Bioinformatics Services for HT Sequencing
|
|
- Lindsey Skinner
- 6 years ago
- Views:
Transcription
1 Bioinformatics Services for HT Sequencing Tyler Backman, Rebecca Sun, Thomas Girke December 19, 2008 Bioinformatics Services for HT Sequencing Slide 1/18
2 Introduction People Service Overview and Rates Resources Hardware Web Site: Sample Submission and Data Download Data Analysis and Software Bioinformatics Services for HT Sequencing Slide 2/18
3 Bioinformatics Service Team Rebecca Sun - Bioinformatics Data Analyst Tyler Backman - Bioinformatics Data Analyst Thomas Girke - The one to blame... Bioinformatics Services for HT Sequencing People Slide 3/18
4 Bioinformatics Services Most time consuming part of HT sequencing projects Most analysis steps can only be handled by powerful servers! Facility provides a wide spectrum of data analysis and pipeline development services for: Primary data analyses Custom data analyses Due to the wide spectrum of data analysis options for the specific needs of each project, we strongly recommend to discuss them in a meeting with the bioinformatics staff. Bioinformatics Services for HT Sequencing Service Overview and Rates Slide 4/18
5 Service Overview Primary data analysis QC of sequencing run Quality filtering and adaptor trimming Basic mapping to reference genome Access to externally and internally developed analysis pipelines and packages Available upon request Online genome browser support Web BLAST server support Custom data analysis Comprehensive custom analysis: annotations, mapping, predictions etc. Specialty algorithms for base calling, alignment, etc. Detailed data analysis reports Statistical analysis Any custom request if reasonable Bioinformatics Services for HT Sequencing Service Overview and Rates Slide 5/18
6 Bioinformatics Service Rates General charges Sequence/quality control: no cost Sequencing run storage on tapes: included in sequencing run Online genome browser and BLAST server support: standard hourly rate (see below) Rates for custom data analysis 1 week projects: $24/hr 1-2 week project: $18/hr Projects >2 weeks: $12/hr Bioinformatics Services for HT Sequencing Service Overview and Rates Slide 6/18
7 Technical Overview Data processed on and served from 16 cpu Linux server Images and sequences archived on tape and RAID array Extended analysis on 256 cpu Linux cluster Bioinformatics Services for HT Sequencing Hardware Slide 7/18
8 HT Sequencing Web Site Submit sequencing projects (collections of samples) View QC reports Download data Obtain additional information on sequencing and data analysis Bioinformatics Services for HT Sequencing Hardware Slide 8/18
9 HT Sequencing Web Site: Navigation Bioinformatics Services for HT Sequencing Web Site: Sample Submission and Data Download Slide 9/18
10 HT Sequencing Web Site: Sample Submission Bioinformatics Services for HT Sequencing Web Site: Sample Submission and Data Download Slide 10/18
11 HT Sequencing Web Site: Sample Details Key/Value pairs describe each sample for future reference Bioinformatics Services for HT Sequencing Web Site: Sample Submission and Data Download Slide 11/18
12 Illumina Pipeline Other tools are available for base calling, alignment, and downstream analysis Bioinformatics Services for HT Sequencing Data Analysis and Software Slide 12/18
13 Flowcell Quality Report Shows read yield and quality Bioinformatics Services for HT Sequencing Data Analysis and Software Slide 13/18
14 HT Sequencing Web Site: Downloading Data Data is provided in many formats Bioinformatics Services for HT Sequencing Data Analysis and Software Slide 14/18
15 Data Formats for Illumina Reads Format Description fastaq sequence text file quality score text file sequences and ASCII quality scores sequences and numeric quality scores Detailed quality scores (4 per base) Sample sequence text file Bioinformatics Services for HT Sequencing Data Analysis and Software Slide 15/18
16 Anno-J Genome Browser Excellent performance for large datasets Bioinformatics Services for HT Sequencing Data Analysis and Software Slide 16/18
17 GBrowse Genome Browser Flexible visualization options Bioinformatics Services for HT Sequencing Data Analysis and Software Slide 17/18
18 Useful Bioinformatic Tools Type Base Calling Alignment Quality Control Digital Gene Expression (DGE) Software Packages Bustard, Alta-Cyclic, Rolexa Eland, Soap, Maq, Bowtie, Novoalign TileQC, BioConductor ShortRead edger Download links on HT Sequencing Site Bioinformatics Services for HT Sequencing Data Analysis and Software Slide 18/18
SolexaLIMS: A Laboratory Information Management System for the Solexa Sequencing Platform
SolexaLIMS: A Laboratory Information Management System for the Solexa Sequencing Platform Brian D. O Connor, 1, Jordan Mendler, 1, Ben Berman, 2, Stanley F. Nelson 1 1 Department of Human Genetics, David
More informationGalaxy workshop at the Winter School Igor Makunin
Galaxy workshop at the Winter School 2016 Igor Makunin i.makunin@uq.edu.au Winter school, UQ, July 6, 2016 Plan Overview of the Genomics Virtual Lab Introduce Galaxy, a web based platform for analysis
More information!"#$%&$'()#$*)+,-./).01"0#,23+3,303456"6,&((46,7$+-./&((468,
!"#$%&$'()#$*)+,-./).01"0#,23+3,303456"6,&((46,7$+-./&((468, 9"(1(02)1+(',:.;.4(*.',?9@A,!."2.4B.'#A,C(;.
More informationSequence Analysis Pipeline
Sequence Analysis Pipeline Transcript fragments 1. PREPROCESSING 2. ASSEMBLY (today) Removal of contaminants, vector, adaptors, etc Put overlapping sequence together and calculate bigger sequences 3. Analysis/Annotation
More informationSEASHORE / SARUMAN. Short Read Matching using GPU Programming. Tobias Jakobi
SEASHORE SARUMAN Summary 1 / 24 SEASHORE / SARUMAN Short Read Matching using GPU Programming Tobias Jakobi Center for Biotechnology (CeBiTec) Bioinformatics Resource Facility (BRF) Bielefeld University
More informationHigh-throughput sequencing: Alignment and related topic. Simon Anders EMBL Heidelberg
High-throughput sequencing: Alignment and related topic Simon Anders EMBL Heidelberg Established platforms HTS Platforms Illumina HiSeq, ABI SOLiD, Roche 454 Newcomers: Benchtop machines 454 GS Junior,
More informationHow to store and visualize RNA-seq data
How to store and visualize RNA-seq data Gabriella Rustici Functional Genomics Group gabry@ebi.ac.uk EBI is an Outstation of the European Molecular Biology Laboratory. Talk summary How do we archive RNA-seq
More informationBioinformatics in next generation sequencing projects
Bioinformatics in next generation sequencing projects Rickard Sandberg Assistant Professor Department of Cell and Molecular Biology Karolinska Institutet March 2011 Once sequenced the problem becomes computational
More informationHigh-throughput sequencing: Alignment and related topic. Simon Anders EMBL Heidelberg
High-throughput sequencing: Alignment and related topic Simon Anders EMBL Heidelberg Established platforms HTS Platforms Illumina HiSeq, ABI SOLiD, Roche 454 Newcomers: Benchtop machines: Illumina MiSeq,
More informationBioinformatics for High-throughput Sequencing
Bioinformatics for High-throughput Sequencing An Overview Simon Anders EBI is an Outstation of the European Molecular Biology Laboratory. Overview In recent years, new sequencing schemes, also called high-throughput
More informationNGS Data Visualization and Exploration Using IGV
1 What is Galaxy Galaxy for Bioinformaticians Galaxy for Experimental Biologists Using Galaxy for NGS Analysis NGS Data Visualization and Exploration Using IGV 2 What is Galaxy Galaxy for Bioinformaticians
More informationAnalyzing Variant Call results using EuPathDB Galaxy, Part II
Analyzing Variant Call results using EuPathDB Galaxy, Part II In this exercise, we will work in groups to examine the results from the SNP analysis workflow that we started yesterday. The first step is
More informationFusion Detection Using QIAseq RNAscan Panels
Fusion Detection Using QIAseq RNAscan Panels June 11, 2018 Sample to Insight QIAGEN Aarhus Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 www.qiagenbioinformatics.com ts-bioinformatics@qiagen.com
More informationITMO Ecole de Bioinformatique Hands-on session: smallrna-seq N. Servant 21 rd November 2013
ITMO Ecole de Bioinformatique Hands-on session: smallrna-seq N. Servant 21 rd November 2013 1. Data and objectives We will use the data from GEO (GSE35368, Toedling, Servant et al. 2011). Two samples were
More informationTutorial: De Novo Assembly of Paired Data
: De Novo Assembly of Paired Data September 20, 2013 CLC bio Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 Fax: +45 86 20 12 22 www.clcbio.com support@clcbio.com : De Novo Assembly
More informationResequencing Analysis. (Pseudomonas aeruginosa MAPO1 ) Sample to Insight
Resequencing Analysis (Pseudomonas aeruginosa MAPO1 ) 1 Workflow Import NGS raw data Trim reads Import Reference Sequence Reference Mapping QC on reads Variant detection Case Study Pseudomonas aeruginosa
More informationCLC Server. End User USER MANUAL
CLC Server End User USER MANUAL Manual for CLC Server 10.0.1 Windows, macos and Linux March 8, 2018 This software is for research purposes only. QIAGEN Aarhus Silkeborgvej 2 Prismet DK-8000 Aarhus C Denmark
More informationGene Expression Data Analysis. Qin Ma, Ph.D. December 10, 2017
1 Gene Expression Data Analysis Qin Ma, Ph.D. December 10, 2017 2 Bioinformatics Systems biology This interdisciplinary science is about providing computational support to studies on linking the behavior
More information4.1. Access the internet and log on to the UCSC Genome Bioinformatics Web Page (Figure 1-
1. PURPOSE To provide instructions for finding rs Numbers (SNP database ID numbers) and increasing sequence length by utilizing the UCSC Genome Bioinformatics Database. 2. MATERIALS 2.1. Sequence Information
More informationData: ftp://ftp.broad.mit.edu/pub/users/bhaas/rnaseq_workshop/rnaseq_workshop_dat a.tgz. Software:
A Tutorial: De novo RNA- Seq Assembly and Analysis Using Trinity and edger The following data and software resources are required for following the tutorial: Data: ftp://ftp.broad.mit.edu/pub/users/bhaas/rnaseq_workshop/rnaseq_workshop_dat
More informationRead Mapping. Slides by Carl Kingsford
Read Mapping Slides by Carl Kingsford Bowtie Ultrafast and memory-efficient alignment of short DNA sequences to the human genome Ben Langmead, Cole Trapnell, Mihai Pop and Steven L Salzberg, Genome Biology
More informationQIAseq Targeted RNAscan Panel Analysis Plugin USER MANUAL
QIAseq Targeted RNAscan Panel Analysis Plugin USER MANUAL User manual for QIAseq Targeted RNAscan Panel Analysis 0.5.2 beta 1 Windows, Mac OS X and Linux February 5, 2018 This software is for research
More informationAccessible, Transparent and Reproducible Analysis with Galaxy
Accessible, Transparent and Reproducible Analysis with Galaxy Application of Next Generation Sequencing Technologies for Whole Transcriptome and Genome Analysis ABRF 2013 Saturday, March 2, 2013 Palm Springs,
More informationHelpful Galaxy screencasts are available at:
This user guide serves as a simplified, graphic version of the CloudMap paper for applicationoriented end-users. For more details, please see the CloudMap paper. Video versions of these user guides and
More informationSequencing Data. Paul Agapow 2011/02/03
Webservices for Next Generation Sequencing Data Paul Agapow 2011/02/03 Aims Assumed parameters: Must have a system for non-technical users to browse and manipulate their Next Generation Sequencing (NGS)
More informationImporting your Exeter NGS data into Galaxy:
Importing your Exeter NGS data into Galaxy: The aim of this tutorial is to show you how to import your raw Illumina FASTQ files and/or assemblies and remapping files into Galaxy. As of 1 st July 2011 Illumina
More informationDifferential Expression Analysis at PATRIC
Differential Expression Analysis at PATRIC The following step- by- step workflow is intended to help users learn how to upload their differential gene expression data to their private workspace using Expression
More informationChIP-seq practical: peak detection and peak annotation. Mali Salmon-Divon Remco Loos Myrto Kostadima
ChIP-seq practical: peak detection and peak annotation Mali Salmon-Divon Remco Loos Myrto Kostadima March 2012 Introduction The goal of this hands-on session is to perform some basic tasks in the analysis
More informationMapping, Alignment and SNP Calling
Mapping, Alignment and SNP Calling Heng Li Broad Institute MPG Next Gen Workshop 2011 Heng Li (Broad Institute) Mapping, alignment and SNP calling 17 February 2011 1 / 19 Outline 1 Mapping Messages from
More informationTutorial. De Novo Assembly of Paired Data. Sample to Insight. November 21, 2017
De Novo Assembly of Paired Data November 21, 2017 Sample to Insight QIAGEN Aarhus Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 www.qiagenbioinformatics.com AdvancedGenomicsSupport@qiagen.com
More information1 Abstract. 2 Introduction. 3 Requirements
1 Abstract 2 Introduction This SOP describes the HMP Whole- Metagenome Annotation Pipeline run at CBCB. This pipeline generates a 'Pretty Good Assembly' - a reasonable attempt at reconstructing pieces
More informationIllumina Next Generation Sequencing Data analysis
Illumina Next Generation Sequencing Data analysis Chiara Dal Fiume Sr Field Application Scientist Italy 2010 Illumina, Inc. All rights reserved. Illumina, illuminadx, Solexa, Making Sense Out of Life,
More informationTutorial. Find Very Low Frequency Variants With QIAGEN GeneRead Panels. Sample to Insight. November 21, 2017
Find Very Low Frequency Variants With QIAGEN GeneRead Panels November 21, 2017 Sample to Insight QIAGEN Aarhus Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 www.qiagenbioinformatics.com
More informationUsing Pipeline Output Data for Whole Genome Alignment
Using Pipeline Output Data for Whole Genome Alignment FOR RESEARCH ONLY Topics 4 Introduction 4 Pipeline 4 Maq 4 GBrowse 4 Hardware Requirements 5 Workflow 6 Preparing to Run Maq 6 UNIX/Linux Environment
More informationAnalysis of high-throughput sequencing data. Simon Anders EBI
Analysis of high-throughput sequencing data Simon Anders EBI Outline Overview on high-throughput sequencing (HTS) technologies, focusing on Solexa's GenomAnalyzer as example Software requirements to works
More informationAnalysis of ChIP-seq data
Before we start: 1. Log into tak (step 0 on the exercises) 2. Go to your lab space and create a folder for the class (see separate hand out) 3. Connect to your lab space through the wihtdata network and
More informationNGS Data Analysis. Roberto Preste
NGS Data Analysis Roberto Preste 1 Useful info http://bit.ly/2r1y2dr Contacts: roberto.preste@gmail.com Slides: http://bit.ly/ngs-data 2 NGS data analysis Overview 3 NGS Data Analysis: the basic idea http://bit.ly/2r1y2dr
More informationRNA-seq. Manpreet S. Katari
RNA-seq Manpreet S. Katari Evolution of Sequence Technology Normalizing the Data RPKM (Reads per Kilobase of exons per million reads) Score = R NT R = # of unique reads for the gene N = Size of the gene
More informationAgilent Genomic Workbench Lite Edition 6.5
Agilent Genomic Workbench Lite Edition 6.5 SureSelect Quality Analyzer User Guide For Research Use Only. Not for use in diagnostic procedures. Agilent Technologies Notices Agilent Technologies, Inc. 2010
More informationIntroduction to Read Alignment. UCD Genome Center Bioinformatics Core Tuesday 15 September 2015
Introduction to Read Alignment UCD Genome Center Bioinformatics Core Tuesday 15 September 2015 From reads to molecules Why align? Individual A Individual B ATGATAGCATCGTCGGGTGTCTGCTCAATAATAGTGCCGTATCATGCTGGTGTTATAATCGCCGCATGACATGATCAATGG
More informationA generic and modular platform for automated sequence processing and annotation. Arthur Gruber
2 A generic and modular platform for automated sequence processing and annotation Arthur Gruber Instituto de Ciências Biomédicas Universidade de São Paulo AG-ICB-USP 2 Sequence processing and annotation
More informationsrna Detection Results
srna Detection Results Summary: This tutorial explains how to work with the output obtained from the srna Detection module of Oasis. srna detection is the first analysis module of Oasis, and it examines
More informationCopyright 2014 Regents of the University of Minnesota
Quality Control of Illumina Data using Galaxy Contents September 16, 2014 1 Introduction 2 1.1 What is Galaxy?..................................... 2 1.2 Galaxy at MSI......................................
More informationRNA-seq Data Analysis
Seyed Abolfazl Motahari RNA-seq Data Analysis Basics Next Generation Sequencing Biological Samples Data Cost Data Volume Big Data Analysis in Biology تحلیل داده ها کنترل سیستمهای بیولوژیکی تشخیص بیماریها
More informationGenome Browser. Background and Strategy
Genome Browser Background and Strategy Contents What is a genome browser? Purpose of a genome browser Examples Structure Extra Features Contents What is a genome browser? Purpose of a genome browser Examples
More informationSeminar III: R/Bioconductor
Leonardo Collado Torres lcollado@lcg.unam.mx Bachelor in Genomic Sciences www.lcg.unam.mx/~lcollado/ August - December, 2009 1 / 25 Class outline Working with HTS data: a simulated case study Intro R for
More informationMaximizing Public Data Sources for Sequencing and GWAS
Maximizing Public Data Sources for Sequencing and GWAS February 4, 2014 G Bryce Christensen Director of Services Questions during the presentation Use the Questions pane in your GoToWebinar window Agenda
More informationGEP Project Management System: Annotation Project Submission
GEP Project Management System: Annotation Project Submission Author Wilson Leung wleung@wustl.edu Document History Initial Draft 06/04/2007 First Revision 01/11/2009 Second Revision 01/08/2010 Third Revision
More informationBGGN-213: FOUNDATIONS OF BIOINFORMATICS (Lecture 14)
BGGN-213: FOUNDATIONS OF BIOINFORMATICS (Lecture 14) Genome Informatics (Part 1) https://bioboot.github.io/bggn213_f17/lectures/#14 Dr. Barry Grant Nov 2017 Overview: The purpose of this lab session is
More informationGSNAP: Fast and SNP-tolerant detection of complex variants and splicing in short reads by Thomas D. Wu and Serban Nacu
GSNAP: Fast and SNP-tolerant detection of complex variants and splicing in short reads by Thomas D. Wu and Serban Nacu Matt Huska Freie Universität Berlin Computational Methods for High-Throughput Omics
More informationAdvanced Supercomputing Hub for OMICS Knowledge in Agriculture. Step-wise Help to Access Bio-computing Portal. (
Advanced Supercomputing Hub for OMICS Knowledge in Agriculture Step-wise Help to Access Bio-computing Portal (http://webapp.cabgrid.res.in/biocomp/) Centre for Agricultural Bioinformatics ICAR - Indian
More informationMaize genome sequence in FASTA format. Gene annotation file in gff format
Exercise 1. Using Tophat/Cufflinks to analyze RNAseq data. Step 1. One of CBSU BioHPC Lab workstations has been allocated for your workshop exercise. The allocations are listed on the workshop exercise
More informationDecrypting your genome data privately in the cloud
Decrypting your genome data privately in the cloud Marc Sitges Data Manager@Made of Genes @madeofgenes The Human Genome 3.200 M (x2) Base pairs (bp) ~20.000 genes (~30%) (Exons ~1%) The Human Genome Project
More informationGalaxy Platform For NGS Data Analyses
Galaxy Platform For NGS Data Analyses Weihong Yan wyan@chem.ucla.edu Collaboratory Web Site http://qcb.ucla.edu/collaboratory Collaboratory Workshops Workshop Outline ü Day 1 UCLA galaxy and user account
More informationAnalyzing ChIP- Seq Data in Galaxy
Analyzing ChIP- Seq Data in Galaxy Lauren Mills RISS ABSTRACT Step- by- step guide to basic ChIP- Seq analysis using the Galaxy platform. Table of Contents Introduction... 3 Links to helpful information...
More informationUnix tutorial, tome 5: deep-sequencing data analysis
Unix tutorial, tome 5: deep-sequencing data analysis by Hervé December 8, 2008 Contents 1 Input files 2 2 Data extraction 3 2.1 Overview, implicit assumptions.............................. 3 2.2 Usage............................................
More informationProf. Konstantinos Krampis Office: Rm. 467F Belfer Research Building Phone: (212) Fax: (212)
Director: Prof. Konstantinos Krampis agbiotec@gmail.com Office: Rm. 467F Belfer Research Building Phone: (212) 396-6930 Fax: (212) 650 3565 Facility Consultant:Carlos Lijeron 1/8 carlos@carotech.com Office:
More informationColorado State University Bioinformatics Algorithms Assignment 6: Analysis of High- Throughput Biological Data Hamidreza Chitsaz, Ali Sharifi- Zarchi
Colorado State University Bioinformatics Algorithms Assignment 6: Analysis of High- Throughput Biological Data Hamidreza Chitsaz, Ali Sharifi- Zarchi Although a little- bit long, this is an easy exercise
More informationNextGenMap and the impact of hhighly polymorphic regions. Arndt von Haeseler
NextGenMap and the impact of hhighly polymorphic regions Arndt von Haeseler Joint work with: The Technological Revolution Wetterstrand KA. DNA Sequencing Costs: Data from the NHGRI Genome Sequencing Program
More informationDocumentation of S MART
Documentation of S MART Matthias Zytnicki March 14, 2012 Contents 1 Introduction 3 2 Installation and requirements 3 2.1 For Windows............................. 3 2.2 For Mac................................
More informationMapping NGS reads for genomics studies
Mapping NGS reads for genomics studies Valencia, 28-30 Sep 2015 BIER Alejandro Alemán aaleman@cipf.es Genomics Data Analysis CIBERER Where are we? Fastq Sequence preprocessing Fastq Alignment BAM Visualization
More informationContact: Raymond Hovey Genomics Center - SFS
Bioinformatics Lunch Seminar (Summer 2014) Every other Friday at noon. 20-30 minutes plus discussion Informal, ask questions anytime, start discussions Content will be based on feedback Targeted at broad
More informationINTRODUCTION AUX FORMATS DE FICHIERS
INTRODUCTION AUX FORMATS DE FICHIERS Plan. Formats de séquences brutes.. Format fasta.2. Format fastq 2. Formats d alignements 2.. Format SAM 2.2. Format BAM 4. Format «Variant Calling» 4.. Format Varscan
More informationThese will serve as a basic guideline for read prep. This assumes you have demultiplexed Illumina data.
These will serve as a basic guideline for read prep. This assumes you have demultiplexed Illumina data. We have a few different choices for running jobs on DT2 we will explore both here. We need to alter
More informationUnder the Hood of Alignment Algorithms for NGS Researchers
Under the Hood of Alignment Algorithms for NGS Researchers April 16, 2014 Gabe Rudy VP of Product Development Golden Helix Questions during the presentation Use the Questions pane in your GoToWebinar window
More informationde.nbi and its Galaxy interface for RNA-Seq
de.nbi and its Galaxy interface for RNA-Seq Jörg Fallmann Thanks to Björn Grüning (RBC-Freiburg) and Sarah Diehl (MPI-Freiburg) Institute for Bioinformatics University of Leipzig http://www.bioinf.uni-leipzig.de/
More informationChIP-Seq Tutorial on Galaxy
1 Introduction ChIP-Seq Tutorial on Galaxy 2 December 2010 (modified April 6, 2017) Rory Stark The aim of this practical is to give you some experience handling ChIP-Seq data. We will be working with data
More informationData management for Proteomics ABRF 2005
MASCOTIntegra Data management for Proteomics 1 Mascot Integra: Data management for proteomics What is Mascot Integra? What Mascot Integra is not Security and Electronic signatures in Mascot Integra Instrument
More informationUnderstanding and Pre-processing Raw Illumina Data
Understanding and Pre-processing Raw Illumina Data Matt Johnson October 4, 2013 1 Understanding FASTQ files After an Illumina sequencing run, the data is stored in very large text files in a standard format
More informationUser Manual. Ver. 3.0 March 19, 2012
User Manual Ver. 3.0 March 19, 2012 Table of Contents 1. Introduction... 2 1.1 Rationale... 2 1.2 Software Work-Flow... 3 1.3 New in GenomeGems 3.0... 4 2. Software Description... 5 2.1 Key Features...
More informationUsing the Galaxy Local Bioinformatics Cloud at CARC
Using the Galaxy Local Bioinformatics Cloud at CARC Lijing Bu Sr. Research Scientist Bioinformatics Specialist Center for Evolutionary and Theoretical Immunology (CETI) Department of Biology, University
More informationBioHPC Lab at Cornell
BioHPC Lab at Cornell Robert Bukowski (formerly: Computational Biology Service Unit) http://cbsu.tc.cornell.edu/lab/doc/biohpclabintro20130916.pdf (CBSU) Cornell Core Facility providing services for a
More informationESG: Extended Similarity Group Job Submission
ESG: Extended Similarity Group Job Submission Cite: Meghana Chitale, Troy Hawkins, Changsoon Park, & Daisuke Kihara ESG: Extended similarity group method for automated protein function prediction, Bioinformatics,
More informationMetaPhyler Usage Manual
MetaPhyler Usage Manual Bo Liu boliu@umiacs.umd.edu March 13, 2012 Contents 1 What is MetaPhyler 1 2 Installation 1 3 Quick Start 2 3.1 Taxonomic profiling for metagenomic sequences.............. 2 3.2
More informationTutorial. OTU Clustering Step by Step. Sample to Insight. June 28, 2018
OTU Clustering Step by Step June 28, 2018 Sample to Insight QIAGEN Aarhus Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 www.qiagenbioinformatics.com ts-bioinformatics@qiagen.com
More informationTumor-Specific NeoAntigen Detector (TSNAD) v2.0 User s Manual
Tumor-Specific NeoAntigen Detector (TSNAD) v2.0 User s Manual Zhan Zhou, Xingzheng Lyu and Jingcheng Wu Zhejiang University, CHINA March, 2016 USER'S MANUAL TABLE OF CONTENTS 1 GETTING STARTED... 1 1.1
More informationCS313 Exercise 4 Cover Page Fall 2017
CS313 Exercise 4 Cover Page Fall 2017 Due by the start of class on Thursday, October 12, 2017. Name(s): In the TIME column, please estimate the time you spent on the parts of this exercise. Please try
More informationTutorial. OTU Clustering Step by Step. Sample to Insight. March 2, 2017
OTU Clustering Step by Step March 2, 2017 Sample to Insight QIAGEN Aarhus Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 www.qiagenbioinformatics.com AdvancedGenomicsSupport@qiagen.com
More informationIntroduction to R and Bioconductor
Introduction to R and Bioconductor RNA-Seq / ChIP-Seq Data Analysis Workshop 10 September 2012 CSC, Helsinki Nicolas Delhomme A bit of interaction? What is your R knowledge, on a 0 (beginner) to 2 (expert)
More informationPICS: Probabilistic Inference for ChIP-Seq
PICS: Probabilistic Inference for ChIP-Seq Xuekui Zhang * and Raphael Gottardo, Arnaud Droit and Renan Sauteraud April 30, 2018 A step-by-step guide in the analysis of ChIP-Seq data using the PICS package
More informationGEP Project Management System: TSS Project Submission
GEP Project Management System: TSS Project Submission Author Wilson Leung wleung@wustl.edu Document History Initial Draft 08/21/2015 Version GEP Project Management System (Version alpha) Introduction In
More informationMDA Blast2GO Exercises
MDA 2011 - Blast2GO Exercises Ana Conesa and Stefan Götz March 2011 Bioinformatics and Genomics Department Prince Felipe Research Center Valencia, Spain Contents 1 Annotate 10 sequences with Blast2GO 2
More informationNext Generation Sequencing quality trimming (NGSQTRIM)
Next Generation Sequencing quality trimming (NGSQTRIM) Danamma B.J 1, Naveen kumar 2, V.G Shanmuga priya 3 1 M.Tech, Bioinformatics, KLEMSSCET, Belagavi 2 Proprietor, GenEclat Technologies, Bengaluru 3
More informationChromatin immunoprecipitation sequencing (ChIP-Seq) on the SOLiD system Nature Methods 6, (2009)
ChIP-seq Chromatin immunoprecipitation (ChIP) is a technique for identifying and characterizing elements in protein-dna interactions involved in gene regulation or chromatin organization. www.illumina.com
More informationGenome Browsers - The UCSC Genome Browser
Genome Browsers - The UCSC Genome Browser Background The UCSC Genome Browser is a well-curated site that provides users with a view of gene or sequence information in genomic context for a specific species,
More informationCopyright 2014 Regents of the University of Minnesota
Quality Control of Illumina Data using Galaxy August 18, 2014 Contents 1 Introduction 2 1.1 What is Galaxy?..................................... 2 1.2 Galaxy at MSI......................................
More informationExeter Sequencing Service
Exeter Sequencing Service A guide to your denovo RNA-seq results An overview Once your results are ready, you will receive an email with a password-protected link to them. Click the link to access your
More informationThe UCSC Gene Sorter, Table Browser & Custom Tracks
The UCSC Gene Sorter, Table Browser & Custom Tracks Advanced searching and discovery using the UCSC Table Browser and Custom Tracks Osvaldo Graña Bioinformatics Unit, CNIO 1 Table Browser and Custom Tracks
More informationIntroducing Oracle R Enterprise 1.4 -
Hello, and welcome to this online, self-paced lesson entitled Introducing Oracle R Enterprise. This session is part of an eight-lesson tutorial series on Oracle R Enterprise. My name is Brian Pottle. I
More informationFast-track to Gene Annotation and Genome Analysis
Fast-track to Gene Annotation and Genome Analysis Contents Section Page 1.1 Introduction DNA Subway is a bioinformatics workspace that wraps high-level analysis tools in an intuitive and appealing interface.
More informationASAP - Allele-specific alignment pipeline
ASAP - Allele-specific alignment pipeline Jan 09, 2012 (1) ASAP - Quick Reference ASAP needs a working version of Perl and is run from the command line. Furthermore, Bowtie needs to be installed on your
More informationUsing WebGBrowse to Visualize Genome Annotation on GBrowse
Protocol Using WebGBrowse to Visualize Genome Annotation on GBrowse Ram Podicheti and Qunfeng Dong 1 Center for Genomics and Bioinformatics, Indiana University, Bloomington, IN 47405, USA INTRODUCTION
More informationSOP for Influenza autocuration
SOP for Influenza autocuration Authors: Catherine Macken (c.macken@auckland.ac.nz), Sam Zaremba (Sam.Zaremba@ngc.com), Guangyu Sun (gsun@vecna.com), Sherry He (she@virusbrc.org), Christian Suloway (csuloway@virusbrc.org),
More informationUsing Galaxy to provide a NGS Analysis Platform
11/15/11 Using Galaxy to provide a NGS Analysis Platform Friedrich Miescher Institute - part of the Novartis Research Foundation - affiliated institute of Basel University - member of Swiss Institute of
More informationGenome 373: Mapping Short Sequence Reads III. Doug Fowler
Genome 373: Mapping Short Sequence Reads III Doug Fowler What is Galaxy? Galaxy is a free, open source web platform for running all sorts of computational analyses including pretty much all of the sequencing-related
More informationReference guided RNA-seq data analysis using BioHPC Lab computers
Reference guided RNA-seq data analysis using BioHPC Lab computers This document assumes that you already know some basics of how to use a Linux computer. Some of the command lines in this document are
More informationADNI Sequencing Working Group. Robert C. Green, MD, MPH Andrew J. Saykin, PsyD Arthur Toga, PhD
ADNI Sequencing Working Group Robert C. Green, MD, MPH Andrew J. Saykin, PsyD Arthur Toga, PhD Why sequencing? V V V V V V V V V V V V V A fortuitous relationship TIME s Best Invention of 2008 The initial
More informationUsing Galaxy to provide a NGS Analysis Platform GTC s NGS & Bioinformatics Summit Europe October 7-8, 2013 in Berlin, Germany.
Using Galaxy to provide a NGS Analysis Platform GTC s NGS & Bioinformatics Summit Europe October 7-8, 2013 in Berlin, Germany. (public version) Hans-Rudolf Hotz ( hrh@fmi.ch ) Friedrich Miescher Institute
More informationALEXA-Seq ( User Manual (v.1.6)
ALEXA-Seq (www.alexaplatform.org) User Manual (v.1.6) 17 May 2010 Copyright 2009, 2010. Malachi Griffith and Marco A. Marra 1 Table of Contents Table of Contents... 2 Authors... 3 Citation... 3 License...
More informationWelcome to MAPHiTS (Mapping Analysis Pipeline for High-Throughput Sequences) tutorial page.
Welcome to MAPHiTS (Mapping Analysis Pipeline for High-Throughput Sequences) tutorial page. In this page you will learn to use the tools of the MAPHiTS suite. A little advice before starting : rename your
More information