Table of contents Genomatix AG 1
|
|
- Grace Brianne Rodgers
- 6 years ago
- Views:
Transcription
1
2
3 Table of contents! Introduction! 3 Getting started! 5 The Genome Browser window! 9 The toolbar! 9 The general annotation tracks! 12 Annotation tracks! 13 The 'Sequence' track! 14 The 'Position' track! 15 The scale! 15 Data tracks! 17 Coverage tracks! 17 Coverage tracks with scores! 18 Strand-specific coverage tracks! 18 Alignment tracks! 19 BAM files! 19 Public data! 20 Chromatin states! 20 Evolutionary constrained elements! 21 ENCODE! 21 Customizing Genome Browser! 23 Adding and removing tracks! 23 Adding tracks! 23 Removing tracks! 23 Changing the height of a track! 23 Changing the color of a track! 23 Changing the scale of coverage tracks! 24 Changing the chart type of coverage tracks! 26 Changing the order of tracks! 27 Superimposing tracks! 28 Track legend! 29 Integrated track legend! 29 Track legend panel! 30 Track legend on the left side! 30 Transcript track! 31 Highlight transcripts by source! 31 Remove genes and transcripts! 31 Alignment track! 32 Alignment settings! 32 SAM/BAM settings! 33 Extracting information! 37 Sequences! 37 Annotation sequences! Genomatix AG 1
4 Table of contents Read sequences! 38 Links! Genomatix AG! 2
5 Introduction The Genomatix Genome Browser Introduction The Genomatix Genome Browser is our intuitive tool for visualizing regions of the genome and the associated annotation overlaid with multiple instances of your own positional data (e.g. from NGS experiments). You can browse a genome via position or go directly to a gene of interest, get an impression of locus complexity, easily access general annotation and proprietary data from Genomatix and add or combine your own data tracks in various display formats. Whether you want a detailed overview of the various transcripts of a gene, combine ChIP-Seq and RNA-Seq data in genomic context - down to a single read - or export a graphic for your next paper, these are all tasks you can achieve with Genome Browser. This guide will introduce you to the features of the software for a quick and efficient start with Genome Browser. We hope it will help you get the most from our software. You can also find information in the online help. If any questions remain or if you run into any problems you are always welcome to contact us at: support@genomatix.de (via ) support-us@genomatix.com (via , US and Canadian users) (via phone) (via fax) Genomatix AG 3
6 Introduction 2018 Genomatix AG! 4
7 Getting started Getting started Genome Browser is part of the Genomatix Software Suite and replaces the old graphical representation ('Detailed Graphics') of ElDorado. It can be accessed directly from the navigation bar under 'Genomes & Data': Using a direct link (e.g. in a RegionMiner or Gene Overview result): Or via the ElDorado links on the main menu and in the navigation bar: The direct link leads to the Genome Browser overview page, where you have to select an organism for browsing. In addition, you can select a microarray chip to display probe positions: Genomatix AG 5
8 Getting started Clicking the 'Submit' button will then open the Genome Browser view with no specific region (you can start to view data by entering a region, gene or transcript in the toolbar): If you access Genome Browser through ElDorado you will get to the ElDorado start page where you can select the organism and your gene or region of interest. Alternatively you can also submit the sequence of the region you want to view. If you want to visualize your own data these must be present as BED or BAM files in one of your projects. Choose the according project from the 'Current project' drop-down menu on the top left to be able to view them. After clicking the 'Submit' button you will get to the overview page where in addition to the visualization you can access detailed information on transcripts, tissue expression profiles, comparative genomics and associated literature (see next page) Genomatix AG! 6
9 Getting started To start the Genome Browser, simply click on the 'Genome Browser' button on top of the list. Coming from ElDorado, the region or gene you specified will be shown: Genomatix AG 7
10 Getting started 2018 Genomatix AG! 8
11 The Genome Browser window The Genome Browser window The browser window consists of four parts the toolbar on top, the general annotation tracks and the user data tracks in the middle and a scale on the bottom. While the data is displayed below the annotation tracks per default you can move tracks around between the two. We will introduce these sections in more detail in the next few paragraphs. toolbar general annotation data scale The toolbar Here is an overview of the toolbar and its elements: move and zoom go back/forward show/hide position line settings save/load view states select gene, transcript or chromosomal region add/remove tracks export relative location on chromosome organism select region and jump to ElDorado Move and zoom: clicking any of the arrows will shift the display view to the left or right of the current view (single arrows: a half window size, double arrows: a full window size). You can also move the view by clicking in the window, holding the mouse button and moving the mouse. If there are too many tracks to fit them into your browser window, you can also scroll down using this method. Zooming in or out can be either achieved by clicking on the scaling bars (zoom levels range from 50 bp to 1Mb), by using the '+' and '-' buttons or using your Genomatix AG 9
12 The Genome Browser window mouse wheel. For the two highest levels the nucleotide sequence will be displayed. Go back or forward: These buttons allow you to jump back and forward between chromosomal positions viewed before in the current session. The file selection is not affected! Track selection (select annotation and user data for display): This button allows you to individually select annotation tracks from the ElDorado database, your user data in BED and BAM format, public data in BED format and other tracks (like the sequence). If you upload or save BED/BAM files in the project management while working with the Genome Browser you can update your BED/BAM file list (for the selected organism) by clicking on the reload button ( ). The first number in parentheses behind the group name indicates the number of selected tracks, the second one the total number of tracks. These two numbers can change if you filter the tracks by their name with the input field at the bottom. For more details regarding file selection and data background please see the following sections. To see the source of the elements annotated in ElDorado just move your pointer over any of the elements or have a look at the overview in the online help or at Probes are only shown for the microarray selected on the ElDorado or the Genome Browser start page Show / hide position line: will display a thin vertical position line indicating the exact genomic location of its position. It can also be used to visually align different features. Select region for ElDorado: Click on this button and select a region of interest using your mouse to query the ElDorado database Genomatix AG! 10
13 The Genome Browser window Settings: The settings window allows you to change some global parameters of the visualization. You can define the resolution for the coverage tracks and modify the appearance of the track legend. Any settings here affect all tracks shown: Export: Allows you to export the current view as jpg or png image. Save: Opens a panel, which allows you to save your current session. Reloading a session will display the chromosomal region with the customized data tracks preloaded. This panel allows you also to save and manage multiple sessions. Selecting a gene or chromosomal region: Using this input you can jump to a different chromosomal region by either entering the chromosomal coordinates (e.g. 'chr1', '1' or 'NC_00009' plus start and end position), a gene symbol or a gene id. If you enter coordinates, just hit the return key. If you enter a gene symbol or transcript accession, a drop down list will pop up, where you can select your gene from: Genomatix AG 11
14 The Genome Browser window In the lower part of the toolbar you can find the chromosomal location bar and an icon for the currently displayed species: The yellow indicator shows the relative chromosomal position of the current view. You can also drag it using the mouse to get to another chromosomal position. If cytogenetic G banding pattern information from UCSC is available, then cytobands are drawn. Darker bands are AT-rich, and lighter bands are GC-rich. Moving the mouse pointer over the cytobands will show the cytoband type. 'gneg' and 'gpos' define the stain intensity, 'acen' means acrocentric bands, 'gvar' stands for variable heterochromatic region and 'stalk' refers to tightly constricted regions on the short arms of acrocentric chromosomes. Cytobands are available for Homo sapiens, Mus musculus, Rattus norvegicus and Drosophila melanogaster. Moving the mouse pointer over the species icon will show the species name, ElDorado version, project and the currently selected chromosome. The general annotation tracks All tracks in the Genome Browser consist of a track button (a small triangle or square to the very left of the track), a track label indicating the type of annotation data or based on the name of user data and the visualization of the data. If a track can't be shown, e.g. because the selected range is too big to get a meaningful visualization of the data, this will be indicated by a yellow track button. A red-colored track button indicates that data is still being loaded for that track. You can hide the track buttons and labels or choose to use the track legend window instead of the settings menu as described above. Here are screenshots showing the track buttons within the tracks and the track legend window: 2018 Genomatix AG! 12
15 The Genome Browser window Annotation tracks All annotation data from Genomatix' ElDorado database can be displayed in this section. The tracks selected by default are micrornas (from mirbase, pink), modules (known functional transcription factor binding site combinations, dark blue), promoter regions (yellow), repeat regions (light orange), transcription start sites (red) and transcript (black). If you started the Genome Browser via ElDorado, the user sequence track (dark orange) will also be shown, marking the location of the gene you entered or the aligned sequence if you submitted a sequence or accession number. To add or remove tracks use the track selection button ( ) in the toolbar. (Please note that the 'transcripts' track is located in the 'other tracks' section.) Clicking on a track button (the small triangles on the left side of the tracks: ) will expand the associated track. For most tracks this will result in plus and minus strand being displayed separately, but for the transcript track all transcript variants are shown. Strand orientation for these is indicated by the small grey arrows next to the transcript accession numbers. Tracks with a square instead of a triangle can't be expanded. Clicking on a track button of an expanded annotation track ( ) will show the annotations stacked among each other. This screenshot shows the promoter regions in an unexpanded track, the repeats in a strand-specific track and the modules (track with the button) are stacked on each other: The unexpanded transcript track shows all transcripts in one row. The thin lines denote the introns and the thicker lines denote the exons. The thinner part of the exon is the UTR and the thicker part is the coding sequence. The gene symbol for each locus is displayed as long as it does not overlap with the previous gene symbol. The expanded transcript track shows each transcript stacked above each other. Transcripts from different loci are drawn with more space between them Genomatix AG 13
16 The Genome Browser window If you move your mouse pointer over a transcript, additional information is shown in a popup window: Furthermore, double-clicking the transcript opens a popup menu. Using the 'Element links' option you can go to e.g. ElDorado's More Gene Info or Detailed Transcript Info pages for more detailed information on the chosen transcript: The 'Sequence' track The sequence track can be used to display the underlying reference sequence of the region you're looking at. If you zoom in to the 250 bp level (second smallest scaling bar) the sequence will be displayed as color code: If you zoom in further to the 50 bp zoom level (smallest scaling bar) the nucleotides will be displayed: 2018 Genomatix AG! 14
17 The Genome Browser window For zoom levels where displaying either the sequence or the color coded nucleotides isn't possible, the sequence track will just show checkered grey and yellow squares. The 'Position' track The position track shows the exact chromosomal position of the region currently displayed. The scale The scale below the tracks helps you to quickly verify the genomic distances you're looking at in the current view. It can be hidden via the settings menu Genomatix AG 15
18 The Genome Browser window 2018 Genomatix AG! 16
19 The Genome Browser window Data tracks All BED and BAM files stored in the project management for the currently selected project can be added to the user data section. To add data, use the track selection button ( ) in the toolbar, then pick the 'BED files' or 'BAM files' option and tick those files that you want to add as coverage or as alignment track: Coverage tracks By default the coverage tracks are displayed as bar charts in black and with auto scaling. Each bar represents a distinct region of the underlying sequence, which we call 'bin'. For each bin a coverage value is calculated by dividing the number of 'covered' nucleotides by the total number of nucleotides in the bin. Multiple coverage is taken into account. Example GATC (region 1 - partial) ACCCTCCACA (region 2) CCTCCACACTC (region 3) AGACCCTCCACACTCTGATC (bin) Here the bin is 20 nucleotides long. It is covered by 3 regions from the BED/BAM file, with a coverage value of ( )/20 = 1.2 Please note that the bins are recalculated dynamically whenever you change the zoom level or move the view. You can change the number of bins displayed via the 'Settings' menu. Moving your mouse pointer over a bar will give you the name of the BED/BAM file associated with the track and coverage for that bin: Genomatix AG 17
20 The Genome Browser window You can customize each coverage track by setting different colors or choosing another chart type. Combining tracks is also possible. To learn more, please refer to the next section 'Customizing Genome Browser'. Coverage tracks with scores The regions in BED files can contain scores in the fifth column. The official format allows a value between 0 and 1,000. The Genomatix Genome Browser does also handle values greater than 1,000 as well as negative values. The scores can be visualized in the coverage track by double clicking the track, selecting coverage settings and then selecting either Visualize positive scores or Visualize positive and negative scores. Please note that visualization of positive and negative scores in combination with a strand-specific view is not possible for the same coverage track. The coverage of each bin is calculated by adding the products of region length and score and dividing it through the length of the bin. Example GATC (region 1 / score: 0.5) ACCCTCCACA (region 2 / score: 1) CCTCCACACTC (region 3 / score: 2) AGACCCTCCACACTCTGATC (bin) Here the bin is 20 nucleotides long. It is covered by 3 regions from the BED file, with a coverage value of (4* *1 + 10*2)/20 = 1.6 The next screenshot shows an alignment track and coverage track of a BED file with the visualization of positive scores. The regions on the left have a low score and the regions on the right have a high score. Strand-specific coverage tracks Coverage-tracks can be expanded like most annotation tracks by clicking the left triangle button ( ). Then one coverage plot is shown for the plus and one for the minus strand. The bin range on the right still displays the highest value for both strands together. The next screenshot displays two strand-specific coverage tracks. The first coverage track shows strand-unspecific RNA-seq data and the second coverage track shows strand-specific data: 2018 Genomatix AG! 18
21 The Genome Browser window Strand-specific coverage tracks with the plot type 'Region map' are displayed like strand-specific annotation tracks. Alignment tracks Alignment tracks display the segments of your BED files or aligned reads from your BAM files. These tracks are shown up to a view range of 25,000 bp, otherwise you have to zoom in. If you move your mouse pointer to the right edge of the alignment track, a scroll bar will appear. You can use this to scroll around within the alignment track. If you zoom close enough to a segment or read, then the strand-orientation is displayed as arrowhead: BAM files Spliced reads and deletions are visualized with a thin line between the aligned read parts. At higher resolutions read bases that mismatch the reference are visualized with the same color code as in the sequence track ( ). Insertions are visualized with a Genomatix AG 19
22 The Genome Browser window yellow bar ( available. ). Mismatches and insertions are only displayed if the MD string is If you move your mouse pointer over a read, additional information like the name, quality and the sequence is shown in a popup window. Mismatches are highlighted in lower-case and insertions are marked bold. Public data Under 'BED files' you can find the group 'public' with more than 1,500 BED files. These BED files are available for every user. Chromatin states These BED files contain chromatin states of nine cell lines according to Jason Ernst et al., Nature 473: (2011). Ernst et al. identified different chromatin states corresponding to regulatory elements such as active and inactive promoters or weakly and strongly transcribed regions. In the next screenshot the regulatory elements for the cell line Gm12878 are displayed. The BED files have been added as coverage tracks with the plot type 'Region map'. More information about plot types can be found in the next chapter 'Customizing Genome Browser' Genomatix AG! 20
23 The Genome Browser window Evolutionary constrained elements This BED file contains evolutionary constrained elements according to Kerstin Lindblad-Toh et al., Nature 478: (2011). Kerstin Lindblad-Toh et al. compared the human genome sequence with 29 mammalian genome sequence and identified 4.2% of the human genome as evolutionary constrained. ENCODE The data of these tracks are from the ENCODE project (ENCODE Project Consortium. "A user s guide to the encyclopedia of DNA elements (ENCODE)." PLoS Biol 9.4 (2011): e ). The tracks are divided into the categories DNase hypersensitivity sites, Histone modifications, Transcription factor binding sites, Polymerase binding sites and Other factor binding sites. The tracks in DNase hypersensitivity sites show regions where the chromatin is hypersensitive to cutting by the DNase enzyme. The tracks can be loaded individual for each cell type or as a supertrack consisting of DNase hypersensitivity sites from all cell types. At the functional level hypersensitive sites often represent transcriptional active regions. The tracks in Histone modifications show regions with modifications of the histones H3k27ac, H3K4me1-3 and H3K9ac. The tracks can be also loaded individual for each cell type or as histone-specific supertracks combined of all cell types. At the functional level the histone peaks are associated with transcriptional activity. The tracks in the category Transcription factor binding sites show ChIP-Seq peaks of more than 120 TFs. The data can be loaded in four different ways: 1. single TF in a specific cell type 2. all TFs in a specific tissue (supertrack) 3. single TF in all cell-types/tissues (supertrack) 4. all TFs in all cell-types/tissues (supertrack) The supertracks with more than one TF have a special feature. Double clicking in an alignment track gives you the option to either load a supertrack for a TF or a cell Genomatix AG 21
24 The Genome Browser window type-specific TF track. Double clicking on the peak of a TF filters the options to the according TF. The next screenshot shows the option menu when double clicking on the peak region of GATA2: The score of each region represents the signal strength of its peak. The score of the regions in the supertracks is the sum of the signal strength in the individual cell types. The tracks in the categories Polymerase binding sites and Other factor binding sites show ChIP-Seq peaks of Polymerase and other factors binding to DNA that are not characterized as transcription factors. Loading and supertrack handling for these is the same as for the Transcription factor binding sites Genomatix AG! 22
25 Customizing Genome Browser Customizing Genome Browser Adding and removing tracks Adding tracks To add tracks to either the annotation or user data area use the track selection button ( ) as described in the sections above. You can either select each track separately by ticking the checkboxes or you can use the buttons (, ) to the right of the track groups. Clicking the first button ( ) shows several options to add tracks from the group below each other. The option adds all tracks regardless the track type, the option adds all annotation tracks, the option adds all coverage tracks and the option adds all alignment tracks. Clicking the second button ( ) shows several options to add tracks from the group already stacked. The different options are only shown if no more than 20 tracks would be added. Please note that if you add more tracks than can be shown in your browser window, you will have to scroll down to view those tracks. Removing tracks To remove a track, either click on the track selection button ( ) and deselect the track in the popup-menu or double click the track and select the 'Remove track' option from the pop-up menu. To remove several tracks from one group at once, click in the track selection popup-menu the button and then the type of tracks you want to remove (,,, ). The first number in parentheses behind the group name indicates the number of selected tracks and the second number in parentheses indicates the total number of tracks. Changing the height of a track You can change the height of any track in both the annotation and user data area. Double click on the track and select 'Set track height' from the menu. In the upcoming window you can set the track height in pixels. To change the height for several tracks at once, check the box 'Apply to multiple tracks' and select the corresponding tracks: Changing the color of a track You can also change the color of a track. Double click it, select 'Set color' and then choose a color using the color picker in the upcoming window. You can also change the transparency of a track if the track is stackable.to change the color and transparency for several tracks at once, check the box 'Apply to multiple tracks' and select the corresponding tracks: Genomatix AG 23
26 Customizing Genome Browser Changing the scale of coverage tracks Double-clicking a user data track and selecting 'Scale type' will bring up a panel, where you can choose from different ways to scale the y-axis of a track. The default is 'Auto scale': With 'Auto scale', the data is automatically scaled, which means that each track is scaled based on its maximum value in the currently displayed region. As a consequence, the maximum values displayed differ between tracks and will also differ if you move to a different location of the chromosome. The displayed data range for each track is shown on the right hand side of the track. In this example the range shows that PGR is much higher expressed in T47D (third from the bottom, range from 0 to ) than in MCF10A (top, range from 0 to 10.38). If you select 'Local common auto scale', all tracks for which this scaling method was selected will be scaled based on their common maximum in the displayed region. This can be helpful to assess the differences between data in the region you're looking at. If you select 'Global common auto scale', each lane is in addition normalized based on the total length of regions and thus taking the numbers and lengths of all bed files into account where this scaling method was selected. This will give you more of a global view of your data. Please note that if you select one of the common scales, data in your current view might be scaled down to being invisible if the maximal values in other tracks are high in comparison. The best way to check for the presence of any data at the current position is to use 'Auto scale', for comparing tracks either the 'local' or 'global common scales' are recommended. 'Manual scale' lets you enter a minimum and maximum value for the y-axis range. Depending on the values, some data might become invisible due to the scaling! Selecting 'Log scale' will change the scale from linear to log 2 based. This can be applied to any of the 4 scaling choices. The option 'Instant scale' is enabled by default. If you move the view by clicking in the window, holding the mouse button and moving the mouse, then the tracks are scaled instantly. If the option is disabled, then the view does not scale until you release the 2018 Genomatix AG! 24
27 Customizing Genome Browser mouse button. If you added many data tracks and cannot move the view smoothly, it is recommended to disable this option. The selected scaling options are displayed if you move your cursor over the bin range on the right side: Example For the view on the next page, tracks for estrogen receptor (ER) positive breast cancer cell lines were colored in blue, while ER negative breast cancer cell line tracks were colored in orange. The control cell line (MCF10A) remained black. The track height was set to 30 for all: Genomatix AG 25
28 Customizing Genome Browser Changing the chart type of coverage tracks Besides changing the height or color of a track you can also choose from four different chart types for coverage tracks: 'Bar chart' is the default, where each bar stands for a bin containing regions from the BED file. As in a histogram, the more regions from the BED file fall into a bin the higher the bar will be plotted. 'Line plot' uses the same binning approach as 'bar chart' but will display a line instead of bars. You can think of it as the outline of a bar chart. 'Heatmap' will display the values of the bin in a heat-map style, i.e. the value of each bin is indicated by the saturation of the drawn bar. Higher values will have 'darker' bars, lower values are 'lighter'. All bars are drawn in the same height. 'Region map' will just indicate that some data has been found for this position in the BED file without assigning any value to it. This chart type is only available for BED files. The resolution of the user tracks, i.e. the number of bars or line segments drawn can be changed via the 'Settings' button ( ) in the toolbar: Please note that choosing a high number of bins might slow down the responsiveness of the Genome Browser when displaying many user tracks, as more calculations have to be performed! 2018 Genomatix AG! 26
29 Customizing Genome Browser Example Below you can see an example combining several settings in one view: It shows the four different chart types: bar chart (MCF7, first blue track), line plot (BT474, second blue track), heat-map (ZR75, third blue track), and region map (T47D, fourth blue track), all of them set to a resolution of 200 bins: Changing the order of tracks If you need a different order of tracks, e.g. to better correlate a user track with an annotation track, you can simply move tracks around by clicking on their name and then moving them to the new position and then releasing the mouse button. A line will appear in between other tracks to indicate the position where the track will be inserted: Genomatix AG 27
30 Customizing Genome Browser You can move any track to any position in the display. Superimposing tracks A powerful feature of Genome Browser is the capacity to superimpose tracks. This enables you to convey multiple levels of information in a single track. You can combine several annotation tracks or coverage tracks. If you prefer a superimposed display for the annotation track (as in the old 'Detailed graphics' in ElDorado), e.g. for primary transcripts, exons and promoters, you can overlay these tracks using simple drag and drop (select a track by clicking on the track label, hold and move the track over the other track and release the mouse button when the small green plus sign appears): The view below was generated by removing the 'Repeat Region' and 'Module' tracks and adding the 'Primary Transcript' and 'Exon tracks' and then combining those (using drag and drop) with the 'Promoter' track: To separate any track from a combined track, simply click on its label and drag it to a different order in the display. Please note that the 'Sequence', 'Position', 'Transcript' and alignment tracks can't be superimposed on any other tracks. You can also superimpose coverage tracks using the same drag & drop method as for the annotation tracks. In combination with different chart types and/or scalings this can be used to create highly informative combined tracks. Example For the view shown on the next page four BED files containing raw reads and clusters from two cell lines were added. The read tracks were then set to 'Common local auto scale'. The cluster track displays were set to 'Region Map' and their color was changed. The resolution was increased and subsequently the read files were superimposed on top of the corresponding cluster files. You can now see the cluster 2018 Genomatix AG! 28
31 Customizing Genome Browser positions, the read distribution within the cluster and the relative coverage all in a single track for each experiment: Track legend The track legend is by default integrated in the tracks. You can change the display of the track legend in the settings panel by clicking on the button. Integrated track legend The integrated track legend shows a button and a label on the left side for each track. If you have superimposed several tracks, then several button and labels are displayed beneath each other on the superimposed tracks. This determines the minimum height of your superimposed tracks. If you disable the buttons and the labels for the integrated track legend in the settings panel or choose the track legend panel, then a minimum height is not required for the superimposed tracks Genomatix AG 29
32 Customizing Genome Browser Track legend panel The track legend panel is displayed on top of the tracks, but can be moved freely. Tracks can also be moved by dragging the label between the tracks and can be superimposed by dragging the label on another label. An advantage of the track legend panel is that the superimposed tracks have no minimum height. Track legend on the left side The track legend on the left side is displayed separately on the left side and does not superimpose the tracks. Dragging the labels can also be used to move and superimpose the tracks. If you double-click on the border separating the track legend and the tracks, then the track legend fades out to the left. Double-clicking the separator again, fades in the track legend. You can also resize the left track legend by dragging the separator with the mouse Genomatix AG! 30
33 Customizing Genome Browser Transcript track Highlight transcripts by source Double-clicking the transcript track and selecting 'Highlight transcripts by source' opens a small window where you can individually select and deselect transcript sources. Clicking the OK or Apply button, transcripts of deselected sources will be shown greyed out. Remove genes and transcripts Double-clicking the transcript track and selecting 'Remove genes and transcripts' opens a small window where you can individually select and deselect genes and transcripts shown in the current window. Deselected genes and transcripts will be removed from the track. Clicking on the arrow ( ) beside the genes and transcripts will open a new browser tab with more detailed gene or transcript information Genomatix AG 31
34 Customizing Genome Browser Alignment track Alignment settings Double-clicking the alignment track and selecting 'Alignment settings' opens a window with several options to customize the alignment track for BED and BAM files. Max. coverage depth determines the maximal coverage in the alignment track and can be set to maximal A maximal coverage of 250 means that no more than 250 alignments are stacked at a single base position. Enable max. alignment length determines if the alignments will be filtered according to the next option. Max. alignment length filters out all alignments with a higher length. Compact view draws the alignments more compact. Strand-specific coloring draws all alignments on the minus strand with an extra color. This color can be set under Minus strand color. The upper track shows the compact view with strand-specific coloring and the lower tracks shows the default view: 2018 Genomatix AG! 32
35 Customizing Genome Browser SAM/BAM settings Double-clicking the alignment track and selecting 'SAM/BAM settings' opens a window with several options to customize the alignment track for SAM/BAM files. Selecting the option draw mate pairs connects paired-end reads with a line and draws them side by side if both reads have been loaded. If the mate read is located on another chromosome, the read is highlighted with a colored border. The color for such an inter-chromosomal pair can also be customized. A useful feature for an inter-chromosomal pair is to double-click the mate and then select Jump to mate to jump to the location of the according mate. In this example the inter-chromosomal read pairs are highlighted with a red border: Genomatix AG 33
36 Customizing Genome Browser Selecting the option Highlight pair orientation all read pairs deviating from the expected read pair orientation are highlighted. The reads are highlighted with three different colors depending on whether the first, the second or both reads are incorrectly oriented. This option allows to detect structural variants more easily. In this example the first and the second reads are incorrectly oriented which indicates a duplication: In the next example only the second read is incorrectly oriented which indicates an inversion: Selecting the option Highlight color insert size deviation colors all reads deviating from the expected insert size are highlighted. The expected insert size range can be customized as well as the colors for inferred insert sizes smaller and larger than the expected insert size. The expected insert size range can also be estimated from the insert sizes of the currently loaded read pairs. A more precise range over all read pairs in the BAM file is calculated by the Genomatix Mapper on the GMS. In this example the read pairs with a smaller insert size than expected are highlighted with a green border and indicate a potential insertion: In this example the read pairs with a larger insert size than expected are highlighted with a blue border and indicate a potential deletion: 2018 Genomatix AG! 34
37 Customizing Genome Browser In order not to miss the highlighted reads in data with high coverage, the display option Show all sorted sorts the reads so that the highlighted reads appear at top. The option Show only highlighted displays only the highlighted reads. Please note that the sorting and filtering function will be only applied on the loaded reads. If your coverage depth exceeds the configured limit, please adjust the maximum coverage depth (see Alignment settings). The option color mapping quality draws the color intensity of the reads depending on the mapping quality value. The higher the mapping quality the more intense the color. The mapping quality range is set by default from 0 to 60. Reads with mapping quality values smaller than the lowest range value are assigned the lowest color intensity and reads with mapping quality values higher than the highest range the highest color intensity. The color intensity for reads with values between the lowest and highest value is scaled linearly. In this example all reads on the right have a lower mapping quality than most of the reads on the left: Genomatix AG 35
38 Customizing Genome Browser 2018 Genomatix AG! 36
39 Extracting information Extracting information There are several ways to extract information about the region, annotation elements and sequences. E.g. you can select a region as mentioned above by clicking on the 'Select region button' ( ) and selecting a region of interest using your mouse to query the ElDorado database. ElDorado gives you more information about the selected annotations and has several export functions to save the annotations as BED file or to extract their sequences. Sequences Sequences can be obtained from annotations and alignments. You can copy the sequence either to your clipboard or on the server and save it in the result management. Annotation sequences Double-clicking on annotation opens a context menu from where you can choose the annotation sequence to display. You can add the flanking sequences on both sides of the annotation which might be useful for SNP annotation Genomatix AG 37
40 Extracting information Read sequences Read sequences can also be displayed by double-clicking on the respective read in the alignment track. For BAM files the read sequence will be displayed with all mismatches, deletions and insertions in the reference (if the MD string is available). Mismatches are highlighted in lower-case. For BED files the reference sequence will be shown. You can copy the sequence either as plain text or in FASTA format to your clipboard or to the server where you can save the sequence in the result management. Links More detailed information can be obtained for most annotation elements: exon, microrna, module, primary transcript, promoter region, transcript, transcript start region, UTR and variation. Double-clicking on an annotation element opens the context menu with links to analyses or more details of the annotation element. E.g. you can start the comparative genomics task for a promoter region or analyze it for binding sites: 2018 Genomatix AG! 38
41
42 A4/180223
You will be re-directed to the following result page.
ENCODE Element Browser Goal: to navigate the candidate DNA elements predicted by the ENCODE consortium, including gene expression, DNase I hypersensitive sites, TF binding sites, and candidate enhancers/promoters.
More informationm6aviewer Version Documentation
m6aviewer Version 1.6.0 Documentation Contents 1. About 2. Requirements 3. Launching m6aviewer 4. Running Time Estimates 5. Basic Peak Calling 6. Running Modes 7. Multiple Samples/Sample Replicates 8.
More informationepigenomegateway.wustl.edu
Everything can be found at epigenomegateway.wustl.edu REFERENCES 1. Zhou X, et al., Nature Methods 8, 989-990 (2011) 2. Zhou X & Wang T, Current Protocols in Bioinformatics Unit 10.10 (2012) 3. Zhou X,
More informationAnalyzing ChIP- Seq Data in Galaxy
Analyzing ChIP- Seq Data in Galaxy Lauren Mills RISS ABSTRACT Step- by- step guide to basic ChIP- Seq analysis using the Galaxy platform. Table of Contents Introduction... 3 Links to helpful information...
More informationGenome Browsers - The UCSC Genome Browser
Genome Browsers - The UCSC Genome Browser Background The UCSC Genome Browser is a well-curated site that provides users with a view of gene or sequence information in genomic context for a specific species,
More informationChIP-Seq Tutorial on Galaxy
1 Introduction ChIP-Seq Tutorial on Galaxy 2 December 2010 (modified April 6, 2017) Rory Stark The aim of this practical is to give you some experience handling ChIP-Seq data. We will be working with data
More informationTutorial: Jump Start on the Human Epigenome Browser at Washington University
Tutorial: Jump Start on the Human Epigenome Browser at Washington University This brief tutorial aims to introduce some of the basic features of the Human Epigenome Browser, allowing users to navigate
More informationA short Introduction to UCSC Genome Browser
A short Introduction to UCSC Genome Browser Elodie Girard, Nicolas Servant Institut Curie/INSERM U900 Bioinformatics, Biostatistics, Epidemiology and computational Systems Biology of Cancer 1 Why using
More informationGenome Browsers Guide
Genome Browsers Guide Take a Class This guide supports the Galter Library class called Genome Browsers. See our Classes schedule for the next available offering. If this class is not on our upcoming schedule,
More informationIntegrative Genomics Viewer. Prat Thiru
Integrative Genomics Viewer Prat Thiru 1 Overview User Interface Basics Browsing the Data Data Formats IGV Tools Demo Outline Based on ISMB 2010 Tutorial by Robinson and Thorvaldsdottir 2 Why IGV? IGV
More informationSPAR outputs and report page
SPAR outputs and report page Landing results page (full view) Landing results / outputs page (top) Input files are listed Job id is shown Download all tables, figures, tracks as zip Percentage of reads
More informationWilson Leung 01/03/2018 An Introduction to NCBI BLAST. Prerequisites: Detecting and Interpreting Genetic Homology: Lecture Notes on Alignment
An Introduction to NCBI BLAST Prerequisites: Detecting and Interpreting Genetic Homology: Lecture Notes on Alignment Resources: The BLAST web server is available at https://blast.ncbi.nlm.nih.gov/blast.cgi
More informationTutorial 1: Exploring the UCSC Genome Browser
Last updated: May 12, 2011 Tutorial 1: Exploring the UCSC Genome Browser Open the homepage of the UCSC Genome Browser at: http://genome.ucsc.edu/ In the blue bar at the top, click on the Genomes link.
More informationIntegrated Genome browser (IGB) installation
Integrated Genome browser (IGB) installation Navigate to the IGB download page http://bioviz.org/igb/download.html You will see three icons for download: The three icons correspond to different memory
More informationChIP-seq hands-on practical using Galaxy
ChIP-seq hands-on practical using Galaxy In this exercise we will cover some of the basic NGS analysis steps for ChIP-seq using the Galaxy framework: Quality control Mapping of reads using Bowtie2 Peak-calling
More informationCLC Server. End User USER MANUAL
CLC Server End User USER MANUAL Manual for CLC Server 10.0.1 Windows, macos and Linux March 8, 2018 This software is for research purposes only. QIAGEN Aarhus Silkeborgvej 2 Prismet DK-8000 Aarhus C Denmark
More informationGenomic Analysis with Genome Browsers.
Genomic Analysis with Genome Browsers http://barc.wi.mit.edu/hot_topics/ 1 Outline Genome browsers overview UCSC Genome Browser Navigating: View your list of regions in the browser Available tracks (eg.
More informationUser's guide to ChIP-Seq applications: command-line usage and option summary
User's guide to ChIP-Seq applications: command-line usage and option summary 1. Basics about the ChIP-Seq Tools The ChIP-Seq software provides a set of tools performing common genome-wide ChIPseq analysis
More informationSupplementary Figure 1. Fast read-mapping algorithm of BrowserGenome.
Supplementary Figure 1 Fast read-mapping algorithm of BrowserGenome. (a) Indexing strategy: The genome sequence of interest is divided into non-overlapping 12-mers. A Hook table is generated that contains
More informationGenome Environment Browser (GEB) user guide
Genome Environment Browser (GEB) user guide GEB is a Java application developed to provide a dynamic graphical interface to visualise the distribution of genome features and chromosome-wide experimental
More informationAgilent Genomic Workbench 7.0
Agilent Genomic Workbench 7.0 Data Viewing User Guide Agilent Technologies Notices Agilent Technologies, Inc. 2012, 2015 No part of this manual may be reproduced in any form or by any means (including
More informationTutorial: Resequencing Analysis using Tracks
: Resequencing Analysis using Tracks September 20, 2013 CLC bio Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 Fax: +45 86 20 12 22 www.clcbio.com support@clcbio.com : Resequencing
More informationGenomeStudio Software Release Notes
GenomeStudio Software 2009.2 Release Notes 1. GenomeStudio Software 2009.2 Framework... 1 2. Illumina Genome Viewer v1.5...2 3. Genotyping Module v1.5... 4 4. Gene Expression Module v1.5... 6 5. Methylation
More informationW ASHU E PI G ENOME B ROWSER
Roadmap Epigenomics Workshop W ASHU E PI G ENOME B ROWSER SOT 2016 Satellite Meeting March 17 th, 2016 Ernest N. Morial Convention Center, New Orleans, LA Presenter: Ting Wang Tutorial Overview: WashU
More informationBrowser Exercises - I. Alignments and Comparative genomics
Browser Exercises - I Alignments and Comparative genomics 1. Navigating to the Genome Browser (GBrowse) Note: For this exercise use http://www.tritrypdb.org a. Navigate to the Genome Browser (GBrowse)
More informationTutorial: RNA-Seq Analysis Part II (Tracks): Non-Specific Matches, Mapping Modes and Expression measures
: RNA-Seq Analysis Part II (Tracks): Non-Specific Matches, Mapping Modes and February 24, 2014 Sample to Insight : RNA-Seq Analysis Part II (Tracks): Non-Specific Matches, Mapping Modes and : RNA-Seq Analysis
More informationGradebook Entering, Sorting, and Filtering Student Scores March 10, 2017
Gradebook Entering, Sorting, and Filtering Student Scores March 10, 2017 1. Entering Student Scores 2. Exclude Student from Assignment 3. Missing Assignments 4. Scores by Class 5. Sorting 6. Show Filters
More informationWilson Leung 05/27/2008 A Simple Introduction to NCBI BLAST
A Simple Introduction to NCBI BLAST Prerequisites: Detecting and Interpreting Genetic Homology: Lecture Notes on Alignment Resources: The BLAST web server is available at http://www.ncbi.nih.gov/blast/
More informationProtocol: peak-calling for ChIP-seq data / segmentation analysis for histone modification data
Protocol: peak-calling for ChIP-seq data / segmentation analysis for histone modification data Table of Contents Protocol: peak-calling for ChIP-seq data / segmentation analysis for histone modification
More informationThe GGA produces results of higher relevance, answering your scientific questions with even greater precision than before.
Welcome...... to the Genomatix Genome Analyzer Quickstart Guide. The Genomatix Genome Analyzer is Genomatix' integrated solution for comprehensive second-level analysis of Next Generation Sequencing (NGS)
More informationKeynote 08 Basics Website:
Website: http://etc.usf.edu/te/ Keynote is Apple's presentation application. Keynote is installed as part of the iwork suite, which also includes the word processing program Pages and the spreadsheet program
More informationThe Allen Human Brain Atlas offers three types of searches to allow a user to: (1) obtain gene expression data for specific genes (or probes) of
Microarray Data MICROARRAY DATA Gene Search Boolean Syntax Differential Search Mouse Differential Search Search Results Gene Classification Correlative Search Download Search Results Data Visualization
More informationChIP-seq practical: peak detection and peak annotation. Mali Salmon-Divon Remco Loos Myrto Kostadima
ChIP-seq practical: peak detection and peak annotation Mali Salmon-Divon Remco Loos Myrto Kostadima March 2012 Introduction The goal of this hands-on session is to perform some basic tasks in the analysis
More informationExercise 2: Browser-Based Annotation and RNA-Seq Data
Exercise 2: Browser-Based Annotation and RNA-Seq Data Jeremy Buhler July 24, 2018 This exercise continues your introduction to practical issues in comparative annotation. You ll be annotating genomic sequence
More informationGuide to WB Annotations
Guide to WB Annotations 04 May 2016 Annotations are a powerful new feature added to Workbench v1.2.0 (Released May 2016) for placing text and symbols within wb_view tabs and windows. They enable generation
More informationSmartView. User Guide - Analysis. Version 2.0
SmartView User Guide - Analysis Version 2.0 Table of Contents Page i Table of Contents Table Of Contents I Introduction 1 Dashboard Layouts 2 Dashboard Mode 2 Story Mode 3 Dashboard Controls 4 Dashboards
More informationUsing Inspiration 7 I. How Inspiration Looks SYMBOL PALETTE
Using Inspiration 7 Inspiration is a graphic organizer application for grades 6 through adult providing visual thinking tools used to brainstorm, plan, organize, outline, diagram, and write. I. How Inspiration
More informationTutorial: RNA-Seq analysis part I: Getting started
: RNA-Seq analysis part I: Getting started August 9, 2012 CLC bio Finlandsgade 10-12 8200 Aarhus N Denmark Telephone: +45 70 22 55 09 Fax: +45 70 22 55 19 www.clcbio.com support@clcbio.com : RNA-Seq analysis
More informationChIP-seq (NGS) Data Formats
ChIP-seq (NGS) Data Formats Biological samples Sequence reads SRA/SRF, FASTQ Quality control SAM/BAM/Pileup?? Mapping Assembly... DE Analysis Variant Detection Peak Calling...? Counts, RPKM VCF BED/narrowPeak/
More informationSupplementary Material. Cell type-specific termination of transcription by transposable element sequences
Supplementary Material Cell type-specific termination of transcription by transposable element sequences Andrew B. Conley and I. King Jordan Controls for TTS identification using PET A series of controls
More informationWindow Designer. Opening Screen: When you start Window Designer, you will see the Opening Screen. Here you will be choosing from 4 options:
Window Designer Opening Screen: When you start Window Designer, you will see the Opening Screen. Here you will be choosing from 4 options: New Design: Use this option when no pre-built templates are available
More informationGetting Started. April Strand Life Sciences, Inc All rights reserved.
Getting Started April 2015 Strand Life Sciences, Inc. 2015. All rights reserved. Contents Aim... 3 Demo Project and User Interface... 3 Downloading Annotations... 4 Project and Experiment Creation... 6
More informationOpen Excel by following the directions listed below: Click on Start, select Programs, and the click on Microsoft Excel.
Candy is Dandy Grading Rubric You have been hired to conduct some market research about M&M's. First, you had your team purchase 4 large bags and the results are given for the contents of those bags. You
More informationPress the Plus + key to zoom in. Press the Minus - key to zoom out. Scroll the mouse wheel away from you to zoom in; towards you to zoom out.
Navigate Around the Map Interactive maps provide many choices for displaying information, searching for more details, and moving around the map. Most navigation uses the mouse, but at times you may also
More informationW ASHU E PI G ENOME B ROWSER
W ASHU E PI G ENOME B ROWSER Keystone Symposium on DNA and RNA Methylation January 23 rd, 2018 Fairmont Hotel Vancouver, Vancouver, British Columbia, Canada Presenter: Renee Sears and Josh Jang Tutorial
More informationLearning to use the drawing tools
Create a blank slide This module was developed for Office 2000 and 2001, but although there are cosmetic changes in the appearance of some of the tools, the basic functionality is the same in Powerpoint
More informationAgilent Genomic Workbench Lite Edition 6.5
Agilent Genomic Workbench Lite Edition 6.5 SureSelect Quality Analyzer User Guide For Research Use Only. Not for use in diagnostic procedures. Agilent Technologies Notices Agilent Technologies, Inc. 2010
More informationUCSC Genome Browser ASHG 2014 Workshop
UCSC Genome Browser ASHG 2014 Workshop We will be using human assembly hg19. Some steps may seem a bit cryptic or truncated. That is by design, so you will think about things as you go. In this document,
More informationMISIS Tutorial. I. Introduction...2 II. Tool presentation...2 III. Load files...3 a) Create a project by loading BAM files...3
MISIS Tutorial Table of Contents I. Introduction...2 II. Tool presentation...2 III. Load files...3 a) Create a project by loading BAM files...3 b) Load the Project...5 c) Remove the project...5 d) Load
More informationNumbers Basics Website:
Website: http://etc.usf.edu/te/ Numbers is Apple's new spreadsheet application. It is installed as part of the iwork suite, which also includes the word processing program Pages and the presentation program
More informationIntroduction to version Instruction date
Introduction to version 1.1.0 Instruction date 16.5.2008 Windows and Files Start by creating the window Open FCS data file By right-clicking the axis the list of available parameters appear. Right-click
More informationSymphony EnvironmentalVue
Symphony EnvironmentalVue Version 3.1 User's Guide Symphony is a registered trademark of Harris Corporation, and Symphony EnvironmentalVue is a trademark of Harris Corporation. This information is the
More informationEasy visualization of the read coverage using the CoverageView package
Easy visualization of the read coverage using the CoverageView package Ernesto Lowy European Bioinformatics Institute EMBL June 13, 2018 > options(width=40) > library(coverageview) 1 Introduction This
More informationWorking with Charts Stratum.Viewer 6
Working with Charts Stratum.Viewer 6 Getting Started Tasks Additional Information Access to Charts Introduction to Charts Overview of Chart Types Quick Start - Adding a Chart to a View Create a Chart with
More informationSNPViewer Documentation
SNPViewer Documentation Module name: Description: Author: SNPViewer Displays SNP data plotting copy numbers and LOH values Jim Robinson (Broad Institute), gp-help@broad.mit.edu Summary: The SNPViewer displays
More informationUser Guide. v7.5. September 4, For the most recent version of this document, visit kcura's Documentation Site.
User Guide v7.5 September 4, 2013 For the most recent version of this document, visit kcura's Documentation Site. Table of Contents 1 User guide overview 4 2 Relativity objects 4 3 Workspace 6 3.1 Workspaces
More informationGetting Started with DADiSP
Section 1: Welcome to DADiSP Getting Started with DADiSP This guide is designed to introduce you to the DADiSP environment. It gives you the opportunity to build and manipulate your own sample Worksheets
More informationQuick Start Guide Jacob Stolk PhD Simone Stolk MPH November 2018
Quick Start Guide Jacob Stolk PhD Simone Stolk MPH November 2018 Contents Introduction... 1 Start DIONE... 2 Load Data... 3 Missing Values... 5 Explore Data... 6 One Variable... 6 Two Variables... 7 All
More informationHow to use earray to create custom content for the SureSelect Target Enrichment platform. Page 1
How to use earray to create custom content for the SureSelect Target Enrichment platform Page 1 Getting Started Access earray Access earray at: https://earray.chem.agilent.com/earray/ Log in to earray,
More informationAgilent Genomic Workbench 7.0
Agilent Genomic Workbench 7.0 ChIP Interactive Analysis User Guide Agilent Technologies Notices Agilent Technologies, Inc. 2012, 2015 No part of this manual may be reproduced in any form or by any means
More informationFull Search Map Tab. This map is the result of selecting the Map tab within Full Search.
Full Search Map Tab This map is the result of selecting the Map tab within Full Search. This map can be used when defining your parameters starting from a Full Search. Once you have entered your desired
More informationFor Research Use Only. Not for use in diagnostic procedures.
SMRT View Guide For Research Use Only. Not for use in diagnostic procedures. P/N 100-088-600-02 Copyright 2012, Pacific Biosciences of California, Inc. All rights reserved. Information in this document
More informationcief Data Analysis Chapter Overview Chapter 12:
page 285 Chapter 12: cief Data Analysis Chapter Overview Analysis Screen Overview Opening Run Files How Run Data is Displayed Viewing Run Data Data Notifications and Warnings Checking Your Results Group
More informationIntroduction to SAGA GIS
GIS Tutorial ID: IGET_RS_001 This tutorial has been developed by BVIEER as part of the IGET web portal intended to provide easy access to geospatial education. This tutorial is released under the Creative
More informationLesson 4 Customize the ToolBox
Lesson 4 Customize the ToolBox In this lesson you will learn how to: Change the toolbox to be a Floating toolbox or a toolbox anchored on the Sidebar. Change the combo ToolBox size and highlighting. Change
More informationAdvanced UCSC Browser Functions
Advanced UCSC Browser Functions Dr. Thomas Randall tarandal@email.unc.edu bioinformatics.unc.edu UCSC Browser: genome.ucsc.edu Overview Custom Tracks adding your own datasets Utilities custom tools for
More informationFull Search Map Tab Overview
FlexMLS Map Server Full Search Map Tab Overview The Full Search Map tab is a need to know module. It is accessible when you use Full Search under Search in the Main Menu tree of FlexMLS. This map can
More informationUser Guide. v Released June Advaita Corporation 2016
User Guide v. 0.9 Released June 2016 Copyright Advaita Corporation 2016 Page 2 Table of Contents Table of Contents... 2 Background and Introduction... 4 Variant Calling Pipeline... 4 Annotation Information
More informationVisualPST 2.4. Visual object report editor for PowerSchool. Copyright Park Bench Software, LLC All Rights Reserved
VisualPST 2.4 Visual object report editor for PowerSchool Copyright 2004-2015 Park Bench Software, LLC All Rights Reserved www.parkbenchsoftware.com This software is not free - if you use it, you must
More informationOverview of Adobe Fireworks
Adobe Fireworks Overview of Adobe Fireworks In this guide, you ll learn how to do the following: Work with the Adobe Fireworks workspace: tools, Document windows, menus, and panels. Customize the workspace.
More informationpanda Documentation Release 1.0 Daniel Vera
panda Documentation Release 1.0 Daniel Vera February 12, 2014 Contents 1 mat.make 3 1.1 Usage and option summary....................................... 3 1.2 Arguments................................................
More informationClip Art and Graphics. Inserting Clip Art. Inserting Other Graphics. Creating Your Own Shapes. Formatting the Shape
1 of 1 Clip Art and Graphics Inserting Clip Art Click where you want the picture to go (you can change its position later.) From the Insert tab, find the Illustrations Area and click on the Clip Art button
More informationIMAGE STUDIO LITE. Tutorial Guide Featuring Image Studio Analysis Software Version 3.1
IMAGE STUDIO LITE Tutorial Guide Featuring Image Studio Analysis Software Version 3.1 Notice The information contained in this document is subject to change without notice. LI-COR MAKES NO WARRANTY OF
More informationDW DIGs Model Windows Tricks
Window Menu 1. Window > Cascade Windows All open windows that aren't minimized at the bottom of the screen will be offset diagonally so you can see the title bar of each. 2. Window > Tile Windows All open
More informationTutorial. RNA-Seq Analysis of Breast Cancer Data. Sample to Insight. November 21, 2017
RNA-Seq Analysis of Breast Cancer Data November 21, 2017 Sample to Insight QIAGEN Aarhus Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 www.qiagenbioinformatics.com AdvancedGenomicsSupport@qiagen.com
More informationUCSC Genome Browser Pittsburgh Workshop -- Practical Exercises
UCSC Genome Browser Pittsburgh Workshop -- Practical Exercises We will be using human assembly hg19. These problems will take you through a variety of resources at the UCSC Genome Browser. You will learn
More informationExcel 2013 Intermediate
Excel 2013 Intermediate Quick Access Toolbar... 1 Customizing Excel... 2 Keyboard Shortcuts... 2 Navigating the Spreadsheet... 2 Status Bar... 3 Worksheets... 3 Group Column/Row Adjusments... 4 Hiding
More informationCreating Web Pages with SeaMonkey Composer
1 of 26 6/13/2011 11:26 PM Creating Web Pages with SeaMonkey Composer SeaMonkey Composer lets you create your own web pages and publish them on the web. You don't have to know HTML to use Composer; it
More informationIntroduction to Galaxy
Introduction to Galaxy Dr Jason Wong Prince of Wales Clinical School Introductory bioinformatics for human genomics workshop, UNSW Day 1 Thurs 28 th January 2016 Overview What is Galaxy? Description of
More informationExcel 2013 Intermediate
Instructor s Excel 2013 Tutorial 2 - Charts Excel 2013 Intermediate 103-124 Unit 2 - Charts Quick Links Chart Concepts Page EX197 EX199 EX200 Selecting Source Data Pages EX198 EX234 EX237 Creating a Chart
More informationAbout...1. Quick Start...2. Features and options...3. Thematic Map...3. Indicators Panel Graph Panel Options Panel...
USER GUIDE TABLE OF CONTENTS About...1 Quick Start...2 Features and options...3 Thematic Map...3 Indicators Panel... 5 Graph Panel... 6 Options Panel... 7 Data-table Panel... 8 Selection Panel... 8 Time
More informationHIPPIE User Manual. (v0.0.2-beta, 2015/4/26, Yih-Chii Hwang, yihhwang [at] mail.med.upenn.edu)
HIPPIE User Manual (v0.0.2-beta, 2015/4/26, Yih-Chii Hwang, yihhwang [at] mail.med.upenn.edu) OVERVIEW OF HIPPIE o Flowchart of HIPPIE o Requirements PREPARE DIRECTORY STRUCTURE FOR HIPPIE EXECUTION o
More informationUsing Excel to produce graphs - a quick introduction:
Research Skills -Using Excel to produce graphs: page 1: Using Excel to produce graphs - a quick introduction: This handout presupposes that you know how to start Excel and enter numbers into the cells
More informationTutorial. Small RNA Analysis using Illumina Data. Sample to Insight. October 5, 2016
Small RNA Analysis using Illumina Data October 5, 2016 Sample to Insight QIAGEN Aarhus Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 www.qiagenbioinformatics.com AdvancedGenomicsSupport@qiagen.com
More informationPart 1: How to use IGV to visualize variants
Using IGV to identify true somatic variants from the false variants http://www.broadinstitute.org/igv A FAQ, sample files and a user guide are available on IGV website If you use IGV in your publication:
More informationSHOW ME THE NUMBERS: DESIGNING YOUR OWN DATA VISUALIZATIONS PEPFAR Applied Learning Summit September 2017 A. Chafetz
SHOW ME THE NUMBERS: DESIGNING YOUR OWN DATA VISUALIZATIONS PEPFAR Applied Learning Summit September 2017 A. Chafetz Overview In order to prepare for the upcoming POART, you need to look into testing as
More informationSmall RNA Analysis using Illumina Data
Small RNA Analysis using Illumina Data September 7, 2016 Sample to Insight CLC bio, a QIAGEN Company Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 www.clcbio.com support-clcbio@qiagen.com
More informationImporting sequence assemblies from BAM and SAM files
BioNumerics Tutorial: Importing sequence assemblies from BAM and SAM files 1 Aim With the BioNumerics BAM import routine, a sequence assembly in BAM or SAM format can be imported in BioNumerics. A BAM
More informationInsight: Measurement Tool. User Guide
OMERO Beta v2.2: Measurement Tool User Guide - 1 - October 2007 Insight: Measurement Tool User Guide Open Microscopy Environment: http://www.openmicroscopy.org OMERO Beta v2.2: Measurement Tool User Guide
More informationAODstats. Guide to using the Victorian data maps. Powered by StatPlanet
AODstats Guide to using the Victorian data maps Powered by StatPlanet Contents Quick start guide Interface: Start page Main page Indicator selector panel Indicator details Indicator search box Graph panel
More informationViTraM: VIsualization of TRAnscriptional Modules
ViTraM: VIsualization of TRAnscriptional Modules Version 1.0 June 1st, 2009 Hong Sun, Karen Lemmens, Tim Van den Bulcke, Kristof Engelen, Bart De Moor and Kathleen Marchal KULeuven, Belgium 1 Contents
More informationDremel Digilab 3D Slicer Software
Dremel Digilab 3D Slicer Software Dremel Digilab 3D Slicer prepares your model for 3D printing. For novices, it makes it easy to get great results. For experts, there are over 200 settings to adjust to
More informationRich Text Editor Quick Reference
Rich Text Editor Quick Reference Introduction Using the rich text editor is similar to using a word processing application such as Microsoft Word. After data is typed into the editing area it can be formatted
More informationPerforming a resequencing assembly
BioNumerics Tutorial: Performing a resequencing assembly 1 Aim In this tutorial, we will discuss the different options to obtain statistics about the sequence read set data and assess the quality, and
More informationHow to...create a Video VBOX Gauge in Inkscape. So you want to create your own gauge? How about a transparent background for those text elements?
BASIC GAUGE CREATION The Video VBox setup software is capable of using many different image formats for gauge backgrounds, static images, or logos, including Bitmaps, JPEGs, or PNG s. When the software
More informationWASHU EPIGENOME BROWSER 2018 epigenomegateway.wustl.edu
WASHU EPIGENOME BROWSER 2018 epigenomegateway.wustl.edu 3 BROWSER MAP 14 15 16 17 18 19 20 21 22 23 24 1 2 5 4 8 9 10 12 6 11 7 13 Key 1 = Go to this page number to learn about the browser feature TABLE
More informationTree and Data Grid for Micro Charts User Guide
COMPONENTS FOR XCELSIUS Tree and Data Grid for Micro Charts User Guide Version 1.1 Inovista Copyright 2009 All Rights Reserved Page 1 TABLE OF CONTENTS Components for Xcelsius... 1 Introduction... 4 Data
More informationOU EDUCATE TRAINING MANUAL
OU EDUCATE TRAINING MANUAL OmniUpdate Web Content Management System El Camino College Staff Development 310-660-3868 Course Topics: Section 1: OU Educate Overview and Login Section 2: The OmniUpdate Interface
More informationGeneious Microsatellite Plugin. Biomatters Ltd
Geneious Microsatellite Plugin Biomatters Ltd November 24, 2018 2 Introduction This plugin imports ABI fragment analysis files and allows you to visualize traces, fit ladders, call peaks, predict bins,
More informationStatistics with a Hemacytometer
Statistics with a Hemacytometer Overview This exercise incorporates several different statistical analyses. Data gathered from cell counts with a hemacytometer is used to explore frequency distributions
More information