Practical Course in Genome Bioinformatics

Transcription

1 Practical Course in Genome Bioinformatics 20/01/2017 Exercises - Day 1 Answer questions Q1-Q3 below and include requested Figures 1-5 in your work report. In figure legends give (short) explanations what the pictures represent and how you generated them. DNAPlotter genome visualization DNAPlotter can be used for visualizing genome annotations. It is especially useful for making circular plots. Input data can be in EMBL, Genbank, and gff3 format. 1) Download Java program DNAplotter.jar from URL above or use Java Web Start (requires Java exceptions to be added from Java control panel [Start->Control Panel->Java 32-bit]) 2) Download from course webpage file phcm1.art which is in EMBL format, it contains both annotation and sequence for an Escherichia coli K-12 strain 3) Start DNAplotter and click ok for 'Read in sequence file'. Read in file phcm1.art 4) From Options->Track manager, you can delete and add more tracks and change their visual appearance. By default, it has 5 tracks to show. There are various options and colours to choose from 5) Click GC plot and GC skew plot from pull-down menu Graph 6) From Options->DNA Wizard, select Edit current dna display and click ok, you can choose a circular or linear plot 7) In DNAPlotter main window, you can double-click annotations and highlight selected information (make labels visible, add arrow heads, and change color and plot width) 8) To save DNAPlotter image: File->Save As, choose Format (e.g. jpeg), fill file name and click 'Save' How to get genome annotations for published genomes? Genomes with existing annotations can be obtained from Genbank ftp site: Bacterial genomes among other things have been recently archived from the main site. For this, we use DNAplotter for a pre-existing E.coli genome in genbank format. Download file U00096.gbk from the course website. Open this file in DNAplotter. Q1: What is GC skew and how does it look for this genome? How to add your own annotations? If you have your own genome (not in EMBL or Genbank format), you can still use DNAPlotter. First read the genome sequence in FASTA format and then add the feature (annotation) file in gff3 format. You can add several tracks from several files. Each gff3 file contains 9 columns, more information about the file format can be found at:

2 File U00096rRNA.gff (from the course website) is an example which contains locations of ribosomal genes: 1) Start DNAPlotter 2) Read in sequence file U00096.fna 3) Read in U00096rRNA.gff using File->Read in Entry on Separate Track 4) Go Options->Track manager: delete the first 5 default tracks add a track so that you will have two Tracks for U00096rRNA.gff use Key: rrna for both Tracks 1st Track: show only Forward strand genes with blue in the outer ring (Position 0.9) (nb: it is not enough to select a colour for the genes, you must also click Apply colour to all for the selected colour to be used in the visualisation) 2nd Track: show only Reverse strand genes with red in the inner ring (Position 0.8) click 'update tracks' in Track Manager window to make changes visible, the inner and outer rings will snap into alignment when the tracks are updated 5) You can get information about locations and track labels in Options->DNA Wizard (Edit current DNA display) You can also add information manually. Next we will add a green gene between positions 1,000,000-1,200,000. This is Figure 1 to be included in your work report (in this picture, also show the GC skew). 1) In Options->Features window, fill and to start and stop positions and choose colour 2) In DNAPlotter main window, double click your gene and add new Label 'green gene', add Arrow head and make label visible by clicking 'Show Label' In the Features window, you can delete annotations using Tools->Delete Selected Row. Visualizing multiple genome alignments We use software Mauve for creating and visualizing multiple genome alignments Here we connect via Putty and use Mauve at CSC. The Java software is also available from In this exercise, we have three E.coli genomes: E.coli laboratory strain K12: U00096.gbk E.coli O157 (EHEC): AE gbk E.coli O104:H4 (EAEC): CP gbk Input to Mauve can be in fasta or Genbank format (.gbk). Let's use Genbank format so that we can search genes by their annotations: 1) Start Mauve Open a Xwin server. This is a program called either Cygwin-X or Xming. The Xwin server will appear in the tray of your Windows desktop (bottom right bar). Then Open Putty and select option Enable X11 forwarding located under the SSH options on the left side of the Putty window. Then log in to taito-shell.csc.fi with your user credentials. Go to your working directory and create a folder for day1: cd $WRKDIR mkdir -p bioinfo2017/day1 cd bioinfo2017/day1 Copy and unzip the materials for today using cp and unzip:

3 cp /wrk/jkammon/bioinfo/day1/materials_day1.zip. unzip materials_day1.zip Run Mauve from the command line: module load biokit Mauve & 2) File->Align with progressivemauve add all three genomes one by one click 'Align' give name to outputfile 3) Use buttons on the top of the window for moving, zooming in/out and resetting display (by clicking leftmost button with home icon) you can zoom to see genomic annotations you can zoom into nucleotide level you can go to specified genomic position from View->Go To->Sequence Position you can center alignment between all genomes by clicking leftmost button on top of any genomic position 4) Set K12 strain for reference (right mouse click on top of genome) 5) Image can be saved by Tools->Export->Export Image Show in Figure 2 (attach to report) all genomes in their full length. Using annotation to find alignments of specific genes: Example 1. All genomes contain the gene (thra): find by 'Name', 'contains', write thra to search field and click 'Search' locations of hits can be visualized by clicking gene names in Sequence Navigator window Zoom in to see nucleotides, you can center alignments by clicking left mouse button at any position Example 2. Find shiga toxins: a) b) find by 'Name', 'contains', write stx to search field and click 'Search' locations of hits can be visualized by clicking gene names in Sequence Navigator window find by 'Product', 'contains', write Shiga to search field and click 'Search' in Sequence Navigator, choose one of the genes of O104:H4 strain (by clicking), and then double-click gene box on main window and choose 'View GenBank annotation' In Feature Detail window: click CDS to see more information of this gene Q2: Which of the three E.coli strains contain shiga toxins? Run Mauve alignment only for AE gbk and CP gbk. Find location of Shiga toxin 2 (stx2) and create Figure 3 for your report from the alignment.

4 UCSC Genome browser Task 1. Get familiar with the genome browser Find information about human Fumarate hydratase ( fumarase ) gene. How many exons fumarase has and where it is located in hg19? Include a screenshot showing this as Figure 4 in your work report. 1) open web browser and go to URL: 2) write fumarase to search box and click 'submit' 3) select 'Homo sapiens fumarate hydratase (FH)' on top under 'UCSC Genes' Task 2. Viewing and adding annotation tracks There is information about adding your own annotations in UCSC genome browser at: Take a look on Examples 1-4 there and see how they look in genome browser. Then, add a new track using BED format, name the track (name= course ), put your name as its description and make its colour green (color=0,255,0). Make two green bars with width of 5000 bp, first bar starting from chr22 position and the second bar starting from position : browser position chr22: track name= course description= your name here color=0,255,0, chr first chr second In UCSC genome browser (genome Human hg19): 1) click 'manage custom tracks' 2) click 'add custom tracks' 3) paste your bed file and click 'submit' 4) click go at view in Genome Browser' Save the Genome Browser view showing your custom track above as Figure 5 to your work report for this session. The rest of the UCSC examples in this document are intended as something you can take a look of if you have extra time. Whether you decide to include these in your work report can only have an increasing effect on your work report grade for this time. Please remember to answer Q3 in the end of this document, though. (Extra) Make a new track with different color and add three bars of width 100bp in positions , , and Task 3 (extra). Visualizing your own sequence on genome browser Find gene model (exon structure) for the following mrna: cgactgccgagctccgccctccaggcggccccacccgcctgccgtcctggggcgccgccg ccccgccgccggcagtggaccgctgtgcgcgaaccctgaaccctacggtcccgacccgcg ggcgaggccgggtacctgggctgggatccggagcaagcgggcgagggcagcgccctaagc aggcccggagcgatggcagccttgatgaccccgggaaccggggccccacccgcgcctggt gacttctccggggaagggagccagggacttcccgacccttcgccagagcccaagcagctc ccggagctgatccgcatgaagcgagacggaggccgcctgagcgaagcggacatcaggggc ttcgtggccgctgtggtgaatgggagcgcgcagggcgcacagatcggggccatgctgatg gccatccgacttcggggcatggatctggaggagacctcggtgctgacccaggccctggct cagtcgggacagcagctggagtggccagaggcctggcgccagcagcttgtggacaagcat tccacagggggtgtgggtgacaaggtcagcctggtcctcgcacctgccctggcggcatgt

5 ggctgcaaggtgccaatgatcagcggacgtggtctggggcacacaggaggcaccttggat aagctggagtctattcctggattcaatgtcatccagagcccagagcagatgcaagtgctg ctggaccaggcgggctgctgtatcgtgggtcagagtgagcagctggttcctgcggacgga atcctatatgcagccagagatgtgacagccaccgtggacagcctgccactcatcacagcc tccattctcagtaagaaactcgtggaggggctgtccgctctggtggtggacgttaagttc ggaggggccgccgtcttccccaaccaggagcaggcccgggagctggcaaagacgctggtt ggcgtgggagccagcctagggcttcgggtcgcggcagcgctgaccgccatggacaagccc ctgggtcgctgcgtgggccacgccctggaggtggaggaggcgctgctctgcatggacggc gcaggcccgccagacttaagggacctggtcaccacgctcgggggcgccctgctctggctc agcggacacgcggggactcaggcccagggcgctgcccgggtggccgcggcgctggacgac ggctcggcccttggccgcttcgagcggatgctggcggcgcagggcgtggatcccggtctg gcccgagccctgtgctcgggaagtcccgcagaacgccggcagctgctgcctcgcgcccgg gagcaggaggagctgctggcgcccgcagatggcaccgtggagctggtccgggcgctgccg ctggcgctggtgctgcacgagctcggggccgggcgcagccgcgctggggagccgctccgc ctgggggtgggcgcagagctgctggtcgacgtgggtcagaggctgcgccgtgggaccccc tggctccgcgtgcaccgggacggccccgcgctcagcggcccgcagagccgcgccctgcag gaggcgctcgtactctccgaccgcgcgccattcgccgccccctcgcccttcgcagagctc gttctgccgccgcagcaataaagctcctttgccgcgaaaaaaaaaaa 1) First, in genome browser, click 'hide all'. 2) in UCSC genome browser, use Tools->Blat: choose human genome hg19 copy and paste the above sequence and click 'submit' 3) visualize exon structure on genome browser (click browser) 4) go back and click details. The exon coordinates on the genome can be seen in Side-by-Side-Alignment section. 5) create a new annotation track for this gene in bed format where you show exons (information from previous step) as blue bars. browser position chr22: track name="my TYMP" description="nm_001953" color=0,0,255, chr chr chr chr chr chr chr chr chr chr ) after you have added your own track, compare it against what is in UCSC browser by selecting UCSC Genes track 'full' and clicking 'refresh' in Genes and Gene Predictions section. If you like you can also click 'default tracks' to see more UCSC browser default tracks. Q3: Which of the visualization methods presented today did you find best and easiest to use? Do you use any other visualization software or methods in your studies / work that you would recommend? Please return the work report of these exercises to alan.j.medlar@helsinki.fi as PDF at latest on Friday 10th February Instructions and an example report can be found at: