, 2018 Outline Python basics get started with Python Data types Control
More informationPython: common syntax
Lab 09 Python! Python Intro Main Differences from C++: True and False are capitals Python floors (always down) with int division (matters with negatives): -3 / 2 = -2 No variable data types or variable
More informationAnnouncements. Project 2 due next Monday. Next Tuesday is review session; Midterm 1 on Wed., EE 129, 8:00 9:30pm
Project 2 due next Monday Next Tuesday is review session; Announcements Midterm 1 on Wed., EE 129, 8:00 9:30pm Project 3 to be posted Oct. 3 (next Wed) Preparing for the Midterm: Review Chapters 3-6 of
More informationDecisions, Decisions. Testing, testing C H A P T E R 7
C H A P T E R 7 In the first few chapters, we saw some of the basic building blocks of a program. We can now make a program with input, processing, and output. We can even make our input and output a little
More informationExpressions and Variables
Expressions and Variables Expressions print(expression) An expression is evaluated to give a value. For example: 2 + 9-6 Evaluates to: 5 Data Types Integers 1, 2, 3, 42, 100, -5 Floating points 2.5, 7.0,
More informationLecture 3: Functions & Modules
http://www.cs.cornell.edu/courses/cs1110/2018sp Lecture 3: Functions & Modules (Sections 3.1-3.3) CS 1110 Introduction to Computing Using Python [E. Andersen, A. Bracy, D. Gries, L. Lee, S. Marschner,
More informationLecture 1: Introduction to Python
Hendrik Weimer Institute for Theoretical Physics, Leibniz University Hannover Quantum Physics with Python, 04 April 2016 Goals of this course Learn to use the Python language for physics problems Master
More informationLogical Thinking through Computer Programming
Logical Thinking through Computer Programming Course Objectives To empower students. September 2, 2016 - September 23, 2016 Men s Honor Farm To elevate the technical literacy of the students. To help students
More informationPYTHON- AN INNOVATION
PYTHON- AN INNOVATION As per CBSE curriculum Class 11 Chapter- 2 By- Neha Tyagi PGT (CS) KV 5 Jaipur(II Shift) Jaipur Region Python Introduction In order to provide an input, process it and to receive
More informationCSCE 110 Programming I
CSCE 110 Programming I Basics of Python (Part 1): Variables, Expressions, and Input/Output Dr. Tiffani L. Williams Department of Computer Science and Engineering Texas A&M University Spring 2013 Tiffani
More informationGetting Started. Excerpted from Hello World! Computer Programming for Kids and Other Beginners
Getting Started Excerpted from Hello World! Computer Programming for Kids and Other Beginners EARLY ACCESS EDITION Warren D. Sande and Carter Sande MEAP Release: May 2008 Softbound print: November 2008
More informationIntroductory Linux Course. Python I. Pavlin Mitev UPPMAX. Author: Nina Fischer Dept. for Cell and Molecular Biology, Uppsala University
Introductory Linux Course Python I Pavlin Mitev UPPMAX Author: Nina Fischer Dept. for Cell and Molecular Biology, Uppsala University August, 2017 Outline Python introduction Python basics get started with
More informationCS 112 Introduction to Computing II. Wayne Snyder Computer Science Department Boston University
CS 112 Introduction to Computing II Wayne Snyder Department Boston University Today: Java basics: Compilation vs Interpretation Program structure Statements Values Variables Types Operators and Expressions
More informationLecture 10: Lists and Sequences
http://www.cs.cornell.edu/courses/cs/8sp Lecture : Lists and Sequences (Sections.-.,.4-.6,.8-.) CS Introduction to Computing Using Python [E. Andersen, A. Bracy, D. Gries, L. Lee, S. Marschner, C. Van
More informationIntroduction to Python
Introduction to Python Reading assignment: Perkovic text, Ch. 1 and 2.1-2.5 Python Python is an interactive language. Java or C++: compile, run Also, a main function or method Python: type expressions
More informationVariables, expressions and statements
Variables, expressions and statements 2.1. Values and data types A value is one of the fundamental things like a letter or a number that a program manipulates. The values we have seen so far are 2 (the
More informationReview for the Final Exam CS 8: Introduction to Computer Science, Winter 2018 Lecture #15
Review for the Final Exam CS 8: Introduction to Computer Science, Winter 2018 Lecture #15 Ziad Matni Dept. of Computer Science, UCSB Administrative Project #2 is DUE on FRIDAY no late submissions accepted
More informationAbstract Data Types. CS 234, Fall Types, Data Types Abstraction Abstract Data Types Preconditions, Postconditions ADT Examples
Abstract Data Types CS 234, Fall 2017 Types, Data Types Abstraction Abstract Data Types Preconditions, Postconditions ADT Examples Data Types Data is stored in a computer as a sequence of binary digits:
More informationIntroduction to Computers. Laboratory Manual. Experiment #3. Elementary Programming, II
Think Twice Code Once The Islamic University of Gaza Engineering Faculty Department of Computer Engineering Fall 2017 LNGG 1003 Khaleel I. Shaheen Introduction to Computers Laboratory Manual Experiment
More informationPython The way of a program. Srinidhi H Asst Professor Dept of CSE, MSRIT
Python The way of a program Srinidhi H Asst Professor Dept of CSE, MSRIT 1 Problem Solving Problem solving means the ability to formulate problems, think creatively about solutions, and express a solution
More informationCIS192: Python Programming
CIS192: Python Programming Introduction Harry Smith University of Pennsylvania January 18, 2017 Harry Smith (University of Pennsylvania) CIS 192 Lecture 1 January 18, 2017 1 / 34 Outline 1 Logistics Rooms
More informationLecture 2: Variables & Assignments
http://www.cs.cornell.edu/courses/cs1110/2018sp Lecture 2: Variables & Assignments (Sections 2.1-2.3,2.5) CS 1110 Introduction to Computing Using Python [E. Andersen, A. Bracy, D. Gries, L. Lee, S. Marschner,
More informationPython Programming Exercises 1
Python Programming Exercises 1 Notes: throughout these exercises >>> preceeds code that should be typed directly into the Python interpreter. To get the most out of these exercises, don t just follow them
More informationCSSE 120 Introduction to Software Development Practice for Test 1 paper-and-pencil part Page 1 of 6
CSSE 120 Introduction to Software Development Practice for Test 1 paper-and-pencil part Page 1 of 6 Name: Use this quiz to help you prepare for the Paper-and-Pencil portion of Test 1. Complete it electronically
More informationHello World! Computer Programming for Kids and Other Beginners. Chapter 1. by Warren Sande and Carter Sande. Copyright 2009 Manning Publications
Hello World! Computer Programming for Kids and Other Beginners by Warren Sande and Carter Sande Chapter 1 Copyright 2009 Manning Publications brief contents Preface xiii Acknowledgments xix About this
More informationPython 1: Intro! Max Dougherty Andrew Schmitt
Python 1: Intro! Max Dougherty Andrew Schmitt Computational Thinking Two factors of programming: The conceptual solution to a problem. Solution syntax in a programming language BJC tries to isolate and
More informationComp 151. More on Arithmetic and intro to Objects
Comp 151 More on Arithmetic and intro to Objects Admin Any questions 2 The Project Lets talk about the project. What do you need A 'accumulator' variable. Start outside of the loop Lets look at your book's
More information