Local Rn Manager Generate FASTQ Analysis Modle Workflow Gide For Research Use Only. Not for se in diagnostic procedres. Overview 3 Set Parameters 3 Analysis Methods 5 View Analysis Reslts 5 Analysis Report 6 Analysis Otpt Files 6 Cstom Analysis Settings 9 Revision History 10 Technical Assistance 11 Docment # 1000000003344 v01 Janary 2018 For Research Use Only. Not for se in diagnostic procedres. ILLUMINA PROPRIETARY
Local Rn Manager Generate FASTQ Analysis Modle Workflow Gide This docment and its contents are proprietary to Illmina, Inc. and its affiliates ("Illmina"), and are intended solely for the contractal se of its cstomer in connection with the se of the prodct(s) described herein and for no other prpose. This docment and its contents shall not be sed or distribted for any other prpose and/or otherwise commnicated, disclosed, or reprodced in any way whatsoever withot the prior written consent of Illmina. Illmina does not convey any license nder its patent, trademark, copyright, or common-law rights nor similar rights of any third parties by this docment. The instrctions in this docment mst be strictly and explicitly followed by qalified and properly trained personnel in order to ensre the proper and safe se of the prodct(s) described herein. All of the contents of this docment mst be flly read and nderstood prior to sing sch prodct(s). FAILURE TO COMPLETELY READ AND EXPLICITLY FOLLOW ALL OF THE INSTRUCTIONS CONTAINED HEREIN MAY RESULT IN DAMAGE TO THE PRODUCT(S), INJURY TO PERSONS, INCLUDING TO USERS OR OTHERS, AND DAMAGE TO OTHER PROPERTY, AND WILL VOID ANY WARRANTY APPLICABLE TO THE PRODUCT(S). ILLUMINA DOES NOT ASSUME ANY LIABILITY ARISING OUT OF THE IMPROPER USE OF THE PRODUCT(S) DESCRIBED HEREIN (INCLUDING PARTS THEREOF OR SOFTWARE). 2018 Illmina, Inc. All rights reserved. All trademarks are the property of Illmina, Inc. or their respective owners. For specific trademark information, see www.illmina.com/company/legal.html. Docment # 1000000003344 v01 For Research Use Only. Not for se in diagnostic procedres. 2
Local Rn Manager Generate FASTQ Analysis Modle Workflow Gide Overview The Local Rn Manager Generate FASTQ analysis modle first demltiplexes indexed reads, if present, generates intermediate analysis files in the FASTQ file format, and then exits the workflow. No alignment or frther analysis is performed. FASTQ files are reqired inpt for analysis with third-party analysis tools. Compatible Library Types The Generate FASTQ analysis modle is compatible with specific library types represented by library kit categories on the Create Rn screen. For a crrent list of compatible library kits, see the Local Rn Manager spport page on the Illmina website. Inpt Reqirements The Generate FASTQ analysis modle reqires the base call files (*.bcl) and the rn smmary files generated dring the seqencing rn. Becase the workflow ends after FASTQ file generation, no other inpt files are reqired. Abot This Gide This gide provides instrctions for setting p rn parameters for seqencing and analysis parameters for the Generate FASTQ analysis modle. For information abot the Local Rn Manager dashboard and system settings, see the Local Rn Manager Software Gide (docment # 1000000002702). Set Parameters 1 Select Create Rn, and then select Generate FASTQ. 2 Enter a rn name that identifies the rn from seqencing throgh analysis. The rn name can contain alphanmeric characters, spaces, and the following special characters: `~!@#$%-_{}. 3 [Optional] Enter a rn description to frther identify the rn. The rn description can contain alphanmeric characters, spaces, and the following special characters: `~!@#$%-_{}. Specify Rn Settings 1 Select a library prep kit from the Library Prep Kit drop-down list. 2 Specify the nmber of index reads. 0 for a rn with no indexing 1 for a single-indexed rn 2 for a dal-indexed rn If yor library prep kit spports only one option, the index read is atomatically selected. 3 Specify a read type: Single Read or Paired End. If yor library prep kit spports only one option, the read type is atomatically selected. 4 Enter the nmber of cycles for the rn. 5 [Optional] If sing cstom primers, specify their information. Cstom primer options may vary based on yor instrment or Local Rn Manager implementation. Docment # 1000000003344 v01 For Research Use Only. Not for se in diagnostic procedres. 3
Local Rn Manager Generate FASTQ Analysis Modle Workflow Gide Specify Modle-Specific Settings 1 Set the Adapter Trimming option. Adapter trimming is enabled by defalt. 2 Set the Reverse Complement option. Enabling this setting makes all reads reverse-complemented as they are written to FASTQ files. By defalt, the reverse complement setting is trned off. The availability of these settings depend on yor Library Prep kit, they are not available for every library prep kit option. Specify Samples for the Rn Specify samples for the rn sing the following options: Enter samples manally Use the blank table at the bottom of the Create Rn screen. Import sample sheet Navigate to an external file in a comma-separated vales (*.csv) format. After yo have poplated the samples table, yo can export the sample information to an external file. Yo can se this file as a reference when preparing libraries or import the file when configring another rn. Enter Samples Manally 1 Adjst the samples table to an appropriate nmber of rows. In the Rows field, se the p/down arrows or enter a nmber to specify the nmber of rows to add to the table. Select the + icon to add the rows to the table. Select the x icon to delete a row. Right-click on a row in the table and se the commands in the contextal men. 2 Enter a niqe sample ID in the Sample ID field. Use alphanmeric characters, dashes, or nderscores. Spaces are not allowed in this field. 3 [Optional] Enter a sample description in the Sample Description field. Use alphanmeric characters, dashes, or nderscores. Spaces are not allowed in this field. 4 If yo have a plated kit, select an index plate well from the Index well drop-down list. 5 Select an Index 1 adapter from the Index 1 (i7) drop-down list. Select Show Index Seqence/Show Index Names to toggle between showing the name of the index and the index seqence. 6 Select an Index 2 adapter from the Index 2 (i5) drop-down list. 7 Select a manifest file from the Manifest drop-down list. 8 [Optional] Enter a project name in the Sample Project field. Use alphanmeric characters, dashes, or nderscores. Spaces are not allowed in this field. 9 [Optional] Select Export Sample Sheet to export the sample information in *.csv format. The exported sample sheet can be sed as a template when creating new rns or imported for another rn. 10 Select Save Rn. Docment # 1000000003344 v01 For Research Use Only. Not for se in diagnostic procedres. 4
Local Rn Manager Generate FASTQ Analysis Modle Workflow Gide Import Sample Sheet 1 If yo do not have a sample sheet to import, see Enter Samples Manally on page 4 for instrctions on how to create and export a sample sheet. Edit the file as follows. a b c Open the sample sheet in a text editor. Enter the sample information in the [Data] section of the file. Save the file. Make sre that the sample IDs are niqe. 2 Select Import Sample Sheet at the top of the Create Rn screen and browse to the location of the sample information file. Make sre that the information in the manifest and sample sheet is correct. Incorrect information can impact the seqencing rn. 3 When finished, select Save Rn. Analysis Methods The Generate FASTQ analysis modle performs the following analysis steps and then writes analysis otpt files to the folder. Demltiplexes index reads Generates FASTQ files Demltiplexing Demltiplexing compares each Index Read seqence to the index seqences specified for the rn. No qality vales are considered in this step. Index reads are identified sing the following steps: Samples are nmbered starting from 1 based on the order they are listed for the rn. Sample nmber 0 is reserved for clsters that were not assigned to a sample. Clsters are assigned to a sample when the index seqence matches exactly. FASTQ File Generation After demltiplexing, the software generates intermediate analysis files in the FASTQ format, which is a text format sed to represent seqences. FASTQ files contain reads for each sample and the associated qality scores. Any controls sed for the rn and clsters that did not pass filter are exclded. Each FASTQ file contains reads for only one sample, and the name of that sample is inclded in the FASTQ file name. FASTQ files are the primary inpt for alignment. View Analysis Reslts 1 From the Local Rn Manager dashboard, select the rn name. 2 From the Rn Overview tab, review the seqencing rn metrics. 3 [Optional] Select the Copy to Clipboard icon to copy the otpt rn folder file path. 4 If yo want to change the file location of the analysis data for any ftre rns, select the Edit icon, and edit the otpt rn folder file path. Docment # 1000000003344 v01 For Research Use Only. Not for se in diagnostic procedres. 5
Local Rn Manager Generate FASTQ Analysis Modle Workflow Gide The file path leading p to the otpt rn folder is editable. The otpt rn folder name cannot be changed. 5 Select the Seqencing Information tab to review rn parameters and consmables information. 6 Select the Samples and Reslts tab to view the analysis report. If analysis was reqeed, select the appropriate analysis from the Select Analysis drop-down list. From the left navigation bar, select a sample name to view the report for another sample. 7 [Optional] Select the Copy to Clipboard icon to copy the Analysis folder file path. Analysis Report Analysis reslts are provided on the Samples and Reslts tab. Indexing Table 1 Indexing Table Colmn Heading Index Nmber Sample ID Sample Description Index 1 (i7) Index 2 (i5) Description An assigned ID based on the order that samples are listed in the sample table. The sample ID provided when the rn was created. The sample description provided when the rn was created. The Index 1 adapter sed with the sample. The Index 2 adapter sed with the sample. Analysis Otpt Files The following analysis otpt files are generated for the Generate FASTQ analysis modle. File Name Demltiplexing (*.demx) FASTQ (*.fastq.gz) Description Intermediate files containing demltiplexing reslts. Intermediate files containing qality scored base calls. FASTQ files are the primary inpt for the alignment step. Demltiplexing File Format The process of demltiplexing reads the index seqence attached to each clster to determine from which sample the clster originated. The mapping between clsters and sample nmber is written to a demltiplexing (*.demx) file for each tile of the flow cell. The demltiplexing file naming format is s_1_x.demx, where X is the tile nmber. Demltiplexing files start with a header: Version (4 byte integer), crrently 1 Clster cont (4 byte integer) The remainder of the file consists of sample nmbers for each clster from the tile. When the demltiplexing step is complete, the software generates a demltiplexing file named DemltiplexSmmaryF1L1.txt. In the file name, F1 represents the flow cell nmber. In the file name, L1 represents the lane nmber. Docment # 1000000003344 v01 For Research Use Only. Not for se in diagnostic procedres. 6
Local Rn Manager Generate FASTQ Analysis Modle Workflow Gide Demltiplexing reslts in a table with one row per tile and one colmn per sample, inclding sample 0. The most commonly occrring seqences in index reads. FASTQ File Format FASTQ is a text-based file format that contains base calls and qality vales per read. Each record contains 4 lines: The identifier The seqence A pls sign (+) The Phred qality scores in an ASCII + 33 encoded format The identifier is formatted as: @Instrment:RnID:FlowCellID:Lane:Tile:X:Y ReadNm:FilterFlag:0:SampleNmber Example: @SIM:1:FCX:1:15:6329:1045 1:N:0:2 TCGCACTCAACGCCCTGCATATGACAAGACAGAATC + <>;##=><9=AAAAAAAAAA9#:<#<;<<<????#= FASTQ File Names FASTQ files are named with the sample name and the sample nmber. The sample nmber is a nmeric assignment based on the order that the sample is listed for the rn. For example:...\samplename_s1_l001_r1_001.fastq.gz samplename The sample name listed for the sample. If a sample name is not provided, the file name incldes the sample ID. S1 The sample nmber based on the order that samples are listed for the rn starting with 1. In this example, S1 indicates that this sample is the first sample listed for the rn. NOTE Reads that cannot be assigned to any sample are written to a FASTQ file for sample nmber 0, and exclded from downstream analysis. L001 The lane nmber. R1 The read. In this example, R1 means Read 1. For a paired-end rn, a file from Read 2 incldes R2 in the file name. When generated, the Index Reads are I1 or I2. 001 The last segment is always 001. FASTQ files are compressed in the GNU zip format, as indicated by *.gz in the file name. FASTQ files can be ncompressed sing tools sch as gzip (command-line) or 7-zip (GUI). Spplementary Otpt Files The following otpt files provide spplementary information, or smmarize rn reslts and analysis errors. Althogh these files are not reqired for assessing analysis reslts, they can be sed for trobleshooting prposes. All files are located in the Alignment folder nless otherwise specified. Docment # 1000000003344 v01 For Research Use Only. Not for se in diagnostic procedres. 7
Local Rn Manager Generate FASTQ Analysis Modle Workflow Gide File Name AdapterConts.txt AdapterTrimming.txt AnalysisLog.txt AnalysisError.txt CompletedJobInfo.xml DemltiplexSmmaryF1L1.txt GenerateFASTQRnStatistics.xml Description Contains a smmary of the nmber of reads that had adapter trimming performed per sample. Lists the nmber of trimmed bases and percentage of bases for each tile. This file is present only if adapter trimming was specified for the rn. Processing log that describes every step that occrred dring analysis of the crrent rn folder. This file does not contain error messages. Processing log that lists any errors that occrred dring analysis. This file will be empty if no errors occrred. Written after analysis is complete, contains information abot the rn, sch as date, flow cell ID, software version, and other parameters. Reports demltiplexing reslts in a table with 1 row per tile and 1 colmn per sample. Contains smmary statistics specific to the rn. Analysis Folder The analysis folder holds the files generated by the Local Rn Manager software. The relationship between the otpt folder and analysis folder is smmarized as follows: Dring seqencing, Real-Time Analysis (RTA) poplates the otpt folder with files generated dring image analysis, base calling, and qality scoring. RTA copies files to the analysis folder in real time. After RTA assigns a qality score to each base for each cycle, the software writes the file RTAComplete.xml to both folders. When the file RTAComplete.txt is present, analysis begins. As analysis contines, Local Rn Manager writes otpt files to the analysis folder, and then copies the files back to the otpt folder. Folder Strctre Data Alignment_## or Alignment_Imported_## [Timestamp of Rn] DataAccessFiles Fastq FastqSmmaryF1L1.txt Sample1_S1_L001_R1_001.fastq.gz Sample2_S2_L001_R2_001.fastq.gz Undetermined_S0_L001_R1_001.fastq.gz Undetermined_S0_L001_R2_001.fastq.gz Logging BildFastq0.stdot.txt BildFastq1.stdot.txt Docment # 1000000003344 v01 For Research Use Only. Not for se in diagnostic procedres. 8
Local Rn Manager Generate FASTQ Analysis Modle Workflow Gide Plots commands.txt AdapterConts.txt AdapterTrimming.txt AnalysisError.txt AnalysisLog.txt Checkpoint.txt CompletedJobInfo.xml DemltiplexSmmaryF1L1.txt GenerateFASTQRnStatistics.xml SampleSheetUsed.csv Cstom Analysis Settings Cstom analysis settings are intended for technically advanced sers. If settings are applied incorrectly, serios problems can occr. Add a Cstom Analysis Setting 1 From the Modle-Specific Settings section of the Create Rn screen, select Show advanced modle settings. 2 Select Add cstom setting. 3 In the cstom setting field, enter the setting name as listed in the Available Analysis Settings section. 4 In the setting vale field, enter the setting vale. 5 To remove a setting, select the x icon. Available Analysis Settings Adapter Trimming By defalt, adapter trimming is enabled in the Generate FASTQ analysis modle. To specify a different adapter, se the Adapter setting. The same adapter seqence is trimmed for Read 1 and Read 2. To specify 2 adapter seqences, separate the seqences with a pls (+) sign. To specify a different adapter seqence for Read 2, se the AdapterRead2 setting. Setting Name Adapter AdapterRead2 Setting Vale Enter the seqence of the adapter to be trimmed. Enter the seqence of the adapter to be trimmed. Docment # 1000000003344 v01 For Research Use Only. Not for se in diagnostic procedres. 9
Local Rn Manager Generate FASTQ Analysis Modle Workflow Gide Revision History Docment Date Description of Change Docment # 100000003344 v01 Docment # 100000003344 v00 Janary 2018 Janary 2016 Updated software descriptions for Generate FASTQ v2.0, which incldes pdates to: Sample sheet import Otpt folder strctre Indexing table Removed Most Poplar Index Seqences table Spplementary otpt files Initial release. Docment # 1000000003344 v01 For Research Use Only. Not for se in diagnostic procedres. 10
Local Rn Manager Generate FASTQ Analysis Modle Workflow Gide Technical Assistance For technical assistance, contact Illmina Technical Spport. Website: Email: www.illmina.com techspport@illmina.com Illmina Cstomer Spport Telephone Nmbers Region Toll Free Regional North America +1.800.809.4566 Astralia +1.800.775.688 Astria +43 800006249 +43 19286540 Belgim +32 80077160 +32 34002973 China 400.066.5835 Denmark +45 80820183 +45 89871156 Finland +358 800918363 +358 974790110 France +33 805102193 +33 170770446 Germany +49 8001014940 +49 8938035677 Hong Kong 800960230 Ireland +353 1800936608 +353 016950506 Italy +39 800985513 +39 236003759 Japan 0800.111.5011 Netherlands +31 8000222493 +31 207132960 New Zealand 0800.451.650 Norway +47 800 16836 +47 21939693 Singapore +1.800.579.2745 Spain +34 911899417 +34 800300143 Sweden +46 850619671 +46 200883979 Switzerland +41 565800000 +41 800200442 Taiwan 00806651752 United Kingdom +44 8000126019 +44 2073057197 Other contries +44.1799.534000 Safety data sheets (SDSs) Available on the Illmina website at spport.illmina.com/sds.html. Prodct docmentation Available for download in PDF from the Illmina website. Go to spport.illmina.com, select a prodct, then select Docmentation & Literatre. Docment # 1000000003344 v01 For Research Use Only. Not for se in diagnostic procedres. 11
Docment # 1000000003344 v01 Illmina 5200 Illmina Way San Diego, California 92122 U.S.A. +1.800.809.ILMN (4566) +1.858.202.4566 (otside North America) techspport@illmina.com www.illmina.com For Research Use Only. Not for se in diagnostic procedres. 2018 Illmina, Inc. All rights reserved.