Genome Browser. Background and Strategy
|
|
|
- Stephen Dennis
- 6 years ago
- Views:
Transcription
1 Genome Browser Background and Strategy
2 Contents What is a genome browser? Purpose of a genome browser Examples Structure Extra Features
3 Contents What is a genome browser? Purpose of a genome browser Examples Structure Extra Features
4 Genome Browser Graphical interface for the display of biological information for the purpose of facilitating genomic analysis. Allows the user to visualize and browse entire genomes with their features such as gene predictions and their respective functions.
5 Web Development:Model-View-Controller (MVC) -Separates internal representations of information from what is presented/accepted by the user -Consists of : Model - stores the data View - generates an output presentation Controller - Updates the model 93controller
6 Web Development: LAMP -The most common stack for hosting websites -Linux - Operating System -Apache -Web Server -MySQL - Relational Database Management System -PHP/Python/Perl - Server Side Scripting Language
7 Web Development: Front-end Back-end
8 Web Development: Available Options Backend/Server Side PHP Django Ruby on Rails Server to Web Application HTML vs XML JSON Frontend/ Client-side HTML5, CSS, JavaScript/JQuery
9 Web Development: Document Object Model (DOM) -Is a World Wide Web Consortium standard -Defines a standard for accessing documents -Consists of: Core DOM - standard model for all document types XML DOM - standard model for XML documents HTML DOM - standard model for HTML documents
10 Contents What is a genome browser? Purpose of a genome browser Examples Structure Extra Features
11 Visualizing Data Intuitive, usable/user-friendly, link from bioinformaticians to biologists
12 How to visualize data?
13 What about genomes? Martin Krzywinski
14 Keep valuable information Genomes Genes Functions Comparisons
15 What information is in a genome? ATGATGAAGAAGATGACAGGTAAGACTTTTGCATTAAGTGCATTGGTTGCCGCCAGCTT T
16 What information is in a genome? 5 ATGATGAAGAAGATGACAGGTAAGACTTTTGCATTAAGTGCATTGGTTGCCGCCAGCTT 3 T
17 Contents What is a genome browser? Purpose of a genome browser Examples Structure Extra Features
18 UCSC The Gold Standard DEVELOPERS Genome Bioinformatics Group of UC Santa Cruz Initially created for the human genome project It has since been adapted for many other organisms FUNCTIONS Genome Browser - views of genomic regions BLAT - BLAST-Like Alignment Tool Table Browser - SQL access to genomic data TRACKS Refseq genes Ensembl gene predictions GenBank mrnas ESTs Conservation sites Repeating Elements.
19 JBrowse
20 Contents What is a genome browser? Purpose of a genome browser Examples Structure Extra Features
21 OUR STRATEGY
22 Haemophilus influenzae Genome Default Genome Genes Virulence Annotation
23 Haemophilus influenzae Genome Default Genome Genes Virulence Annotation Tracks: Features (Name, Type - Gene, CRISPR, RNA) Misc info (Pathway, TM, Coils, SP, Virulence factors, Operons, etc.)
24 : Generic Model Organism Database Tools DBs Science!
25
26
27 Contents What is a genome browser? Purpose of a genome browser Examples Structure Extra Features
28 Extra features Previous years: Detailed information about organisms (or strains) BLAST service Downloads section Results from analysis done in each stage Pipelines Typing tool
29 Extra features Our selection BLAST DOWNLOADS PIPELINES
30 Blast
31 Extra features Our selection BLAST DOWNLOADS Assembled Contigs Predicted Genes Annotated Genes PIPELINES
32 Extra features Our selection BLAST DOWNLOADS PIPELINES Assembly to Annotation Typing tool
33 Assembly to Annotation Pipeline (Fastq GFF)
34 Typing Pipeline (fasta type)
35 Sneak Peek
Generic Model Organism Database. Lavanya Rishishwar
Generic Model Organism Database Lavanya Rishishwar Outline Purpose Genome database Basics of webserver & database GMOD 4/7/2016 Generic Model Organism Database 2 Presentation Assumption What do we understand:
Genome Browsers Guide
Genome Browsers Guide Take a Class This guide supports the Galter Library class called Genome Browsers. See our Classes schedule for the next available offering. If this class is not on our upcoming schedule,
Background and Strategy. Smitha, Adrian, Devin, Jeff, Ali, Sanjeev, Karthikeyan
Background and Strategy Smitha, Adrian, Devin, Jeff, Ali, Sanjeev, Karthikeyan What is a genome browser? A web/desktop based graphical tool for rapid and reliable display of any requested portion of the
Genome Browsers - The UCSC Genome Browser
Genome Browsers - The UCSC Genome Browser Background The UCSC Genome Browser is a well-curated site that provides users with a view of gene or sequence information in genomic context for a specific species,
Genome Browser. Background & Strategy. Spring 2017 Faction II
Genome Browser Background & Strategy Spring 2017 Faction II Outline Beginning of the Last Phase Goals State of Art Applicable Genome Browsers Not So Genome Browsers Storing Data Strategy for the website
Sequence Alignment. GBIO0002 Archana Bhardwaj University of Liege
Sequence Alignment GBIO0002 Archana Bhardwaj University of Liege 1 What is Sequence Alignment? A sequence alignment is a way of arranging the sequences of DNA, RNA, or protein to identify regions of similarity.
LEMONS Database Generator GUI
LEMONS Database Generator GUI For more details and updates : http://lifeserv.bgu.ac.il/wb/dmishmar/pages/lemons.php If you have any questions or requests, please contact us by email: lemons.help@gmail.com
welcome to BOILERCAMP HOW TO WEB DEV
welcome to BOILERCAMP HOW TO WEB DEV Introduction / Project Overview The Plan Personal Website/Blog Schedule Introduction / Project Overview HTML / CSS Client-side JavaScript Lunch Node.js / Express.js
Introduction to Genome Browsers
Introduction to Genome Browsers Rolando Garcia-Milian, MLS, AHIP (Rolando.milian@ufl.edu) Department of Biomedical and Health Information Services Health Sciences Center Libraries, University of Florida
Annotating a Genome in PATRIC
Annotating a Genome in PATRIC The following step-by-step workflow is intended to help you learn how to navigate the new PATRIC workspace environment in order to annotate and browse your genome on the PATRIC
TBtools, a Toolkit for Biologists integrating various HTS-data
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 TBtools, a Toolkit for Biologists integrating various HTS-data handling tools with a user-friendly interface Chengjie Chen 1,2,3*, Rui Xia 1,2,3, Hao Chen 4, Yehua
Genome Browser Background and Strategy
Genome Browser Background and Strategy April 12th, 2017 BIOL 7210 - Faction I (Outbreak) - Genome Browser Group Adam Dabrowski Mrunal Dehankar Shareef Khalid Hubert Pan Ajay Ramakrishnan Ankit Srivastava
The UCSC Genome Browser
The UCSC Genome Browser Search, retrieve and display the data that you want Materials prepared by Warren C. Lathe, Ph.D. Mary Mangan, Ph.D. www.openhelix.com Updated: Q3 2006 Version_0906 Copyright OpenHelix.
Genomic Analysis with Genome Browsers.
Genomic Analysis with Genome Browsers http://barc.wi.mit.edu/hot_topics/ 1 Outline Genome browsers overview UCSC Genome Browser Navigating: View your list of regions in the browser Available tracks (eg.
Topics of the talk. Biodatabases. Data types. Some sequence terminology...
Topics of the talk Biodatabases Jarno Tuimala / Eija Korpelainen CSC What data are stored in biological databases? What constitutes a good database? Nucleic acid sequence databases Amino acid sequence
NGS Data Visualization and Exploration Using IGV
1 What is Galaxy Galaxy for Bioinformaticians Galaxy for Experimental Biologists Using Galaxy for NGS Analysis NGS Data Visualization and Exploration Using IGV 2 What is Galaxy Galaxy for Bioinformaticians
Galaxy workshop at the Winter School Igor Makunin
Galaxy workshop at the Winter School 2016 Igor Makunin i.makunin@uq.edu.au Winter school, UQ, July 6, 2016 Plan Overview of the Genomics Virtual Lab Introduce Galaxy, a web based platform for analysis
Getting Started. April Strand Life Sciences, Inc All rights reserved.
Getting Started April 2015 Strand Life Sciences, Inc. 2015. All rights reserved. Contents Aim... 3 Demo Project and User Interface... 3 Downloading Annotations... 4 Project and Experiment Creation... 6
Tutorial 1: Exploring the UCSC Genome Browser
Last updated: May 12, 2011 Tutorial 1: Exploring the UCSC Genome Browser Open the homepage of the UCSC Genome Browser at: http://genome.ucsc.edu/ In the blue bar at the top, click on the Genomes link.
BovineMine Documentation
BovineMine Documentation Release 1.0 Deepak Unni, Aditi Tayal, Colin Diesh, Christine Elsik, Darren Hag Oct 06, 2017 Contents 1 Tutorial 3 1.1 Overview.................................................
Information Resources in Molecular Biology Marcela Davila-Lopez How many and where
Information Resources in Molecular Biology Marcela Davila-Lopez (marcela.davila@medkem.gu.se) How many and where Data growth DB: What and Why A Database is a shared collection of logically related data,
Review. Fundamentals of Website Development. Web Extensions Server side & Where is your JOB? The Department of Computer Science 11/30/2015
Fundamentals of Website Development CSC 2320, Fall 2015 The Department of Computer Science Review Web Extensions Server side & Where is your JOB? 1 In this chapter Dynamic pages programming Database Others
Practical Course in Genome Bioinformatics
Practical Course in Genome Bioinformatics 20/01/2017 Exercises - Day 1 http://ekhidna.biocenter.helsinki.fi/downloads/teaching/spring2017/ Answer questions Q1-Q3 below and include requested Figures 1-5
HymenopteraMine Documentation
HymenopteraMine Documentation Release 1.0 Aditi Tayal, Deepak Unni, Colin Diesh, Chris Elsik, Darren Hagen Apr 06, 2017 Contents 1 Welcome to HymenopteraMine 3 1.1 Overview of HymenopteraMine.....................................
Genome Browser. Background and Strategy. 12 April 2010
Genome Browser Background and Strategy 12 April 2010 I. Background 1. Project definition 2. Survey of genome browsers II. Strategy Alejandro Caro, Chandni Desai, Neha Gupta, Jay Humphrey, Chengwei Luo,
The UCSC Gene Sorter, Table Browser & Custom Tracks
The UCSC Gene Sorter, Table Browser & Custom Tracks Advanced searching and discovery using the UCSC Table Browser and Custom Tracks Osvaldo Graña Bioinformatics Unit, CNIO 1 Table Browser and Custom Tracks
Tutorial: How to use the Wheat TILLING database
Tutorial: How to use the Wheat TILLING database Last Updated: 9/7/16 1. Visit http://dubcovskylab.ucdavis.edu/wheat_blast to go to the BLAST page or click on the Wheat BLAST button on the homepage. 2.
NextBrowse: An integrated and interactive web-based genome browser for analyzing and interpreting genomic data
NextBrowse: An integrated and interactive web-based genome browser for analyzing and interpreting genomic data Phillip J. Whisenhunt Thesis submitted to the Faculty of the Virginia Polytechnic Institute
Abstract. of biological data of high variety, heterogeneity, and semi-structured nature, and the increasing
Paper ID# SACBIO-129 HAVING A BLAST: ANALYZING GENE SEQUENCE DATA WITH BLASTQUEST WHERE DO WE GO FROM HERE? Abstract In this paper, we pursue two main goals. First, we describe a new tool called BlastQuest,
RNA-seq. Manpreet S. Katari
RNA-seq Manpreet S. Katari Evolution of Sequence Technology Normalizing the Data RPKM (Reads per Kilobase of exons per million reads) Score = R NT R = # of unique reads for the gene N = Size of the gene
2) NCBI BLAST tutorial This is a users guide written by the education department at NCBI.
Web resources -- Tour. page 1 of 8 This is a guided tour. Any homework is separate. In fact, this exercise is used for multiple classes and is publicly available to everyone. The entire tour will take
Wilson Leung 01/03/2018 An Introduction to NCBI BLAST. Prerequisites: Detecting and Interpreting Genetic Homology: Lecture Notes on Alignment
An Introduction to NCBI BLAST Prerequisites: Detecting and Interpreting Genetic Homology: Lecture Notes on Alignment Resources: The BLAST web server is available at https://blast.ncbi.nlm.nih.gov/blast.cgi
Using WebGBrowse to Visualize Genome Annotation on GBrowse
Protocol Using WebGBrowse to Visualize Genome Annotation on GBrowse Ram Podicheti and Qunfeng Dong 1 Center for Genomics and Bioinformatics, Indiana University, Bloomington, IN 47405, USA INTRODUCTION
Princess Nourah bint Abdulrahman University. Computer Sciences Department
Princess Nourah bint Abdulrahman University Computer Sciences Department 1 And use http://www.w3schools.com/ PHP Part 1 Objectives Introduction to PHP Computer Sciences Department 4 Introduction HTML CSS
Genomics 92 (2008) Contents lists available at ScienceDirect. Genomics. journal homepage:
Genomics 92 (2008) 75 84 Contents lists available at ScienceDirect Genomics journal homepage: www.elsevier.com/locate/ygeno Review UCSC genome browser tutorial Ann S. Zweig a,, Donna Karolchik a, Robert
Let's Play... Try to name the databases described on the following slides...
Database Software Let's Play... Try to name the databases described on the following slides... "World's most popular" Free relational database system (RDBMS) that... the "M" in "LAMP" and "XAMP" stacks
Wilson Leung 05/27/2008 A Simple Introduction to NCBI BLAST
A Simple Introduction to NCBI BLAST Prerequisites: Detecting and Interpreting Genetic Homology: Lecture Notes on Alignment Resources: The BLAST web server is available at http://www.ncbi.nih.gov/blast/
COMPARATIVE MICROBIAL GENOMICS ANALYSIS WORKSHOP. Exercise 2: Predicting Protein-encoding Genes, BlastMatrix, BlastAtlas
COMPARATIVE MICROBIAL GENOMICS ANALYSIS WORKSHOP Exercise 2: Predicting Protein-encoding Genes, BlastMatrix, BlastAtlas First of all connect once again to the CBS system: Open ssh shell client. Press Quick
ChIP-seq (NGS) Data Formats
ChIP-seq (NGS) Data Formats Biological samples Sequence reads SRA/SRF, FASTQ Quality control SAM/BAM/Pileup?? Mapping Assembly... DE Analysis Variant Detection Peak Calling...? Counts, RPKM VCF BED/narrowPeak/
Our Task At Hand Aggregate data from every group
Where magical things happen Our Task At Hand Aggregate data from every group That s not too bad? Make it accessible to the public Just some basic HTML? Simple enough, right? Our Real Task Manage 1 million+
Manual of mirdeepfinder for EST or GSS
Manual of mirdeepfinder for EST or GSS Index 1. Description 2. Requirement 2.1 requirement for Windows system 2.1.1 Perl 2.1.2 Install the module DBI 2.1.3 BLAST++ 2.2 Requirement for Linux System 2.2.1
Part 1: How to use IGV to visualize variants
Using IGV to identify true somatic variants from the false variants http://www.broadinstitute.org/igv A FAQ, sample files and a user guide are available on IGV website If you use IGV in your publication:
replace my_user_id in the commands with your actual user ID
Exercise 1. Alignment with TOPHAT Part 1. Prepare the working directory. 1. Find out the name of the computer that has been reserved for you (https://cbsu.tc.cornell.edu/ww/machines.aspx?i=57 ). Everyone
Creating an Online Catalogue Search for CD Collection with AJAX, XML, and PHP Using a Relational Database Server on WAMP/LAMP Server
CIS408 Project 5 SS Chung Creating an Online Catalogue Search for CD Collection with AJAX, XML, and PHP Using a Relational Database Server on WAMP/LAMP Server The catalogue of CD Collection has millions
Today's outline. Resources. Genome browser components. Genome browsers: Discovering biology through genomics. Genome browser tutorial materials
Today's outline Genome browsers: Discovering biology through genomics BaRC Hot Topics April 2013 George Bell, Ph.D. http://jura.wi.mit.edu/bio/education/hot_topics/ Genome browser introduction Popular
Cleveland State University Department of Electrical and Computer Engineering. CIS 408: Internet Computing
Cleveland State University Department of Electrical and Computer Engineering CIS 408: Internet Computing Catalog Description: CIS 408 Internet Computing (-0-) Pre-requisite: CIS 265 World-Wide Web is now
All India Council For Research & Training
WEB DEVELOPMENT & DESIGNING Are you looking for a master program in web that covers everything related to web? Then yes! You have landed up on the right page. Web Master Course is an advanced web designing,
a Very Short Introduction to AngularJS
a Very Short Introduction to AngularJS Lecture 11 CGS 3066 Fall 2016 November 8, 2016 Frameworks Advanced JavaScript programming (especially the complex handling of browser differences), can often be very
Demo 1: Free text search of ENCODE data
Demo 1: Free text search of ENCODE data 1. Go to h(ps://www.encodeproject.org 2. Enter skin into the search box on the upper right hand corner 3. All matches on the website will be shown 4. Select Experiments
BrownNow A Current Events Application for Brown University. Craig Hawkins Advisor: Stan Zdonik Masters Project Report, Brown University 2017
BrownNow A Current Events Application for Brown University Craig Hawkins Advisor: Stan Zdonik Masters Project Report, Brown University 2017 1. Introduction Brown University has an existing events notification
Advanced UCSC Browser Functions
Advanced UCSC Browser Functions Dr. Thomas Randall tarandal@email.unc.edu bioinformatics.unc.edu UCSC Browser: genome.ucsc.edu Overview Custom Tracks adding your own datasets Utilities custom tools for
JBrowse. To get started early: Double click VirtualBox on the desktop Click JBrowse 2016 Tutorial Click Start
JBrowse To get started early: Double click VirtualBox on the desktop Click JBrowse 2016 Tutorial Click Start JBrowse PAG 2015 Scott Cain GMOD Coordinator scott@scottcain.net What is GMOD? A set of interoperable
Applied Bioinformatics
Applied Bioinformatics Course Overview & Introduction to Linux Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu What is bioinformatics Bio Bioinformatics
Applied Bioinformatics
Applied Bioinformatics Course Overview & Introduction to Linux Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu What is bioinformatics Bio Bioinformatics
Sequencing Data. Paul Agapow 2011/02/03
Webservices for Next Generation Sequencing Data Paul Agapow 2011/02/03 Aims Assumed parameters: Must have a system for non-technical users to browse and manipulate their Next Generation Sequencing (NGS)
Project Plan Medication Shortages Dashboard
Project Plan Medication Shortages Dashboard The Capstone Experience Team Spectrum Health Aaron Cosentino Eric Dostie Ramata Koumare Grayson Wright Department of Computer Science and Engineering Michigan
Public Repositories Tutorial: Bulk Downloads
Public Repositories Tutorial: Bulk Downloads Almost all of the public databases, genome browsers, and other tools you have explored so far offer some form of access to rapidly download all or large chunks
The UCSC Genome Browser
The UCSC Genome Browser UNIT 1.4 The rapid progress of public sequencing and mapping efforts on vertebrate genomes has increased the demand for tools that offer quick and easy access to the data at many
Bioinformatics in next generation sequencing projects
Bioinformatics in next generation sequencing projects Rickard Sandberg Assistant Professor Department of Cell and Molecular Biology Karolinska Institutet March 2011 Once sequenced the problem becomes computational
Demo 1: Free text search of ENCODE data
Demo 1: Free text search of ENCODE data 1. Go to h(ps://www.encodeproject.org 2. Enter skin into the search box on the upper right hand corner 3. All matches on the website will be shown 4. Select Experiments
Two Examples of Datanomic. David Du Digital Technology Center Intelligent Storage Consortium University of Minnesota
Two Examples of Datanomic David Du Digital Technology Center Intelligent Storage Consortium University of Minnesota Datanomic Computing (Autonomic Storage) System behavior driven by characteristics of
Tutorial 4 BLAST Searching the CHO Genome
Tutorial 4 BLAST Searching the CHO Genome Accessing the CHO Genome BLAST Tool The CHO BLAST server can be accessed by clicking on the BLAST button on the home page or by selecting BLAST from the menu bar
Our data for today is a small subset of Saimaa ringed seal RNA sequencing data (RNA_seq_reads.fasta). Let s first see how many reads are there:
Practical Course in Genome Bioinformatics 19.2.2016 (CORRECTED 22.2.2016) Exercises - Day 5 http://ekhidna.biocenter.helsinki.fi/downloads/teaching/spring2016/ Answer the 5 questions (Q1-Q5) according
User Manual. Ver. 3.0 March 19, 2012
User Manual Ver. 3.0 March 19, 2012 Table of Contents 1. Introduction... 2 1.1 Rationale... 2 1.2 Software Work-Flow... 3 1.3 New in GenomeGems 3.0... 4 2. Software Description... 5 2.1 Key Features...
RNA-Seq in Galaxy: Tuxedo protocol. Igor Makunin, UQ RCC, QCIF
RNA-Seq in Galaxy: Tuxedo protocol Igor Makunin, UQ RCC, QCIF Acknowledgments Genomics Virtual Lab: gvl.org.au Galaxy for tutorials: galaxy-tut.genome.edu.au Galaxy Australia: galaxy-aust.genome.edu.au
RNA-Seq Analysis With the Tuxedo Suite
June 2016 RNA-Seq Analysis With the Tuxedo Suite Dena Leshkowitz Introduction In this exercise we will learn how to analyse RNA-Seq data using the Tuxedo Suite tools: Tophat, Cuffmerge, Cufflinks and Cuffdiff.
Maize genome sequence in FASTA format. Gene annotation file in gff format
Exercise 1. Using Tophat/Cufflinks to analyze RNAseq data. Step 1. One of CBSU BioHPC Lab workstations has been allocated for your workshop exercise. The allocations are listed on the workshop exercise
Case Study. CMS for Management of Monetization Training Resources
Case Study CMS for Management of Monetization Training Resources Client Requirement The client is a digital marketing company providing efficient strategies for marketing and data monetization to their
SolexaLIMS: A Laboratory Information Management System for the Solexa Sequencing Platform
SolexaLIMS: A Laboratory Information Management System for the Solexa Sequencing Platform Brian D. O Connor, 1, Jordan Mendler, 1, Ben Berman, 2, Stanley F. Nelson 1 1 Department of Human Genetics, David
Bioinformatics. Computational Methods I: Genomic Resources and Unix. George Bell WIBR Biocomputing Group
Bioinformatics Computational Methods I: Genomic Resources and Unix George Bell WIBR Biocomputing Group Human genome databases Human Genome Sequencing Consortium Major annotators: NCBI Ensembl (EMBL-EBI
Advanced genome browsers: Integrated Genome Browser and others Heiko Muller Computational Research
Genomic Computing, DEIB, 4-7 March 2013 Advanced genome browsers: Integrated Genome Browser and others Heiko Muller Computational Research IIT@SEMM heiko.muller@iit.it List of Genome Browsers Alamut Annmap
[v1.2] SIMBA docs LGCM Federal University of Minas Gerais 2015
![[v1.2] SIMBA docs LGCM Federal University of Minas Gerais 2015](/thumbs/81/84357512.jpg "[v1.2] SIMBA docs LGCM Federal University of Minas Gerais 2015")
[v1.2] SIMBA docs LGCM Federal University of Minas Gerais 2015 2 Summary 1. Introduction... 3 1.1 Why use SIMBA?... 3 1.2 How does SIMBA work?... 4 1.3 How to download SIMBA?... 4 1.4 SIMBA VM... 4 2.
Inf 202 Introduction to Data and Databases (Spring 2010)
Inf 202 Introduction to Data and Databases (Spring 2010) Jagdish S. Gangolly Informatics CCI SUNY Albany April 22, 2010 Database Processing Applications Standard Database Processing Client/Server Environment
Exon Probeset Annotations and Transcript Cluster Groupings
Exon Probeset Annotations and Transcript Cluster Groupings I. Introduction This whitepaper covers the procedure used to group and annotate probesets. Appropriate grouping of probesets into transcript clusters
Dr. Gabriela Salinas Dr. Orr Shomroni Kaamini Rhaithata
Analysis of RNA sequencing data sets using the Galaxy environment Dr. Gabriela Salinas Dr. Orr Shomroni Kaamini Rhaithata Microarray and Deep-sequencing core facility 30.10.2017 RNA-seq workflow I Hypothesis
ESG: Extended Similarity Group Job Submission
ESG: Extended Similarity Group Job Submission Cite: Meghana Chitale, Troy Hawkins, Changsoon Park, & Daisuke Kihara ESG: Extended similarity group method for automated protein function prediction, Bioinformatics,
WebDev. Web Design COMBINES A NUMBER OF DISCIPLINES. Web Development Process DESIGN DEVELOPMENT CONTENT MULTIMEDIA
WebDev Site Construction is one of the last steps The Site Development Process http://webstyleguide.com Web Design COMBINES A NUMBER OF DISCIPLINES DESIGN CONTENT Interaction Designers User Interface Designers
Genome Browser. Shruti Bhide Abhiram Das Khanjan Gandhi Viswateja Nelakuditi
Genome Browser Shruti Bhide Abhiram Das Khanjan Gandhi Viswateja Nelakuditi Present Scenario Need of Databases and Genome Browser Present Scenario Need of Databases and Genome Browser Put all the ingredients
Ajax On Rails: Build Dynamic Web Applications With Ruby By Scott Raymond READ ONLINE
Ajax On Rails: Build Dynamic Web Applications With Ruby By Scott Raymond READ ONLINE Let's take a look at how we can accomplish this with AJAX in Rails. Overall, I was quite surprised at how easy it is
Gegenees genome format...7. Gegenees comparisons...8 Creating a fragmented all-all comparison...9 The alignment The analysis...
User Manual: Gegenees V 1.1.0 What is Gegenees?...1 Version system:...2 What's new...2 Installation:...2 Perspectives...4 The workspace...4 The local database...6 Populate the local database...7 Gegenees
CLC Server. End User USER MANUAL
CLC Server End User USER MANUAL Manual for CLC Server 10.0.1 Windows, macos and Linux March 8, 2018 This software is for research purposes only. QIAGEN Aarhus Silkeborgvej 2 Prismet DK-8000 Aarhus C Denmark
GEP Project Management System: Annotation Project Submission
GEP Project Management System: Annotation Project Submission Author Wilson Leung wleung@wustl.edu Document History Initial Draft 06/04/2007 First Revision 01/11/2009 Second Revision 01/08/2010 Third Revision
Standard 1 The student will author web pages using the HyperText Markup Language (HTML)
I. Course Title Web Application Development II. Course Description Students develop software solutions by building web apps. Technologies may include a back-end SQL database, web programming in PHP and/or
Software review. Shopping in the genome market with EnsMart
Shopping in the genome market with EnsMart Keywords: genome databases, human genome, comparative genomics, data mining, open source software Abstract Life scientists who work with the supermarket of genome
Jquery Ajax Json Php Mysql Data Entry Example
Jquery Ajax Json Php Mysql Data Entry Example Then add required assets in head which are jquery library, datatable js library and css By ajax api we can fetch json the data from employee-grid-data.php.
Sequence Analysis Pipeline
Sequence Analysis Pipeline Transcript fragments 1. PREPROCESSING 2. ASSEMBLY (today) Removal of contaminants, vector, adaptors, etc Put overlapping sequence together and calculate bigger sequences 3. Analysis/Annotation
Package sapfinder. R topics documented: April 11, Type Package
Type Package Package sapfinder April 11, 2019 Title A package for variant peptides detection and visualization in shotgun proteomics. Version 1.20.1 Date 2014-11-21 Author Shaohang Xu, Bo Wen Maintainer
PHP & My SQL Duration-4-6 Months
PHP & My SQL Duration-4-6 Months Overview of the PHP & My SQL Introduction of different Web Technology Working with the web Client / Server Programs Server Communication Sessions Cookies Typed Languages
NGS Data Analysis. Roberto Preste
NGS Data Analysis Roberto Preste 1 Useful info http://bit.ly/2r1y2dr Contacts: roberto.preste@gmail.com Slides: http://bit.ly/ngs-data 2 NGS data analysis Overview 3 NGS Data Analysis: the basic idea http://bit.ly/2r1y2dr
Ampliación de Bases de Datos
1. Introduction to In this course, we are going to use: Apache web server PHP installed as a module for Apache Database management system MySQL and the web application PHPMyAdmin to administrate it. It
Bioinformatics Data Distribution and Integration via Web Services and XML
Letter Bioinformatics Data Distribution and Integration via Web Services and XML Xiao Li and Yizheng Zhang* College of Life Science, Sichuan University/Sichuan Key Laboratory of Molecular Biology and Biotechnology,
Assessing Transcriptome Assembly
Assessing Transcriptome Assembly Matt Johnson July 9, 2015 1 Introduction Now that you have assembled a transcriptome, you are probably wondering about the sequence content. Are the sequences from the
MASTERS COURSE IN FULL STACK WEB APPLICATION DEVELOPMENT W W W. W E B S T A C K A C A D E M Y. C O M
MASTERS COURSE IN FULL STACK WEB APPLICATION DEVELOPMENT W W W. W E B S T A C K A C A D E M Y. C O M COURSE OBJECTIVES Enable participants to develop a complete web application from the scratch that includes
TRAPPIST: A toolkit for comparative analysis and visualization of genomic regions
TRAPPIST: A toolkit for comparative analysis and visualization of genomic regions Geraldine A. Van der Auwera, PhD https://github.com/gglobster/trappist " TRAPPIST: A toolkit for comparative analysis and
Upload to your web space (e.g., UCSC) Due this Thursday 4/8 in class Deliverable: Send me an with the URL Grading:
CS 183 4/6/2010 Build a simple HTML page, topic of your choice Will use this as a basis and gradually and add more features as the class progresses Need to be done with your favorite text editor, no visual
mpmorfsdb: A database of Molecular Recognition Features (MoRFs) in membrane proteins. Introduction
mpmorfsdb: A database of Molecular Recognition Features (MoRFs) in membrane proteins. Introduction Molecular Recognition Features (MoRFs) are short, intrinsically disordered regions in proteins that undergo
Ensembl RNASeq Practical. Overview
Ensembl RNASeq Practical The aim of this practical session is to use BWA to align 2 lanes of Zebrafish paired end Illumina RNASeq reads to chromosome 12 of the zebrafish ZV9 assembly. We have restricted
The Galaxy Track Browser: Transforming the Genome Browser from Visualization Tool to Analysis Tool
The Galaxy Track Browser: Transforming the Genome Browser from Visualization Tool to Analysis Tool Jeremy Goecks * Kanwei Li Ω Dave Clements ℵ The Galaxy Team James Taylor ℇ Emory University Emory University
Tutorial. RNA-Seq Analysis of Breast Cancer Data. Sample to Insight. November 21, 2017
RNA-Seq Analysis of Breast Cancer Data November 21, 2017 Sample to Insight QIAGEN Aarhus Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 www.qiagenbioinformatics.com AdvancedGenomicsSupport@qiagen.com
A generic and modular platform for automated sequence processing and annotation. Arthur Gruber
2 A generic and modular platform for automated sequence processing and annotation Arthur Gruber Instituto de Ciências Biomédicas Universidade de São Paulo AG-ICB-USP 2 Sequence processing and annotation