A distributed edit-compile workflow

Size: px
Start display at page:

Download "A distributed edit-compile workflow"

Transcription

1 Time Synhroniztion nd Logil Cloks Tody 1. The need for time synhroniztion 2. Wll lok time synhroniztion 3. Logil Time: Lmport Cloks COS 418: Distriuted Systems Leture 4 Kyle Jmieson 2 A distriuted edit-ompile workflow Physil time à 2143 < 2144 è mke doesn t ll ompiler Wht mkes time synhroniztion hrd? 1. Qurtz osilltor sensitive to temperture, ge, virtion, rdition Aury. one prt per million (one seond of lok drift over 12 dys) 2. The internet is: Asynhronous: ritrry messge delys Best-effort: messges don t lwys rrive Lk of time synhroniztion result possile ojet file mismth 3 4 1

2 Tody 1. The need for time synhroniztion 2. Wll lok time synhroniztion Cristin s lgorithm, Berkeley lgorithm, NTP 3. Logil Time: Lmport loks Just use Coordinted Universl Time? UTC is rodst from rdio sttions on lnd nd stellite (e.g., the Glol Positioning System) Computers with reeivers n synhronize their loks with these timing signls Signls from lnd-sed sttions re urte to out milliseonds Signls from GPS re urte to out one miroseond Why n t we put GPS reeivers on ll our omputers? 5 6 Synhroniztion to time server Suppose server with n urte lok (e.g., GPSdisiplined rystl osilltor) Could simply issue n RPC to otin the time: Client Server Time But this doesn t ount for network lteny Messge delys will hve outdted server s nswer 7 Cristin s lgorithm: Outline 1. Client sends request pket, timestmped with its lol lok T 1 2. Server timestmps its reeipt of the request T 2 with its lol lok 3. Server sends response pket with its lol lok T 3 nd T 2 4. Client lolly timestmps its reeipt of the server s response T 4 Client T 1 Server T 2 T 4 T 3 How the lient n use these timestmps to synhronize its lol lok to the server s lol lok? Time 8 2

3 Cristin s lgorithm: Offset smple lultion Tody Client Server 1. The need for time synhroniztion Gol: Client sets lok ß T 3 + δ resp Client smples round trip time δ = δ req + δ resp = (T 4 T 1 ) (T 3 T 2 ) T 1 δ req T 2 2. Wll lok time synhroniztion Cristin s lgorithm, Berkeley lgorithm, NTP But lient knows δ, not δ resp Assume: δ req δ resp T δ 3 resp T 4 3. Logil Time: Lmport loks Client sets lok ß T 3 + ½δ Time 9 10 Berkeley lgorithm A single time server n fil, loking timekeeping The Berkeley lgorithm is distriuted lgorithm for timekeeping Berkeley lgorithm Mster mhine: polls L other mhines using Cristin s lgorithm à { θ i } (i = 1 L) Mster Assumes ll mhines hve eqully-urte lol loks Otins verge from prtiipting omputers nd synhronizes loks to tht verge

4 Tody 1. The need for time synhroniztion 2. Wll lok time synhroniztion Cristin s lgorithm, Berkeley lgorithm, NTP 3. Logil Time: Lmport loks The Network Time Protool (NTP) Enles lients to e urtely synhronized to UTC despite messge delys Provides relile servie Survives lengthy losses of onnetivity Communites over redundnt network pths Provides n urte servie Unlike the Berkeley lgorithm, leverges heterogeneous ury in loks NTP: System struture Servers nd time soures re rrnged in lyers (strt) Strtum 0: High-preision time soures themselves e.g., tomi loks, shortwve rdio time reeivers Strtum 1: NTP servers diretly onneted to Strtum 0 Strtum 2: NTP servers tht synhronize with Strtum 1 Strtum 2 servers re lients of Strtum 1 servers Strtum 3: NTP servers tht synhronize with Strtum 2 Strtum 3 servers re lients of Strtum 2 servers NTP opertion: Server seletion Messges etween n NTP lient nd server re exhnged in pirs: request nd response Use Cristin s lgorithm For i th messge exhnge with prtiulr server, lulte: 1. Clok offset θ i from lient to server 2. Round trip time δ i etween lient nd server Over lst eight exhnges with server k, the lient omputes its dispersion σ k = mx i δ i min i δ i Client uses the server with minimum dispersion Users omputers synhronize with Strtum 3 servers

5 NTP opertion : Clok offset lultion Client trks minimum round trip time nd ssoited offset over the lst eight messge exhnges (δ 0, θ 0 ) θ 0 is the est estimte of offset: lient djusts its lok y θ 0 to synhronize to server Offset θ θ 0 Eh point represents one smple NTP opertion: How to hnge time Cn t just hnge time: Don t wnt time to run kwrds Rell the mke exmple Insted, hnge the updte rte for the lok Chnges time in more grdul fshion Prevents inonsistent lol timestmps δ 0 Round trip time δ Clok synhroniztion: Tke-wy points Cloks on different systems will lwys ehve differently Disgreement etween mhines n result in undesirle ehvior NTP, Berkeley lok synhroniztion Rely on timestmps to estimte network delys 100s μs ms ury Cloks never extly synhronized Tody 1. The need for time synhroniztion 2. Wll lok time synhroniztion Cristin s lgorithm, Berkeley lgorithm, NTP 3. Logil Time: Lmport loks Often indequte for distriuted systems Often need to reson out the order of events Might need preision on the order of ns

6 Motivtion: Multi-site dtse replition The onsequenes of onurrent updtes A New York-sed nk wnts to mke its trnstion ledger dtse resilient to whole-site filures Replite the dtse, keep one opy in sf, one in ny Client sends query to the nerest opy Client sends updte to oth opies Replite the dtse, keep one opy in sf, one in ny Deposit 100 Sn Frniso Inonsistent replis! Updtes should hve een performed 1,000 1,000 in the sme order t eh opy New York 1,010 1,100 1,110 1,111 Py 1 interest 21 Ide: Logil loks 22 Defining hppens-efore (à) Consider three proesses:,, nd Lndmrk 1978 pper y Leslie Lmport Nottion: Event hppens efore event ( à ) Insight: only the events themselves mtter Ide: Disregrd the preise lok time Insted, pture just hppens efore reltionship etween pir of events

7 Defining hppens-efore (à) Cn oserve event order t single proess Defining hppens-efore (à) 1. If sme proess nd ours efore, then à Defining hppens-efore (à) 1. If sme proess nd ours efore, then à 2. Cn oserve ordering when proesses ommunite Defining hppens-efore (à) 1. If sme proess nd ours efore, then à 2. If is messge reeipt of, then à

8 Defining hppens-efore (à) 1. If sme proess nd ours efore, then à 2. If is messge reeipt of, then à 3. Cn oserve ordering trnsitively Defining hppens-efore (à) 1. If sme proess nd ours efore, then à 2. If is messge reeipt of, then à 3. If à nd à, then à Conurrent events Not ll events re relted y à, d not relted y à so onurrent, written s d d Lmport loks: Ojetive We seek lok time C() for every event Pln: Tg events with lok times; use lok times to mke distriuted system orret Clok ondition: If à, then C() < C()

9 The Lmport Clok lgorithm Eh proess P i mintins lol lok C i 1. Before exeuting n event, C i ß C i + 1 The Lmport Clok lgorithm 1. Before exeuting n event, C i ß C i + 1: Set event time C() ß C i C 1 =0 C 2 =0 C 3 =0 C 1 =1 C() = 1 C 2 =1 C 3 = The Lmport Clok lgorithm The Lmport Clok lgorithm 1. Before exeuting n event, C i ß C i + 1: Set event time C() ß C i 1. Before exeuting n event, C i ß C i Send the lol lok in the messge m C 1 =2 C() = 1 C() = 2 C 2 =1 C 3 =1 C 1 =2 C() = 1 C() = 2 C(m) = 2 C 2 =1 C 3 =

10 The Lmport Clok lgorithm 3. On proess P j reeiving messge m: Set C j nd reeive event time C() ß1 + mx{ C j, C(m) } C 1 =2 C() = 1 C() = 2 C(m) = 2 C 2 =3 C() = 3 C 3 =1 Lmport Timestmps: Ordering ll events Brek ties y ppending the proess numer to eh event: 1. Proess P i timestmps event e with C i (e).i 2. C().i < C().j when: C() < C(), or C() = C() nd i < j Now, for ny two events nd, C() < C() or C() < C() This is lled totl ordering of events Mking onurrent updtes onsistent Totlly-Ordered Multist Rell multi-site dtse replition: Sn Frniso () deposited 100: New York () pid 1 interest: We rehed n inonsistent stte Gol: All sites pply updtes in (sme) Lmport lok order Client sends updte to one repli site j Repli ssigns it Lmport timestmp C j. j Key ide: Ple events into sorted lol queue Sorted y inresing Lmport timestmps Could we design system tht uses Lmport Clok totl order to mke multi-site updtes onsistent? Exmple: s lol queue: 1.2 ß Timestmps

11 Totlly-Ordered Multist (Almost orret) Totlly-Ordered Multist (Almost orret) 1. On reeiving n updte from lient, rodst to others (inluding yourself) 2. On reeiving n updte from repli: ) Add it to your lol queue ) Brodst n knowledgement messge to every repli (inluding yourself) queues, queues queues nd k s mrks fully k ed mrks fully k ed proesses k 3. On reeiving n knowledgement: Mrk orresponding updte knowledged in your queue 4. Remove nd proess updtes everyone hs k ed from hed of queue (Ak s to self not shown here) Totlly-Ordered Multist (Corret version) Totlly-Ordered Multist (Corret version) 1. On reeiving n updte from lient, rodst to others (inluding yourself) On reeiving or proessing n updte: ) Add it to your lol queue, if reeived updte ) Brodst n knowledgement messge to every repli (inluding yourself) only from hed of queue On reeiving n knowledgement: Mrk orresponding updte knowledged in your queue 4. Remove nd proess updtes everyone hs k ed from hed of queue k k (Ak s to self not shown here)

12 So, re we done? Does totlly-ordered multist solve the prolem of multi-site replition in generl? Not y long shot! 1. Our protool ssumed: No node filures No messge loss No messge orruption 2. All to ll ommunition does not sle 3. Wits forever for messge delys (performne?) Tke-wy points: Lmport loks Cn totlly-order events in distriuted system: tht s useful! We sw n pplition of Lmport loks for totllyordered multist But: while y onstrution, à implies C() < C(), The onverse is not neessrily true: C() < C() does not imply à (possily, ) Cn t use Lmport lok timestmps to infer usl reltionships etween events Wednesdy Topi: Vetor Cloks & Distriuted Snpshots Fridy Preept: RPCs in Go Why glol timing? Suppose there were n infinitely-preise nd glolly onsistent time stndrd Tht would e very hndy. For exmple: 1. Who got lst set on irplne? 2. Moile loud gming: Whih ws first, A shoots B or vie-vers? 3. Does this file need to e reompiled?

13 Totlly-Ordered Multist (Attempt #1) Totlly-Ordered Multist (Corret version) queues, queues queues nd k s mrks fully k ed mrks fully k ed proesses queues nd k s proesses mrks fully k ed proesses, then 1.2 k k Note: k s to self not shown here queues, queues queues queues nd k s mrks fully k ed proesses mrks fully k ed proesses k s mrks fully k ed proesses mrks fully k ed proesses 1.2 k 1.2 k 1.2 (Ak s to self not shown here) Time stndrds Universl Time (UT1) In onept, sed on stronomil oservtion of the sun t 0º longitude Known s Greenwih Men Time Interntionl Atomi Time (TAI) Beginning of TAI is midnight on Jnury 1, 1958 Eh seond is 9,192,631,770 yles of rdition emitted y Cesium tom Hs diverged from UT1 due to slowing of erth s rottion Coordinted Universl Time (UTC) TAI + lep seonds, to e within 0.9 seonds of UT1 Currently TAI UTC = 36 VC pplition: Order proessing Suppose we re running distriuted order proessing system Eh proess = different user Eh event = n order A user hs seen ll orders with V(order) < the user s urrent vetor

Time Synchronization and Logical Clocks

Time Synchronization and Logical Clocks Time Synchronization and Logical Clocks CS 240: Computing Systems and Concurrency Lecture 5 Mootaz Elnozahy Today 1. The need for time synchronization 2. Wall clock time synchronization 3. Logical Time

More information

Distributed Systems Principles and Paradigms

Distributed Systems Principles and Paradigms Distriuted Systems Priniples nd Prdigms Christoph Dorn Distriuted Systems Group, Vienn University of Tehnology.dorn@infosys.tuwien..t http://www.infosys.tuwien..t/stff/dorn Slides dpted from Mrten vn Steen,

More information

Distributed Systems Principles and Paradigms. Chapter 11: Distributed File Systems

Distributed Systems Principles and Paradigms. Chapter 11: Distributed File Systems Distriuted Systems Priniples nd Prdigms Mrten vn Steen VU Amsterdm, Dept. Computer Siene steen@s.vu.nl Chpter 11: Distriuted File Systems Version: Deemer 10, 2012 2 / 14 Distriuted File Systems Distriuted

More information

Time. COS 418: Distributed Systems Lecture 3. Wyatt Lloyd

Time. COS 418: Distributed Systems Lecture 3. Wyatt Lloyd Time COS 418: Distributed Systems Lecture 3 Wyatt Lloyd Today 1. The need for time synchronization 2. Wall clock time synchronization 3. Logical Time: Lamport Clocks 2 A distributed edit-compile workflow

More information

Distance vector protocol

Distance vector protocol istne vetor protool Irene Finohi finohi@i.unirom.it Routing Routing protool Gol: etermine goo pth (sequene of routers) thru network from soure to Grph strtion for routing lgorithms: grph noes re routers

More information

Time Synchronization and Logical Clocks

Time Synchronization and Logical Clocks Time Synchronization and Logical Clocks CS 240: Computing Systems and Concurrency Lecture 5 Marco Canini Credits: Michael Freedman and Kyle Jamieson developed much of the original material. Today 1. The

More information

TIME ATTRIBUTION 11/4/2018. George Porter Nov 6 and 8, 2018

TIME ATTRIBUTION 11/4/2018. George Porter Nov 6 and 8, 2018 TIME George Porter Nov 6 and 8, 2018 ATTRIBUTION These slides are released under an Attribution-NonCommercial-ShareAlike 3.0 Unported (CC BY-NC-SA 3.0) Creative Commons license These slides incorporate

More information

Internet Routing. IP Packet Format. IP Fragmentation & Reassembly. Principles of Internet Routing. Computer Networks 9/29/2014.

Internet Routing. IP Packet Format. IP Fragmentation & Reassembly. Principles of Internet Routing. Computer Networks 9/29/2014. omputer Networks 9/29/2014 IP Pket Formt Internet Routing Ki Shen IP protool version numer heder length (words) for qulity of servie mx numer remining hops (deremented t eh router) upper lyer protool to

More information

Greedy Algorithm. Algorithm Fall Semester

Greedy Algorithm. Algorithm Fall Semester Greey Algorithm Algorithm 0 Fll Semester Optimiztion prolems An optimiztion prolem is one in whih you wnt to fin, not just solution, ut the est solution A greey lgorithm sometimes works well for optimiztion

More information

Shared Memory Architectures. Programming and Synchronization. Today s Outline. Page 1. Message passing review Cosmic Cube discussion

Shared Memory Architectures. Programming and Synchronization. Today s Outline. Page 1. Message passing review Cosmic Cube discussion Tody s Outline Arhitetures Progrmming nd Synhroniztion Disuss pper on Cosmi Cube (messge pssing) Messge pssing review Cosmi Cube disussion > Messge pssing mhine Shred memory model > Communition > Synhroniztion

More information

V = set of vertices (vertex / node) E = set of edges (v, w) (v, w in V)

V = set of vertices (vertex / node) E = set of edges (v, w) (v, w in V) Definitions G = (V, E) V = set of verties (vertex / noe) E = set of eges (v, w) (v, w in V) (v, w) orere => irete grph (igrph) (v, w) non-orere => unirete grph igrph: w is jent to v if there is n ege from

More information

The Network Layer: Routing in the Internet. The Network Layer: Routing & Addressing Outline

The Network Layer: Routing in the Internet. The Network Layer: Routing & Addressing Outline CPSC 852 Internetworking The Network Lyer: Routing in the Internet Mihele Weigle Deprtment of Computer Siene Clemson University mweigle@s.lemson.edu http://www.s.lemson.edu/~mweigle/ourses/ps852 1 The

More information

Error Numbers of the Standard Function Block

Error Numbers of the Standard Function Block A.2.2 Numers of the Stndrd Funtion Blok evlution The result of the logi opertion RLO is set if n error ours while the stndrd funtion lok is eing proessed. This llows you to rnh to your own error evlution

More information

2 Computing all Intersections of a Set of Segments Line Segment Intersection

2 Computing all Intersections of a Set of Segments Line Segment Intersection 15-451/651: Design & Anlysis of Algorithms Novemer 14, 2016 Lecture #21 Sweep-Line nd Segment Intersection lst chnged: Novemer 8, 2017 1 Preliminries The sweep-line prdigm is very powerful lgorithmic design

More information

COSC 6374 Parallel Computation. Non-blocking Collective Operations. Edgar Gabriel Fall Overview

COSC 6374 Parallel Computation. Non-blocking Collective Operations. Edgar Gabriel Fall Overview COSC 6374 Prllel Computtion Non-loking Colletive Opertions Edgr Griel Fll 2014 Overview Impt of olletive ommunition opertions Impt of ommunition osts on Speedup Crtesin stenil ommunition All-to-ll ommunition

More information

COSC 6374 Parallel Computation. Communication Performance Modeling (II) Edgar Gabriel Fall Overview. Impact of communication costs on Speedup

COSC 6374 Parallel Computation. Communication Performance Modeling (II) Edgar Gabriel Fall Overview. Impact of communication costs on Speedup COSC 6374 Prllel Computtion Communition Performne Modeling (II) Edgr Griel Fll 2015 Overview Impt of ommunition osts on Speedup Crtesin stenil ommunition All-to-ll ommunition Impt of olletive ommunition

More information

CS 241 Week 4 Tutorial Solutions

CS 241 Week 4 Tutorial Solutions CS 4 Week 4 Tutoril Solutions Writing n Assemler, Prt & Regulr Lnguges Prt Winter 8 Assemling instrutions utomtilly. slt $d, $s, $t. Solution: $d, $s, nd $t ll fit in -it signed integers sine they re 5-it

More information

Doubts about how to use azimuth values from a Coordinate Object. Juan Antonio Breña Moral

Doubts about how to use azimuth values from a Coordinate Object. Juan Antonio Breña Moral Douts out how to use zimuth vlues from Coordinte Ojet Jun Antonio Breñ Morl # Definition An Azimuth is the ngle from referene vetor in referene plne to seond vetor in the sme plne, pointing towrd, (ut

More information

McAfee Web Gateway

McAfee Web Gateway Relese Notes Revision C MAfee We Gtewy 7.6.2.11 Contents Aout this relese Enhnement Resolved issues Instlltion instrutions Known issues Additionl informtion Find produt doumenttion Aout this relese This

More information

Inter-domain Routing

Inter-domain Routing COMP 631: NETWORKED & DISTRIBUTED SYSTEMS Inter-domin Routing Jsleen Kur Fll 2016 1 Internet-sle Routing: Approhes DV nd link-stte protools do not sle to glol Internet How to mke routing slle? Exploit

More information

Lesson 4.4. Euler Circuits and Paths. Explore This

Lesson 4.4. Euler Circuits and Paths. Explore This Lesson 4.4 Euler Ciruits nd Pths Now tht you re fmilir with some of the onepts of grphs nd the wy grphs onvey onnetions nd reltionships, it s time to egin exploring how they n e used to model mny different

More information

Distributed Systems Principles and Paradigms

Distributed Systems Principles and Paradigms Distriuted Systems Principles nd Prdigms Chpter 11 (version April 7, 2008) Mrten vn Steen Vrije Universiteit Amsterdm, Fculty of Science Dept. Mthemtics nd Computer Science Room R4.20. Tel: (020) 598 7784

More information

10.2 Graph Terminology and Special Types of Graphs

10.2 Graph Terminology and Special Types of Graphs 10.2 Grph Terminology n Speil Types of Grphs Definition 1. Two verties u n v in n unirete grph G re lle jent (or neighors) in G iff u n v re enpoints of n ege e of G. Suh n ege e is lle inient with the

More information

Paradigm 5. Data Structure. Suffix trees. What is a suffix tree? Suffix tree. Simple applications. Simple applications. Algorithms

Paradigm 5. Data Structure. Suffix trees. What is a suffix tree? Suffix tree. Simple applications. Simple applications. Algorithms Prdigm. Dt Struture Known exmples: link tble, hep, Our leture: suffix tree Will involve mortize method tht will be stressed shortly in this ourse Suffix trees Wht is suffix tree? Simple pplitions History

More information

LINX MATRIX SWITCHERS FIRMWARE UPDATE INSTRUCTIONS FIRMWARE VERSION

LINX MATRIX SWITCHERS FIRMWARE UPDATE INSTRUCTIONS FIRMWARE VERSION Overview LINX MATRIX SWITCHERS FIRMWARE UPDATE INSTRUCTIONS FIRMWARE VERSION 4.4.1.0 Due to the omplex nture of this updte, plese fmilirize yourself with these instrutions nd then ontt RGB Spetrum Tehnil

More information

CMPUT101 Introduction to Computing - Summer 2002

CMPUT101 Introduction to Computing - Summer 2002 CMPUT Introdution to Computing - Summer 22 %XLOGLQJ&RPSXWHU&LUFXLWV Chpter 4.4 3XUSRVH We hve looked t so fr how to uild logi gtes from trnsistors. Next we will look t how to uild iruits from logi gtes,

More information

Network Interconnection: Bridging CS 571 Fall Kenneth L. Calvert All rights reserved

Network Interconnection: Bridging CS 571 Fall Kenneth L. Calvert All rights reserved Network Interconnection: Bridging CS 57 Fll 6 6 Kenneth L. Clvert All rights reserved The Prolem We know how to uild (rodcst) LANs Wnt to connect severl LANs together to overcome scling limits Recll: speed

More information

Chapter 9. Greedy Technique. Copyright 2007 Pearson Addison-Wesley. All rights reserved.

Chapter 9. Greedy Technique. Copyright 2007 Pearson Addison-Wesley. All rights reserved. Chpter 9 Greey Tehnique Copyright 2007 Person Aison-Wesley. All rights reserve. Greey Tehnique Construts solution to n optimiztion prolem piee y piee through sequene of hoies tht re: fesile lolly optiml

More information

6.045J/18.400J: Automata, Computability and Complexity. Quiz 2: Solutions. Please write your name in the upper corner of each page.

6.045J/18.400J: Automata, Computability and Complexity. Quiz 2: Solutions. Please write your name in the upper corner of each page. 6045J/18400J: Automt, Computbility nd Complexity Mrh 30, 2005 Quiz 2: Solutions Prof Nny Lynh Vinod Vikuntnthn Plese write your nme in the upper orner of eh pge Problem Sore 1 2 3 4 5 6 Totl Q2-1 Problem

More information

CS Summer Lecture #23: Network and End-to-End layers

CS Summer Lecture #23: Network and End-to-End layers S 4 - Summer 8 - Leture #3: Network nd End-to-End lyers Pst & Present! Lst time: pushing its out of/into hrdwre Link lyer. How to: enode its on wire (in. ntenn), prse its into pkets, ritrte etween s, nme

More information

Introduction to Algebra

Introduction to Algebra INTRODUCTORY ALGEBRA Mini-Leture 1.1 Introdution to Alger Evlute lgeri expressions y sustitution. Trnslte phrses to lgeri expressions. 1. Evlute the expressions when =, =, nd = 6. ) d) 5 10. Trnslte eh

More information

Today. CS 188: Artificial Intelligence Fall Recap: Search. Example: Pancake Problem. Example: Pancake Problem. General Tree Search.

Today. CS 188: Artificial Intelligence Fall Recap: Search. Example: Pancake Problem. Example: Pancake Problem. General Tree Search. CS 88: Artificil Intelligence Fll 00 Lecture : A* Serch 9//00 A* Serch rph Serch Tody Heuristic Design Dn Klein UC Berkeley Multiple slides from Sturt Russell or Andrew Moore Recp: Serch Exmple: Pncke

More information

Lecture 8: Graph-theoretic problems (again)

Lecture 8: Graph-theoretic problems (again) COMP36111: Advned Algorithms I Leture 8: Grph-theoreti prolems (gin) In Prtt-Hrtmnn Room KB2.38: emil: iprtt@s.mn..uk 2017 18 Reding for this leture: Sipser: Chpter 7. A grph is pir G = (V, E), where V

More information

Computational geometry

Computational geometry Leture 23 Computtionl geometry Supplementl reding in CLRS: Chpter 33 exept 33.3 There re mny importnt prolems in whih the reltionships we wish to nlyze hve geometri struture. For exmple, omputtionl geometry

More information

Calculus Differentiation

Calculus Differentiation //007 Clulus Differentition Jeffrey Seguritn person in rowot miles from the nerest point on strit shoreline wishes to reh house 6 miles frther down the shore. The person n row t rte of mi/hr nd wlk t rte

More information

Troubleshooting. Verify the Cisco Prime Collaboration Provisioning Installation (for Advanced or Standard Mode), page

Troubleshooting. Verify the Cisco Prime Collaboration Provisioning Installation (for Advanced or Standard Mode), page Trouleshooting This setion explins the following: Verify the Ciso Prime Collortion Provisioning Instlltion (for Advned or Stndrd Mode), pge 1 Upgrde the Ciso Prime Collortion Provisioning from Smll to

More information

Outline. Motivation Background ARCH. Experiment Additional usages for Input-Depth. Regular Expression Matching DPI over Compressed HTTP

Outline. Motivation Background ARCH. Experiment Additional usages for Input-Depth. Regular Expression Matching DPI over Compressed HTTP ARCH This work ws supported y: The Europen Reserh Counil, The Isreli Centers of Reserh Exellene, The Neptune Consortium, nd Ntionl Siene Foundtion wrd CNS-119748 Outline Motivtion Bkground Regulr Expression

More information

If you are at the university, either physically or via the VPN, you can download the chapters of this book as PDFs.

If you are at the university, either physically or via the VPN, you can download the chapters of this book as PDFs. Lecture 5 Wlks, Trils, Pths nd Connectedness Reding: Some of the mteril in this lecture comes from Section 1.2 of Dieter Jungnickel (2008), Grphs, Networks nd Algorithms, 3rd edition, which is ville online

More information

CSE 124: TIME SYNCHRONIZATION, CRISTIAN S ALGORITHM, BERKELEY ALGORITHM, NTP. George Porter October 27, 2017

CSE 124: TIME SYNCHRONIZATION, CRISTIAN S ALGORITHM, BERKELEY ALGORITHM, NTP. George Porter October 27, 2017 CSE 124: TIME SYNCHRONIZATION, CRISTIAN S ALGORITHM, BERKELEY ALGORITHM, NTP George Porter October 27, 2017 ATTRIBUTION These slides are released under an Attribution-NonCommercial-ShareAlike 3.0 Unported

More information

Lecture 13: Graphs I: Breadth First Search

Lecture 13: Graphs I: Breadth First Search Leture 13 Grphs I: BFS 6.006 Fll 2011 Leture 13: Grphs I: Bredth First Serh Leture Overview Applitions of Grph Serh Grph Representtions Bredth-First Serh Rell: Grph G = (V, E) V = set of verties (ritrry

More information

COMPUTER EDUCATION TECHNIQUES, INC. (WEBLOGIC_SVR_ADM ) SA:

COMPUTER EDUCATION TECHNIQUES, INC. (WEBLOGIC_SVR_ADM ) SA: In orer to lern whih questions hve een nswere orretly: 1. Print these pges. 2. Answer the questions. 3. Sen this ssessment with the nswers vi:. FAX to (212) 967-3498. Or. Mil the nswers to the following

More information

To access your mailbox from inside your organization. For assistance, call:

To access your mailbox from inside your organization. For assistance, call: 2001 Ative Voie, In. All rights reserved. First edition 2001. Proteted y one or more of the following United Sttes ptents:,070,2;,3,90;,88,0;,33,102;,8,0;,81,0;,2,7;,1,0;,90,88;,01,11. Additionl U.S. nd

More information

Slides for Data Mining by I. H. Witten and E. Frank

Slides for Data Mining by I. H. Witten and E. Frank Slides for Dt Mining y I. H. Witten nd E. Frnk Simplicity first Simple lgorithms often work very well! There re mny kinds of simple structure, eg: One ttriute does ll the work All ttriutes contriute eqully

More information

COSC 6374 Parallel Computation. Dense Matrix Operations

COSC 6374 Parallel Computation. Dense Matrix Operations COSC 6374 Prllel Computtion Dense Mtrix Opertions Edgr Griel Fll Edgr Griel Prllel Computtion Edgr Griel erminology Dense Mtrix: ll elements of the mtrix ontin relevnt vlues ypilly stored s 2-D rry, (e.g.

More information

Presentation Martin Randers

Presentation Martin Randers Presenttion Mrtin Rnders Outline Introduction Algorithms Implementtion nd experiments Memory consumption Summry Introduction Introduction Evolution of species cn e modelled in trees Trees consist of nodes

More information

Announcements. CS 188: Artificial Intelligence Fall Recap: Search. Today. Example: Pancake Problem. Example: Pancake Problem

Announcements. CS 188: Artificial Intelligence Fall Recap: Search. Today. Example: Pancake Problem. Example: Pancake Problem Announcements Project : erch It s live! Due 9/. trt erly nd sk questions. It s longer thn most! Need prtner? Come up fter clss or try Pizz ections: cn go to ny, ut hve priority in your own C 88: Artificil

More information

MITSUBISHI ELECTRIC RESEARCH LABORATORIES Cambridge, Massachusetts. Introduction to Matroids and Applications. Srikumar Ramalingam

MITSUBISHI ELECTRIC RESEARCH LABORATORIES Cambridge, Massachusetts. Introduction to Matroids and Applications. Srikumar Ramalingam Cmrige, Msshusetts Introution to Mtrois n Applitions Srikumr Rmlingm MERL mm//yy Liner Alger (,0,0) (0,,0) Liner inepenene in vetors: v, v2,..., For ll non-trivil we hve s v s v n s, s2,..., s n 2v2...

More information

The Math Learning Center PO Box 12929, Salem, Oregon Math Learning Center

The Math Learning Center PO Box 12929, Salem, Oregon Math Learning Center Resource Overview Quntile Mesure: Skill or Concept: 80Q Multiply two frctions or frction nd whole numer. (QT N ) Excerpted from: The Mth Lerning Center PO Box 99, Slem, Oregon 9709 099 www.mthlerningcenter.org

More information

Pattern Matching. Pattern Matching. Pattern Matching. Review of Regular Expressions

Pattern Matching. Pattern Matching. Pattern Matching. Review of Regular Expressions Pttern Mthing Pttern Mthing Some of these leture slides hve een dpted from: lgorithms in C, Roert Sedgewik. Gol. Generlize string serhing to inompletely speified ptterns. pplitions. Test if string or its

More information

Definition of Regular Expression

Definition of Regular Expression Definition of Regulr Expression After the definition of the string nd lnguges, we re redy to descrie regulr expressions, the nottion we shll use to define the clss of lnguges known s regulr sets. Recll

More information

Lexical Analysis: Constructing a Scanner from Regular Expressions

Lexical Analysis: Constructing a Scanner from Regular Expressions Lexicl Anlysis: Constructing Scnner from Regulr Expressions Gol Show how to construct FA to recognize ny RE This Lecture Convert RE to n nondeterministic finite utomton (NFA) Use Thompson s construction

More information

UTMC APPLICATION NOTE UT1553B BCRT TO INTERFACE PSEUDO-DUAL-PORT RAM ARCHITECTURE INTRODUCTION ARBITRATION DETAILS DESIGN SELECTIONS

UTMC APPLICATION NOTE UT1553B BCRT TO INTERFACE PSEUDO-DUAL-PORT RAM ARCHITECTURE INTRODUCTION ARBITRATION DETAILS DESIGN SELECTIONS UTMC APPLICATION NOTE UT1553B BCRT TO 80186 INTERFACE INTRODUCTION The UTMC UT1553B BCRT is monolithi CMOS integrte iruit tht provies omprehensive Bus Controller n Remote Terminl funtions for MIL-STD-

More information

CS143 Handout 07 Summer 2011 June 24 th, 2011 Written Set 1: Lexical Analysis

CS143 Handout 07 Summer 2011 June 24 th, 2011 Written Set 1: Lexical Analysis CS143 Hndout 07 Summer 2011 June 24 th, 2011 Written Set 1: Lexicl Anlysis In this first written ssignment, you'll get the chnce to ply round with the vrious constructions tht come up when doing lexicl

More information

Tries. Yufei Tao KAIST. April 9, Y. Tao, April 9, 2013 Tries

Tries. Yufei Tao KAIST. April 9, Y. Tao, April 9, 2013 Tries Tries Yufei To KAIST April 9, 2013 Y. To, April 9, 2013 Tries In this lecture, we will discuss the following exct mtching prolem on strings. Prolem Let S e set of strings, ech of which hs unique integer

More information

FASTEST METHOD TO FIND ALTERNATIVE RE-ROUTE

FASTEST METHOD TO FIND ALTERNATIVE RE-ROUTE INTERNATIONAL JOURNAL OF RESEARCH IN COMPUTER APPLICATIONS AND ROBOTICS ISSN 2320-7345 FASTEST METHOD TO FIND ALTERNATIVE RE-ROUTE 1 M.JothiLkshmi, M.S., M.Phil. 2 C.Theeendr, M.S., M.Phil. 3 M.K.Pvithr,

More information

CSCI 3130: Formal Languages and Automata Theory Lecture 12 The Chinese University of Hong Kong, Fall 2011

CSCI 3130: Formal Languages and Automata Theory Lecture 12 The Chinese University of Hong Kong, Fall 2011 CSCI 3130: Forml Lnguges nd utomt Theory Lecture 12 The Chinese University of Hong Kong, Fll 2011 ndrej Bogdnov In progrmming lnguges, uilding prse trees is significnt tsk ecuse prse trees tell us the

More information

Architecture and Data Flows Reference Guide

Architecture and Data Flows Reference Guide Arhiteture nd Dt Flows Referene Guide BlkBerry UEM Version 12.7 Pulished: 2017-07-12 SWD-20170627140413745 Contents Aout this guide... 5 Arhiteture: BlkBerry UEM solution... 6 BlkBerry UEM omponents...

More information

Network Layer: Routing Classifications; Shortest Path Routing

Network Layer: Routing Classifications; Shortest Path Routing igitl ommuniction in the Modern World : Routing lssifictions; Shortest Pth Routing s min prolem: To get efficiently from one point to the other in dynmic environment http://.cs.huji.c.il/~com com@cs.huji.c.il

More information

P(r)dr = probability of generating a random number in the interval dr near r. For this probability idea to make sense we must have

P(r)dr = probability of generating a random number in the interval dr near r. For this probability idea to make sense we must have Rndom Numers nd Monte Crlo Methods Rndom Numer Methods The integrtion methods discussed so fr ll re sed upon mking polynomil pproximtions to the integrnd. Another clss of numericl methods relies upon using

More information

Solving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence Winter 2016

Solving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence Winter 2016 Solving Prolems y Serching CS 486/686: Introduction to Artificil Intelligence Winter 2016 1 Introduction Serch ws one of the first topics studied in AI - Newell nd Simon (1961) Generl Prolem Solver Centrl

More information

INTEGRATED WORKFLOW ART DIRECTOR

INTEGRATED WORKFLOW ART DIRECTOR ART DIRECTOR Progrm Resoures INTEGRATED WORKFLOW PROGRAM PLANNING PHASE In this workflow phse proess, you ollorte with the Progrm Mnger, the Projet Mnger, nd the Art Speilist/ Imge Led to updte the resoures

More information

COMP 423 lecture 11 Jan. 28, 2008

COMP 423 lecture 11 Jan. 28, 2008 COMP 423 lecture 11 Jn. 28, 2008 Up to now, we hve looked t how some symols in n lphet occur more frequently thn others nd how we cn sve its y using code such tht the codewords for more frequently occuring

More information

Announcements. CS 188: Artificial Intelligence Fall Recap: Search. Today. General Tree Search. Uniform Cost. Lecture 3: A* Search 9/4/2007

Announcements. CS 188: Artificial Intelligence Fall Recap: Search. Today. General Tree Search. Uniform Cost. Lecture 3: A* Search 9/4/2007 CS 88: Artificil Intelligence Fll 2007 Lecture : A* Serch 9/4/2007 Dn Klein UC Berkeley Mny slides over the course dpted from either Sturt Russell or Andrew Moore Announcements Sections: New section 06:

More information

COMP108 Algorithmic Foundations

COMP108 Algorithmic Foundations Grph Theory Prudene Wong http://www.s.liv..uk/~pwong/tehing/omp108/201617 How to Mesure 4L? 3L 5L 3L ontiner & 5L ontiner (without mrk) infinite supply of wter You n pour wter from one ontiner to nother

More information

Package Contents. Wireless-G USB Network Adapter with SpeedBooster USB Cable Setup CD-ROM with User Guide (English only) Quick Installation

Package Contents. Wireless-G USB Network Adapter with SpeedBooster USB Cable Setup CD-ROM with User Guide (English only) Quick Installation A Division of Ciso Systems, In. Pkge Contents Wireless-G USB Network Adpter with SpeedBooster USB Cle Setup CD-ROM with User Guide (English only) Quik Instlltion 2,4 GHz 802.11g Wireless Model No. Model

More information

PARALLEL AND DISTRIBUTED COMPUTING

PARALLEL AND DISTRIBUTED COMPUTING PARALLEL AND DISTRIBUTED COMPUTING 2009/2010 1 st Semester Teste Jnury 9, 2010 Durtion: 2h00 - No extr mteril llowed. This includes notes, scrtch pper, clcultor, etc. - Give your nswers in the ville spce

More information

Enterprise Digital Signage Create a New Sign

Enterprise Digital Signage Create a New Sign Enterprise Digitl Signge Crete New Sign Intended Audiene: Content dministrtors of Enterprise Digitl Signge inluding stff with remote ess to sign.pitt.edu nd the Content Mnger softwre pplition for their

More information

A Tautology Checker loosely related to Stålmarck s Algorithm by Martin Richards

A Tautology Checker loosely related to Stålmarck s Algorithm by Martin Richards A Tutology Checker loosely relted to Stålmrck s Algorithm y Mrtin Richrds mr@cl.cm.c.uk http://www.cl.cm.c.uk/users/mr/ University Computer Lortory New Museum Site Pemroke Street Cmridge, CB2 3QG Mrtin

More information

CS453 INTRODUCTION TO DATAFLOW ANALYSIS

CS453 INTRODUCTION TO DATAFLOW ANALYSIS CS453 INTRODUCTION TO DATAFLOW ANALYSIS CS453 Leture Register llotion using liveness nlysis 1 Introdution to Dt-flow nlysis Lst Time Register llotion for expression trees nd lol nd prm vrs Tody Register

More information

In the last lecture, we discussed how valid tokens may be specified by regular expressions.

In the last lecture, we discussed how valid tokens may be specified by regular expressions. LECTURE 5 Scnning SYNTAX ANALYSIS We know from our previous lectures tht the process of verifying the syntx of the progrm is performed in two stges: Scnning: Identifying nd verifying tokens in progrm.

More information

Outline. CS38 Introduction to Algorithms. Graphs. Graphs. Graphs. Graph traversals

Outline. CS38 Introduction to Algorithms. Graphs. Graphs. Graphs. Graph traversals Outline CS38 Introution to Algorithms Leture 2 April 3, 2014 grph trversls (BFS, DFS) onnetivity topologil sort strongly onnete omponents heps n hepsort greey lgorithms April 3, 2014 CS38 Leture 2 2 Grphs

More information

CS553 Lecture Introduction to Data-flow Analysis 1

CS553 Lecture Introduction to Data-flow Analysis 1 ! Ide Introdution to Dt-flow nlysis!lst Time! Implementing Mrk nd Sweep GC!Tody! Control flow grphs! Liveness nlysis! Register llotion CS553 Leture Introdution to Dt-flow Anlysis 1 Dt-flow Anlysis! Dt-flow

More information

Ma/CS 6b Class 1: Graph Recap

Ma/CS 6b Class 1: Graph Recap M/CS 6 Clss 1: Grph Recp By Adm Sheffer Course Detils Adm Sheffer. Office hour: Tuesdys 4pm. dmsh@cltech.edu TA: Victor Kstkin. Office hour: Tuesdys 7pm. 1:00 Mondy, Wednesdy, nd Fridy. http://www.mth.cltech.edu/~2014-15/2term/m006/

More information

AI Adjacent Fields. This slide deck courtesy of Dan Klein at UC Berkeley

AI Adjacent Fields. This slide deck courtesy of Dan Klein at UC Berkeley AI Adjcent Fields Philosophy: Logic, methods of resoning Mind s physicl system Foundtions of lerning, lnguge, rtionlity Mthemtics Forml representtion nd proof Algorithms, computtion, (un)decidility, (in)trctility

More information

Internet Routing. Reminder: Routing. CPSC Network Programming

Internet Routing. Reminder: Routing. CPSC Network Programming PS 360 - Network Progrmming Internet Routing Mihele Weigle eprtment of omputer Siene lemson University mweigle@s.lemson.eu pril, 00 http://www.s.lemson.eu/~mweigle/ourses/ps360 Reminer: Routing Internet

More information

Suffix trees, suffix arrays, BWT

Suffix trees, suffix arrays, BWT ALGORITHMES POUR LA BIO-INFORMATIQUE ET LA VISUALISATION COURS 3 Rluc Uricru Suffix trees, suffix rrys, BWT Bsed on: Suffix trees nd suffix rrys presenttion y Him Kpln Suffix trees course y Pco Gomez Liner-Time

More information

The Greedy Method. The Greedy Method

The Greedy Method. The Greedy Method Lists nd Itertors /8/26 Presenttion for use with the textook, Algorithm Design nd Applictions, y M. T. Goodrich nd R. Tmssi, Wiley, 25 The Greedy Method The Greedy Method The greedy method is generl lgorithm

More information

Cooperative Routing in Multi-Source Multi-Destination Multi-hop Wireless Networks

Cooperative Routing in Multi-Source Multi-Destination Multi-hop Wireless Networks oopertive Routing in Multi-Soure Multi-estintion Multi-hop Wireless Networks Jin Zhng Qin Zhng eprtment of omputer Siene n ngineering Hong Kong University of Siene n Tehnology, HongKong {zjzj, qinzh}@se.ust.hk

More information

Final Exam Review F 06 M 236 Be sure to look over all of your tests, as well as over the activities you did in the activity book

Final Exam Review F 06 M 236 Be sure to look over all of your tests, as well as over the activities you did in the activity book inl xm Review 06 M 236 e sure to loo over ll of your tests, s well s over the tivities you did in the tivity oo 1 1. ind the mesures of the numered ngles nd justify your wor. Line j is prllel to line.

More information

Fig.25: the Role of LEX

Fig.25: the Role of LEX The Lnguge for Specifying Lexicl Anlyzer We shll now study how to uild lexicl nlyzer from specifiction of tokens in the form of list of regulr expressions The discussion centers round the design of n existing

More information

McAfee Network Security Platform

McAfee Network Security Platform Pssive Fil-Open Kit Quik Strt Guide Revision D MAfee Network Seurity Pltform MAfee Network Seurity Pltform IPS Sensors, when deployed in-line, route ll inoming trffi through designted port pir. However,

More information

Architecture and Data Flows Reference Guide

Architecture and Data Flows Reference Guide Arhiteture nd Dt Flows Referene Guide BES12 Version 12.5 Pulished: 2016-06-29 SWD-20160620150844487 Contents Aout this guide... 5 Arhiteture: BES12 EMM solution... 6 BES12 omponents...8 Components used

More information

CS201 Discussion 10 DRAWTREE + TRIES

CS201 Discussion 10 DRAWTREE + TRIES CS201 Discussion 10 DRAWTREE + TRIES DrwTree First instinct: recursion As very generic structure, we could tckle this problem s follows: drw(): Find the root drw(root) drw(root): Write the line for the

More information

Compression Outline :Algorithms in the Real World. Lempel-Ziv Algorithms. LZ77: Sliding Window Lempel-Ziv

Compression Outline :Algorithms in the Real World. Lempel-Ziv Algorithms. LZ77: Sliding Window Lempel-Ziv Compression Outline 15-853:Algorithms in the Rel World Dt Compression III Introduction: Lossy vs. Lossless, Benchmrks, Informtion Theory: Entropy, etc. Proility Coding: Huffmn + Arithmetic Coding Applictions

More information

Agilent Mass Hunter Software

Agilent Mass Hunter Software Agilent Mss Hunter Softwre Quick Strt Guide Use this guide to get strted with the Mss Hunter softwre. Wht is Mss Hunter Softwre? Mss Hunter is n integrl prt of Agilent TOF softwre (version A.02.00). Mss

More information

Lists in Lisp and Scheme

Lists in Lisp and Scheme Lists in Lisp nd Scheme Lists in Lisp nd Scheme Lists re Lisp s fundmentl dt structures, ut there re others Arrys, chrcters, strings, etc. Common Lisp hs moved on from eing merely LISt Processor However,

More information

Solving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence

Solving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence Solving Prolems y Serching CS 486/686: Introduction to Artificil Intelligence 1 Introduction Serch ws one of the first topics studied in AI - Newell nd Simon (1961) Generl Prolem Solver Centrl component

More information

10.5 Graphing Quadratic Functions

10.5 Graphing Quadratic Functions 0.5 Grphing Qudrtic Functions Now tht we cn solve qudrtic equtions, we wnt to lern how to grph the function ssocited with the qudrtic eqution. We cll this the qudrtic function. Grphs of Qudrtic Functions

More information

COMBINATORIAL PATTERN MATCHING

COMBINATORIAL PATTERN MATCHING COMBINATORIAL PATTERN MATCHING Genomic Repets Exmple of repets: ATGGTCTAGGTCCTAGTGGTC Motivtion to find them: Genomic rerrngements re often ssocited with repets Trce evolutionry secrets Mny tumors re chrcterized

More information

Integration. September 28, 2017

Integration. September 28, 2017 Integrtion September 8, 7 Introduction We hve lerned in previous chpter on how to do the differentition. It is conventionl in mthemtics tht we re supposed to lern bout the integrtion s well. As you my

More information

MATH 25 CLASS 5 NOTES, SEP

MATH 25 CLASS 5 NOTES, SEP MATH 25 CLASS 5 NOTES, SEP 30 2011 Contents 1. A brief diversion: reltively prime numbers 1 2. Lest common multiples 3 3. Finding ll solutions to x + by = c 4 Quick links to definitions/theorems Euclid

More information

Problem Final Exam Set 2 Solutions

Problem Final Exam Set 2 Solutions CSE 5 5 Algoritms nd nd Progrms Prolem Finl Exm Set Solutions Jontn Turner Exm - //05 0/8/0. (5 points) Suppose you re implementing grp lgoritm tt uses ep s one of its primry dt strutures. Te lgoritm does

More information

CSE 124: LAMPORT AND VECTOR CLOCKS. George Porter October 30, 2017

CSE 124: LAMPORT AND VECTOR CLOCKS. George Porter October 30, 2017 CSE 124: LAMPORT AND VECTOR CLOCKS George Porter October 30, 2017 ATTRIBUTION These slides are released under an Attribution-NonCommercial-ShareAlike 3.0 Unported (CC BY-NC-SA 3.0) Creative Commons license

More information

What are suffix trees?

What are suffix trees? Suffix Trees 1 Wht re suffix trees? Allow lgorithm designers to store very lrge mount of informtion out strings while still keeping within liner spce Allow users to serch for new strings in the originl

More information

IP: Network Layer. Goals and Tasks. Routing. Switching. Switching (cont.) Datagram v/s Virtual Circuit. Overview Addressing Routing

IP: Network Layer. Goals and Tasks. Routing. Switching. Switching (cont.) Datagram v/s Virtual Circuit. Overview Addressing Routing IP: Network Lyer Overview Addressing Routing Overview Gols nd Tsks Routing Switching Issues Bsic ides TOC IP TOC IP Overview Gols nd Tsks Gols of Network Lyer Guide pckets from source to destintion Use

More information

Lesson6: Modeling the Web as a graph Unit5: Linear Algebra for graphs

Lesson6: Modeling the Web as a graph Unit5: Linear Algebra for graphs Lesson6: Modeling the We s grph Unit5: Liner Alger for grphs Rene Pikhrdt Introdution to We Siene Prt 2 Emerging We Properties Rene Pikhrdt Institute CC-BY-SA-3. for We Siene nd Tehnologies Modeling the

More information

12/9/14. CS151 Fall 20124Lecture (almost there) 12/6. Graphs. Seven Bridges of Königsberg. Leonard Euler

12/9/14. CS151 Fall 20124Lecture (almost there) 12/6. Graphs. Seven Bridges of Königsberg. Leonard Euler CS5 Fll 04Leture (lmost there) /6 Seven Bridges of Königserg Grphs Prof. Tny Berger-Wolf Leonrd Euler 707-783 Is it possile to wlk with route tht rosses eh ridge e Seven Bridges of Königserg Forget unimportnt

More information

Class Overview. Database Design. Database Design Process. Database Design. Introduction to Data Management CSE 414

Class Overview. Database Design. Database Design Process. Database Design. Introduction to Data Management CSE 414 Introution to Dt Mngement CSE 44 Unit 6: Coneptul Design E/R Digrms Integrity Constrints BCNF Introution to Dt Mngement CSE 44 E/R Digrms ( letures) CSE 44 Autumn 08 Clss Overview Dtse Design Unit : Intro

More information

TO REGULAR EXPRESSIONS

TO REGULAR EXPRESSIONS Suject :- Computer Science Course Nme :- Theory Of Computtion DA TO REGULAR EXPRESSIONS Report Sumitted y:- Ajy Singh Meen 07000505 jysmeen@cse.iit.c.in BASIC DEINITIONS DA:- A finite stte mchine where

More information

UT1553B BCRT True Dual-port Memory Interface

UT1553B BCRT True Dual-port Memory Interface UTMC APPICATION NOTE UT553B BCRT True Dul-port Memory Interfce INTRODUCTION The UTMC UT553B BCRT is monolithic CMOS integrted circuit tht provides comprehensive MI-STD- 553B Bus Controller nd Remote Terminl

More information