CS 268: IP Multicast Routing
|
|
- Dustin Patrick Fitzgerald
- 5 years ago
- Views:
Transcription
1 Motivtion CS 268: IP Multicst Routing Ion Stoic April 5, 2004 Mny pplictions requires one-to-mny communiction - E.g., video/udio conferencing, news dissemintion, file updtes, etc. Using unicst to replicte pckets not efficient thus, IP multicst needed - Wht bout the e2e rguments? istoic@cs.berkeley.edu 2 Open group semntic Semntic - A group is identified by loction-independent ddress - Any source (not necessry in the group) cn multicst to ll members in group Advntges: - Query n object/service when its loction is not known Disdvntge - Difficult to protect ginst unuthorized listeners Multicst delivery widely vilble on individul LANs - Exmple: Ethernet multicst But not cross interconnection of LANs istoic@cs.berkeley.edu 3 istoic@cs.berkeley.edu 4 Three Approches [Deering & Cheriton 89] Single spnning-tree (T) Distnce-vector multicst (DVM) Link-stte multicst (LSM) Also: Sketches hierrchicl multicst Multicst Service Model Built round the notion of group of hosts: - Senders nd receivers need not know bout ech other Sender simply sends pckets to logicl group ddress No restriction on number or loction of receivers - Applictions my impose limits Norml, best-effort delivery semntics of IP istoic@cs.berkeley.edu 5 istoic@cs.berkeley.edu 6 1
2 Multicst Service Model (cont d) Dynmic membership - Hosts cn join/leve t will No synchroniztion or negotition - Cn be implemented higher lyer if desired Key Design Gols 1. Delivery efficiency s good s unicst 2. Low join ltency 3. Low leve ltency istoic@cs.berkeley.edu 7 istoic@cs.berkeley.edu 8 Network Model Distnce Vector Multicst Routing Interconnected LANs LANs support link-level multicst Mp globlly unique multicst ddress to LAN-bsed multicst ddress (LAN-specific lgorithm) An elegnt extension to DV routing Use shortest pth DV routes to determine if link is on the source-rooted spnning tree istoic@cs.berkeley.edu 9 istoic@cs.berkeley.edu 10 Reverse Pth Flooding (RPF) A router forwrds brodcst pcket from source (S) iff it rrives vi the shortest pth from the router bck to S Pcket is replicted out ll but the incoming interfce Reverse shortest pths esy to compute just use info in DV routing tbles - DV gives shortest reverse pths - Works if costs re symmetric Forwrd pckets tht rrives tt on shortest pth from t to S (ssume symmetric routes) istoic@cs.berkeley.edu 11 Flooding cn cuse given pcket to be sent multiple times over the sme link duplicte pcket b Solution: Reverse Pth Brodcsting istoic@cs.berkeley.edu 12 2
3 Reverse Pth Brodcsting (RPB) Bsic ide: forwrd pcket from S only on child links for S Child link of router R for source S: link tht hs R s prent on the shortest pth from the link to S Identify Child Links Routing updtes identify prent Since distnces re known, ech router cn esily figure out if it's the prent for given link In cse of tie, lower ddress wins 5 6 forwrd only to child link child link of x for S b istoic@cs.berkeley.edu 13 istoic@cs.berkeley.edu 14 Truncted RBP This is still brodcst lgorithm the trffic goes everywhere First order solution: Truncted RPB Don't forwrd trffic onto network with no receivers 1. Identify leves 2. Detect group membership in lef istoic@cs.berkeley.edu 15 istoic@cs.berkeley.edu 16 Reverse Pth Multicst (RPM) Bsic RPM Ide Prune bck trnsmission so tht only bsolutely necessry links crry trffic Use on-demnd pruning so tht router group stte scles with number of ctive groups (not ll groups) Prune (Source,Group) t lef if no members - Send Non-Membership Report (NMR) up tree If ll children of router R prune (S,G) - Propgte prune for (S,G) to prent R On timeout: - Prune dropped - Flow is reinstted - Down strem routers re-prune Note: gin soft-stte pproch istoic@cs.berkeley.edu 17 istoic@cs.berkeley.edu 18 3
4 Detils RMP Scling How to pick prune timers? - Too long lrge join time - Too short high control overhed Wht do you do when member of group (re)joins? - Issue prune-cncelltion messge (grfts) Both NRM nd grft messges re positively cknowledged (why?) Stte requirements: - O(Sources Groups) ctive stte How to get better scling? - Hierrchicl Multicst - Core-bsed Trees istoic@cs.berkeley.edu 19 istoic@cs.berkeley.edu 20 Core Bsed Trees (CBT) Exmple Bllrdie, Frncis, nd Crowcroft, - Core Bsed Trees (CBT): An Architecture for Sclble Inter- Domin Multicst Routing, SIGCOMM 93 Similr to Deering s Single-Spnning Tree Unicst pcket to core nd bounce it bck to multicst group Tree construction is receiver-bsed - One tree per group - Only nodes on tree involved Reduce routing tble stte from O(S x G) to O(G) Group members: M1, M2, M3 M1 sends dt M1 control (join) messges dt M2 root M3 istoic@cs.berkeley.edu 21 istoic@cs.berkeley.edu 22 Disdvntges IP Multicst Revisited Sub-optiml dely Smll, locl groups with non-locl core - Need good core selection - Optiml choice (computing topologicl center) is NP complete Despite mny yers of reserch nd mny compelling pplictions, nd despite the fct tht the mny of tody routers implement IP multicst, this is still not widely deployed Why? istoic@cs.berkeley.edu 23 istoic@cs.berkeley.edu 24 4
5 Possible Explntions [Holbrook & Cheriton 99] Solution: EXPRE Violtes ISP input-rte-bsed billing model - No incentive for ISPs to enble multicst! No indiction of group size (gin needed for billing) Hrd to implement sender control ny node cn send to the group (remember open group semntic?) Multicst ddress scrcity Limit to single source group Use both source nd destintion IP fields to define group - Ech source cn llocte 16 millions chnnels (i.e., multicst groups) Use RPM lgorithm Add counting mechnism - Use recursive CountQuery messge Use session rely pproch to implement multiple source multicst trees istoic@cs.berkeley.edu 25 istoic@cs.berkeley.edu 26 Summry Deering s DV-RMP n elegnt extension of DV routing CBT ddresses some of the DV-RMP sclbility concerns but is sub-optiml nd less robust Protocol Independent Multicst (PIM) - Sprse mode similr to CBT - Dense mode similr to DV-RPM Lesson: economic incentives plys mjor role in deploying technicl solution - See EXPRE work istoic@cs.berkeley.edu 27 5
CS 268: IP Multicast Routing
Motivation CS 268: IP Multicast Routing Ion Stoica April 8, 2003 Many applications requires one-to-many communication - E.g., video/audio conferencing, news dissemination, file updates, etc. Using unicast
More informationNetwork Interconnection: Bridging CS 571 Fall Kenneth L. Calvert All rights reserved
Network Interconnection: Bridging CS 57 Fll 6 6 Kenneth L. Clvert All rights reserved The Prolem We know how to uild (rodcst) LANs Wnt to connect severl LANs together to overcome scling limits Recll: speed
More informationMulticast EECS 122: Lecture 16
Multicast EECS 1: Lecture 16 Department of Electrical Engineering and Computer Sciences University of California Berkeley Broadcasting to Groups Many applications are not one-one Broadcast Group collaboration
More informationLooking up objects in Pastry
Review: Pstry routing tbles 0 1 2 3 4 7 8 9 b c d e f 0 1 2 3 4 7 8 9 b c d e f 0 1 2 3 4 7 8 9 b c d e f 0 2 3 4 7 8 9 b c d e f Row0 Row 1 Row 2 Row 3 Routing tble of node with ID i =1fc s - For ech
More informationNetwork Layer: Routing Classifications; Shortest Path Routing
igitl ommuniction in the Modern World : Routing lssifictions; Shortest Pth Routing s min prolem: To get efficiently from one point to the other in dynmic environment http://.cs.huji.c.il/~com com@cs.huji.c.il
More informationIP: Network Layer. Goals and Tasks. Routing. Switching. Switching (cont.) Datagram v/s Virtual Circuit. Overview Addressing Routing
IP: Network Lyer Overview Addressing Routing Overview Gols nd Tsks Routing Switching Issues Bsic ides TOC IP TOC IP Overview Gols nd Tsks Gols of Network Lyer Guide pckets from source to destintion Use
More informationNetworking Acronym Smorgasbord: , DVMRP, CBT, WFQ
Networking Acronym Smorgasbord: 802.11, DVMRP, CBT, WFQ EE122 Fall 2011 Scott Shenker http://inst.eecs.berkeley.edu/~ee122/ Materials with thanks to Jennifer Rexford, Ion Stoica, Vern Paxson and other
More informationCSE 123A Computer Networks
CSE 123A Computer Networks Winter 2005 Lecture 12 Internet Routing: Multicast Today: Multicast routing Multicast service model Host interface Host-router interactions (IGMP) Multicast Routing Limiters
More informationMulticast service model Host interface Host-router interactions (IGMP) Multicast Routing Distance Vector Link State. Shared tree.
CSE 123A Computer Networks Fall 2009 Lecture 10 Internet Routing: Multicast Today: Multicast routing Multicast service model Host interface Host-router interactions (IGMP) Multicast Routing Distance Vector
More informationChapter 7. Routing with Frame Relay, X.25, and SNA. 7.1 Routing. This chapter discusses Frame Relay, X.25, and SNA Routing. Also see the following:
Chpter 7 Routing with Frme Rely, X.25, nd SNA This chpter discusses Frme Rely, X.25, nd SNA Routing. Also see the following: Section 4.2, Identifying the BANDIT in the Network Section 4.3, Defining Globl
More informationIST 220: Ch3-Transport Layer
ST 220: Ch3-Trns Lyer Abdullh Konk School of nformtion Sciences nd Technology Penn Stte Berks Lerning Objectives. Understnd position of trns lyer in nternet model. Understnd rtionle for extence of trns
More informationCS4700/CS5700 Fundamentals of Computer Networks
CS4700/CS5700 Fundamentals of Computer Networks Lecture 19: Multicast Routing Slides used with permissions from Edward W. Knightly, T. S. Eugene Ng, Ion Stoica, Hui Zhang Alan Mislove amislove at ccs.neu.edu
More informationAnnouncements. EECS 122: Introduction to Computer Networks Multicast and Overlay Networks. Motivational Example: Streaming Media
Announcements EEC : Introduction to Computer Networks Multicast and Overlay Networks Ion toica (and Brighten Godfrey) TAs: Lucian Popa, David Zats and Ganesh Ananthanarayanan http://inst.eecs.berkeley.edu/~ee/
More informationTCP/ICN: Carrying TCP over Content Centric and Named Data Networks
TCP/ICN: Crrying TCP over Content Centric nd Nmed Dt Networks Ily Moiseenko Cisco Systems Dve Orn Cisco Systems Outline I. Introduction II. Design Bsic fetching proxy Relible prefetching proxy Unrelible
More informationToday. Search Problems. Uninformed Search Methods. Depth-First Search Breadth-First Search Uniform-Cost Search
Uninformed Serch [These slides were creted by Dn Klein nd Pieter Abbeel for CS188 Intro to AI t UC Berkeley. All CS188 mterils re vilble t http://i.berkeley.edu.] Tody Serch Problems Uninformed Serch Methods
More informationTransparent neutral-element elimination in MPI reduction operations
Trnsprent neutrl-element elimintion in MPI reduction opertions Jesper Lrsson Träff Deprtment of Scientific Computing University of Vienn Disclimer Exploiting repetition nd sprsity in input for reducing
More informationA Priority-based Distributed Call Admission Protocol for Multi-hop Wireless Ad hoc Networks
A Priority-bsed Distributed Cll Admission Protocol for Multi-hop Wireless Ad hoc Networks un Sun Elizbeth M. Belding-Royer Deprtment of Computer Science University of Cliforni, Snt Brbr suny, ebelding
More informationPhylogeny and Molecular Evolution
Phylogeny nd Moleculr Evolution Chrcter Bsed Phylogeny 1/50 Credit Ron Shmir s lecture notes Notes by Nir Friedmn Dn Geiger, Shlomo Morn, Sgi Snir nd Ron Shmir Durbin et l. Jones nd Pevzner s presenttion
More informationA dynamic multicast tree based routing scheme without replication in delay tolerant networks
Accepted Mnuscript A dynmic multicst tree bsed routing scheme without repliction in dely tolernt networks Yunsheng Wng, Jie Wu PII: S0-()00- DOI: 0.0/j.jpdc.0..00 Reference: YJPDC To pper in: J. Prllel
More informationDistributed Systems Principles and Paradigms
Distriuted Systems Principles nd Prdigms Chpter 11 (version April 7, 2008) Mrten vn Steen Vrije Universiteit Amsterdm, Fculty of Science Dept. Mthemtics nd Computer Science Room R4.20. Tel: (020) 598 7784
More informationIZT DAB ContentServer, IZT S1000 Testing DAB Receivers Using ETI
IZT DAB ContentServer, IZT S1000 Testing DAB Receivers Using ETI Appliction Note Rel-time nd offline modultion from ETI files Generting nd nlyzing ETI files Rel-time interfce using EDI/ETI IZT DAB CONTENTSERVER
More informationCS201 Discussion 10 DRAWTREE + TRIES
CS201 Discussion 10 DRAWTREE + TRIES DrwTree First instinct: recursion As very generic structure, we could tckle this problem s follows: drw(): Find the root drw(root) drw(root): Write the line for the
More informationRegular Expression Matching with Multi-Strings and Intervals. Philip Bille Mikkel Thorup
Regulr Expression Mtching with Multi-Strings nd Intervls Philip Bille Mikkel Thorup Outline Definition Applictions Previous work Two new problems: Multi-strings nd chrcter clss intervls Algorithms Thompson
More informationDesign and Performance Evaluation of Underwater Data Dissemination Strategies using Interference Avoidance and Network Coding
Design nd Performnce Evlution of Underwter Dt Dissemintion Strtegies using Interference Avoidnce nd Network Coding Rúl Plcios Fbrizio Grnelli University of Trento, Itly Jnus Heide Frnk H.P. Fitzek Alborg
More informationCSCI 446: Artificial Intelligence
CSCI 446: Artificil Intelligence Serch Instructor: Michele Vn Dyne [These slides were creted by Dn Klein nd Pieter Abbeel for CS188 Intro to AI t UC Berkeley. All CS188 mterils re vilble t http://i.berkeley.edu.]
More informationMobile IP route optimization method for a carrier-scale IP network
Moile IP route optimiztion method for crrier-scle IP network Tkeshi Ihr, Hiroyuki Ohnishi, nd Ysushi Tkgi NTT Network Service Systems Lortories 3-9-11 Midori-cho, Musshino-shi, Tokyo 180-8585, Jpn Phone:
More informationCSCI1950 Z Computa4onal Methods for Biology Lecture 2. Ben Raphael January 26, hhp://cs.brown.edu/courses/csci1950 z/ Outline
CSCI1950 Z Comput4onl Methods for Biology Lecture 2 Ben Rphel Jnury 26, 2009 hhp://cs.brown.edu/courses/csci1950 z/ Outline Review of trees. Coun4ng fetures. Chrcter bsed phylogeny Mximum prsimony Mximum
More informationRevisiting the notion of Origin-Destination Traffic Matrix of the Hosts that are attached to a Switched Local Area Network
Interntionl Journl of Distributed nd Prllel Systems (IJDPS) Vol., No.6, November 0 Revisiting the notion of Origin-Destintion Trffic Mtrix of the Hosts tht re ttched to Switched Locl Are Network Mondy
More informationTixeo compared to other videoconferencing solutions
compred to other videoconferencing solutions for V171026EN , unique solution on the video conferencing field Adobe Connect Web RTC Vydio for High security level, privcy Zero impct on network security policies
More informationOverview. Network characteristics. Network architecture. Data dissemination. Network characteristics (cont d) Mobile computing and databases
Overview Mobile computing nd dtbses Generl issues in mobile dt mngement Dt dissemintion Dt consistency Loction dependent queries Interfces Detils of brodcst disks thlis klfigopoulos Network rchitecture
More informationCS 221: Artificial Intelligence Fall 2011
CS 221: Artificil Intelligence Fll 2011 Lecture 2: Serch (Slides from Dn Klein, with help from Sturt Russell, Andrew Moore, Teg Grenger, Peter Norvig) Problem types! Fully observble, deterministic! single-belief-stte
More informationPage 1. This Week. CS 269: Lecture 11 Multicast A Tale of Two Failures. Multicast and QoS: the lost decade. Irony. History. Lectures.
This Week CS 269: Lecture 11 Multicast A Tale of Two Failures Scott Shenker and Ion Stoica Computer Science Division Department of Electrical Engineering and Computer Sciences University of California,
More informationUnit #9 : Definite Integral Properties, Fundamental Theorem of Calculus
Unit #9 : Definite Integrl Properties, Fundmentl Theorem of Clculus Gols: Identify properties of definite integrls Define odd nd even functions, nd reltionship to integrl vlues Introduce the Fundmentl
More informationDynamic Programming. Andreas Klappenecker. [partially based on slides by Prof. Welch] Monday, September 24, 2012
Dynmic Progrmming Andres Klppenecker [prtilly bsed on slides by Prof. Welch] 1 Dynmic Progrmming Optiml substructure An optiml solution to the problem contins within it optiml solutions to subproblems.
More informationScalable Distributed Data Structures: A Survey Λ
Sclble Distributed Dt Structures: A Survey Λ ADRIANO DI PASQUALE University of L Aquil, Itly ENRICO NARDELLI University of L Aquil nd Istituto di Anlisi dei Sistemi ed Informtic, Itly Abstrct This pper
More informationWhat do all those bits mean now? Number Systems and Arithmetic. Introduction to Binary Numbers. Questions About Numbers
Wht do ll those bits men now? bits (...) Number Systems nd Arithmetic or Computers go to elementry school instruction R-formt I-formt... integer dt number text chrs... floting point signed unsigned single
More informationEngineer To Engineer Note
Engineer To Engineer Note EE-186 Technicl Notes on using Anlog Devices' DSP components nd development tools Contct our technicl support by phone: (800) ANALOG-D or e-mil: dsp.support@nlog.com Or visit
More informationSmall Business Networking
Why network is n essentil productivity tool for ny smll business Effective technology is essentil for smll businesses looking to increse the productivity of their people nd business. Introducing technology
More informationLING/C SC/PSYC 438/538. Lecture 21 Sandiway Fong
LING/C SC/PSYC 438/538 Lecture 21 Sndiwy Fong Tody's Topics Homework 8 Review Optionl Homework 9 (mke up on Homework 7) Homework 8 Review Question1: write Prolog regulr grmmr for the following lnguge:
More informationA New Learning Algorithm for the MAXQ Hierarchical Reinforcement Learning Method
A New Lerning Algorithm for the MAXQ Hierrchicl Reinforcement Lerning Method Frzneh Mirzzdeh 1, Bbk Behsz 2, nd Hmid Beigy 1 1 Deprtment of Computer Engineering, Shrif University of Technology, Tehrn,
More informationSmall Business Networking
Why network is n essentil productivity tool for ny smll business Effective technology is essentil for smll businesses looking to increse the productivity of their people nd processes. Introducing technology
More informationA. Design for Tussle
ends v middle Q. wht should network owner do? A. Design for Tussle Bob Briscoe BT Networks Reserch Centre Jun 2004 powerful compromise ends is best, middle is best, ends, middle, ends, middle... bundled
More informationLECT-10, S-1 FP2P08, Javed I.
A Course on Foundtions of Peer-to-Peer Systems & Applictions LECT-10, S-1 CS /799 Foundtion of Peer-to-Peer Applictions & Systems Kent Stte University Dept. of Computer Science www.cs.kent.edu/~jved/clss-p2p08
More informationReadings : Computer Networking. Outline. The Next Internet: More of the Same? Required: Relevant earlier meeting:
Redings 15-744: Computer Networking L-14 Future Internet Architecture Required: Servl pper Extr reding on Mobility First Relevnt erlier meeting: CCN -> Nmed Dt Network 2 Outline The Next Internet: More
More informationCSEP 573 Artificial Intelligence Winter 2016
CSEP 573 Artificil Intelligence Winter 2016 Luke Zettlemoyer Problem Spces nd Serch slides from Dn Klein, Sturt Russell, Andrew Moore, Dn Weld, Pieter Abbeel, Ali Frhdi Outline Agents tht Pln Ahed Serch
More informationSolving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence Winter 2016
Solving Prolems y Serching CS 486/686: Introduction to Artificil Intelligence Winter 2016 1 Introduction Serch ws one of the first topics studied in AI - Newell nd Simon (1961) Generl Prolem Solver Centrl
More informationBonded Internet. Architecture Examples for Replacing or Enhancing Customer MPLS Networks
Bonded Internet Architecture Exmples for Replcing or Enhncing Customer MPLS Networks Bonded Internet Ensuring business customers hve: Fst, Relible, nd Secure ccess to their Cloud pplictions nd services
More informationCOMBINATORIAL PATTERN MATCHING
COMBINATORIAL PATTERN MATCHING Genomic Repets Exmple of repets: ATGGTCTAGGTCCTAGTGGTC Motivtion to find them: Genomic rerrngements re often ssocited with repets Trce evolutionry secrets Mny tumors re chrcterized
More informationSmall Business Networking
Why network is n essentil productivity tool for ny smll business Effective technology is essentil for smll businesses looking to increse the productivity of their people nd business. Introducing technology
More informationSolving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence
Solving Prolems y Serching CS 486/686: Introduction to Artificil Intelligence 1 Introduction Serch ws one of the first topics studied in AI - Newell nd Simon (1961) Generl Prolem Solver Centrl component
More informationFrom Dependencies to Evaluation Strategies
From Dependencies to Evlution Strtegies Possile strtegies: 1 let the user define the evlution order 2 utomtic strtegy sed on the dependencies: use locl dependencies to determine which ttriutes to compute
More informationRIM: Router Interface Marking for IP Traceback
RIM: Router Interfce Mrking for IP Trcebck Ruiling Chen *, Jung-Min Prk *, nd Rndolph Mrchny * Lbortory for Advnced Reserch in Informtion Assurnce nd Security (ARIAS) * Brdley Deprtment of Electricl nd
More informationRouting: Network Layer Part II
Routing: Network Lyer Prt II Routing & orwrding: Logicl View of Router Routing lgorithms: Link stte vs. istnce Vector Routing in the Internet Intr-S vs. Inter-S routing Intr-S: RIP nd OSP Inter-S: GP nd
More informationPasswords Passwords Changing Passwords... <New Passwords> 130 Setting UIM PIN... <UIM PIN/UIM PIN2> 130 Unlocking a Locked UIM...
Psswords Psswords... 128 Chnging Psswords... 130 Setting UIM PIN... 130 Unlocking Locked UIM... 131 Restricting the Hndset Opertions Locking Function... 131 Locking the
More informationCS481: Bioinformatics Algorithms
CS481: Bioinformtics Algorithms Cn Alkn EA509 clkn@cs.ilkent.edu.tr http://www.cs.ilkent.edu.tr/~clkn/teching/cs481/ EXACT STRING MATCHING Fingerprint ide Assume: We cn compute fingerprint f(p) of P in
More informationComplete Coverage Path Planning of Mobile Robot Based on Dynamic Programming Algorithm Peng Zhou, Zhong-min Wang, Zhen-nan Li, Yang Li
2nd Interntionl Conference on Electronic & Mechnicl Engineering nd Informtion Technology (EMEIT-212) Complete Coverge Pth Plnning of Mobile Robot Bsed on Dynmic Progrmming Algorithm Peng Zhou, Zhong-min
More informationSmall Business Networking
Why network is n essentil productivity tool for ny smll business Effective technology is essentil for smll businesses looking to increse the productivity of their people nd business. Introducing technology
More informationFile Manager Quick Reference Guide. June Prepared for the Mayo Clinic Enterprise Kahua Deployment
File Mnger Quick Reference Guide June 2018 Prepred for the Myo Clinic Enterprise Khu Deployment NVIGTION IN FILE MNGER To nvigte in File Mnger, users will mke use of the left pne to nvigte nd further pnes
More informationSmall Business Networking
Why network is n essentil productivity tool for ny smll business Effective technology is essentil for smll businesses looking to increse the productivity of their people nd processes. Introducing technology
More informationPresentation Martin Randers
Presenttion Mrtin Rnders Outline Introduction Algorithms Implementtion nd experiments Memory consumption Summry Introduction Introduction Evolution of species cn e modelled in trees Trees consist of nodes
More informationThe Network Layer: Routing in the Internet. The Network Layer: Routing & Addressing Outline
CPSC 852 Internetworking The Network Lyer: Routing in the Internet Mihele Weigle Deprtment of Computer Siene Clemson University mweigle@s.lemson.edu http://www.s.lemson.edu/~mweigle/ourses/ps852 1 The
More informationSmall Business Networking
Why network is n essentil productivity tool for ny smll business Effective technology is essentil for smll businesses looking to increse the productivity of their people nd processes. Introducing technology
More informationA Scalable and Reliable Mobile Agent Computation Model
A Sclble nd Relible Mobile Agent Computtion Model Yong Liu, Congfu Xu, Zhohui Wu, nd Yunhe Pn College of Computer Science, Zhejing University Hngzhou 310027, Chin cckffe@yhoo.com.cn Abstrct. This pper
More informationQuestions About Numbers. Number Systems and Arithmetic. Introduction to Binary Numbers. Negative Numbers?
Questions About Numbers Number Systems nd Arithmetic or Computers go to elementry school How do you represent negtive numbers? frctions? relly lrge numbers? relly smll numbers? How do you do rithmetic?
More informationEpson Projector Content Manager Operation Guide
Epson Projector Content Mnger Opertion Guide Contents 2 Introduction to the Epson Projector Content Mnger Softwre 3 Epson Projector Content Mnger Fetures... 4 Setting Up the Softwre for the First Time
More informationEasyMP Network Projection Operation Guide
EsyMP Network Projection Opertion Guide Contents 2 Introduction to EsyMP Network Projection EsyMP Network Projection Fetures... 5 Disply Options... 6 Multi-Screen Disply Function... 6 Movie Sending Mode...
More informationPerformance Evaluation of Dynamic Reconfiguration in High-Speed Local Area Networks
Performnce Evlution of Dynmic Reconfigurtion in High-Speed Locl Are Networks Rfel Csdo, Aurelio Bermúdez, Frncisco J. Quiles, JoséL.Sánchez Depto. de Informátic Universidd de Cstill-L Mnch 271- Albcete,
More informationc360 Add-On Solutions
c360 Add-On Solutions Functionlity Dynmics CRM 2011 c360 Record Editor Reltionship Explorer Multi-Field Serch Alerts Console c360 Core Productivity Pck "Does your tem resist using CRM becuse updting dt
More informationArticle Data Dissemination in Mobile Social Networks With the Acknowledgment Feedback
Article Dt Dissemintion in Mobile Socil Networks With the Acknowledgment Feedbck Ning Wng 1 nd Jie Wu 1 Received: dte ; Accepted: dte ; Published: dte Acdemic Editor: nme 1 Deprtment of Computer nd Informtion
More informationSmall Business Networking
Why network is n essentil productivity tool for ny smll business Effective technology is essentil for smll businesses looking to increse the productivity of their people nd business. Introducing technology
More informationSelf-Organizing Hierarchical Routing for Scalable Ad Hoc Networking
1 Self-Orgnizing Hierrchicl Routing for Sclble Ad Hoc Networking Shu Du Ahmed Khn Sntshil PlChudhuri Ansley Post Amit Kumr Sh Peter Druschel Dvid B. Johnson Rudolf Riedi Rice University Abstrct As devices
More informationToday. CS 188: Artificial Intelligence Fall Recap: Search. Example: Pancake Problem. Example: Pancake Problem. General Tree Search.
CS 88: Artificil Intelligence Fll 00 Lecture : A* Serch 9//00 A* Serch rph Serch Tody Heuristic Design Dn Klein UC Berkeley Multiple slides from Sturt Russell or Andrew Moore Recp: Serch Exmple: Pncke
More informationSmall Business Networking
Why network is n essentil productivity tool for ny smll business Effective technology is essentil for smll businesses looking to increse the productivity of their people nd processes. Introducing technology
More informationBroadcast and Multicast Routing
Broadcast and Multicast Routing Daniel Zappala CS 460 Computer Networking Brigham Young University Group Communication 2/34 How can the Internet provide efficient group communication? send the same copy
More informationReplicating Web Applications On-Demand
Replicting Web Applictions On-Demnd Swminthn Sivsubrmnin Guillume Pierre Mrten vn Steen Dept. of Computer Science, Vrije Universiteit, Amsterdm {swmi,gpierre,steen}@cs.vu.nl Abstrct Mny Web-bsed commercil
More informationUsing Mobile Mules for Collecting Data from an Isolated Wireless Sensor Network
21 9th Interntionl Conference on Prllel Processing Using Mobile Mules for Collecting Dt from n Isolted Wireless ensor Network Yu-Chee Tseng 1, Wn-Ting Li 1, Chi-Fu Hung 2, nd Fng-Jing Wu 1 1 Deprtment
More informationEE122: Multicast. Kevin Lai October 7, 2002
EE122: Multicast Kevin Lai October 7, 2002 Internet Radio www.digitallyimported.com (techno station) - sends out 128Kb/s MP3 music streams - peak usage ~9000 simultaneous streams only 5 unique streams
More informationPerformance analysis of QoS mechanisms in IP networks
University of Wollongong Reserch Online Fculty of Informtics - Ppers (Archive) Fculty of Engineering nd Informtion Sciences 2000 Performnce nlysis of QoS mechnisms in IP networks D. Ji University of Wollongong
More informationEE122: Multicast. Internet Radio. Multicast Service Model 1. Motivation
Internet Radio EE122: Multicast Kevin Lai October 7, 2002 wwwdigitallyimportedcom (techno station) - sends out 128Kb/s MP music streams - peak usage ~9000 simultaneous streams only 5 unique streams (trance,
More informationLCI/USB LonWorks Commissioning Interface
Works Commissioning Interfce Importnt: Retin these instructions CONTENTS 1 Unpcking... 1 2 Storing... 1 3 Instlltion... 1 4 Uninstlling the USB Drivers... 8 5 Disposl... 8 1 UNPACKING Instlltion Instructions
More informationInformation regarding
Informtion regrding LANCOM Advnced VPN Client 3.13 Copyright (c) 2002-2017 LANCOM Systems GmbH, Wuerselen (Germny) LANCOM Systems GmbH does not tke ny gurntee nd libility for softwre not developed, mnufctured
More informationMcAfee Network Security Platform
10/100/1000 Copper Active Fil-Open Bypss Kit Guide Revision E McAfee Network Security Pltform This document descries the contents nd how to instll the McAfee 10/100/1000 Copper Active Fil-Open Bypss Kit
More informationMa/CS 6b Class 1: Graph Recap
M/CS 6 Clss 1: Grph Recp By Adm Sheffer Course Detils Adm Sheffer. Office hour: Tuesdys 4pm. dmsh@cltech.edu TA: Victor Kstkin. Office hour: Tuesdys 7pm. 1:00 Mondy, Wednesdy, nd Fridy. http://www.mth.cltech.edu/~2014-15/2term/m006/
More informationRouters implementations
Routers implementtions Switching Technology S38.65 http://www.netlb.hut.fi/opetus/s3865 L - Router implementtions Generl of routers Functions of n IP router Router rchitectures Introduction to routing
More informationAn Overview of PDF/X. Dov Isaacs Principal Scientist, Workflow & Interoperability Chair, ISO TC130 WG2/TF2, PDF/X April 27, 2011
An Overview of PDF/X Dov Iscs Principl Scientist, Workflow & Interoperbility Chir, ISO TC130 WG2/TF2, PDF/X April 27, 2011 PDF s n Adobe File Formt 1993 to 2008 PDF formt introduced by Adobe with Acrobt
More informationTree Structured Symmetrical Systems of Linear Equations and their Graphical Solution
Proceedings of the World Congress on Engineering nd Computer Science 4 Vol I WCECS 4, -4 October, 4, Sn Frncisco, USA Tree Structured Symmetricl Systems of Liner Equtions nd their Grphicl Solution Jime
More informationAlignment of Long Sequences. BMI/CS Spring 2012 Colin Dewey
Alignment of Long Sequences BMI/CS 776 www.biostt.wisc.edu/bmi776/ Spring 2012 Colin Dewey cdewey@biostt.wisc.edu Gols for Lecture the key concepts to understnd re the following how lrge-scle lignment
More informationSmall Business Networking
Why network is n essentil productivity tool for ny smll business Effective technology is essentil for smll businesses looking to increse the productivity of their people nd processes. Introducing technology
More informationIf you are at the university, either physically or via the VPN, you can download the chapters of this book as PDFs.
Lecture 5 Wlks, Trils, Pths nd Connectedness Reding: Some of the mteril in this lecture comes from Section 1.2 of Dieter Jungnickel (2008), Grphs, Networks nd Algorithms, 3rd edition, which is ville online
More informationAnnouncements. CS 188: Artificial Intelligence Fall Recap: Search. Today. General Tree Search. Uniform Cost. Lecture 3: A* Search 9/4/2007
CS 88: Artificil Intelligence Fll 2007 Lecture : A* Serch 9/4/2007 Dn Klein UC Berkeley Mny slides over the course dpted from either Sturt Russell or Andrew Moore Announcements Sections: New section 06:
More informationMa/CS 6b Class 1: Graph Recap
M/CS 6 Clss 1: Grph Recp By Adm Sheffer Course Detils Instructor: Adm Sheffer. TA: Cosmin Pohot. 1pm Mondys, Wednesdys, nd Fridys. http://mth.cltech.edu/~2015-16/2term/m006/ Min ook: Introduction to Grph
More informationHigh Priority Traffic in HCF on Wireless Networks
High Priority Trffic in HC on Wireless Networks Mo Add, Amnd Pert, Gordon Erly School of Comuting, University of Portsmouth, Lion Terrce, Portsmouth, UK {mo.dd, mnd.ert, gordon.erly }@ort.c.uk Abstrct
More informationEfficient Algorithms For Optimizing Policy-Constrained Routing
Efficient Algorithms For Optimizing Policy-Constrined Routing Andrew R. Curtis curtis@cs.colostte.edu Ross M. McConnell rmm@cs.colostte.edu Dn Mssey mssey@cs.colostte.edu Astrct Routing policies ply n
More informationData Flow on a Queue Machine. Bruno R. Preiss. Copyright (c) 1987 by Bruno R. Preiss, P.Eng. All rights reserved.
Dt Flow on Queue Mchine Bruno R. Preiss 2 Outline Genesis of dt-flow rchitectures Sttic vs. dynmic dt-flow rchitectures Pseudo-sttic dt-flow execution model Some dt-flow mchines Simple queue mchine Prioritized
More informationVoIP for the Small Business
Reducing your telecommunictions costs Reserch firm IDC 1 hs estimted tht VoIP system cn reduce telephony-relted expenses by 30%. Voice over Internet Protocol (VoIP) hs become vible solution for even the
More informationVoIP for the Small Business
Reducing your telecommunictions costs Reserch firm IDC 1 hs estimted tht VoIP system cn reduce telephony-relted expenses by 30%. Voice over Internet Protocol (VoIP) hs become vible solution for even the
More informationCPSC 213. Polymorphism. Introduction to Computer Systems. Readings for Next Two Lectures. Back to Procedure Calls
Redings for Next Two Lectures Text CPSC 213 Switch Sttements, Understnding Pointers - 2nd ed: 3.6.7, 3.10-1st ed: 3.6.6, 3.11 Introduction to Computer Systems Unit 1f Dynmic Control Flow Polymorphism nd
More informationEngineer-to-Engineer Note
Engineer-to-Engineer Note EE-204 Technicl notes on using Anlog Devices DSPs, processors nd development tools Visit our Web resources http://www.nlog.com/ee-notes nd http://www.nlog.com/processors or e-mil
More informationPointwise convergence need not behave well with respect to standard properties such as continuity.
Chpter 3 Uniform Convergence Lecture 9 Sequences of functions re of gret importnce in mny res of pure nd pplied mthemtics, nd their properties cn often be studied in the context of metric spces, s in Exmples
More informationEpson iprojection Operation Guide (Windows/Mac)
Epson iprojection Opertion Guide (Windows/Mc) Contents 2 Introduction to Epson iprojection 5 Epson iprojection Fetures... 6 Connection to Vrious Devices... 6 Four-Pnel Disply... 6 Chnge Presenters nd Projection
More information