Compression Outline :Algorithms in the Real World. Lempel-Ziv Algorithms. LZ77: Sliding Window Lempel-Ziv
|
|
- Stephany Thomas
- 6 years ago
- Views:
Transcription
1 Compression Outline :Algorithms in the Rel World Dt Compression III Introduction: Lossy vs. Lossless, Benchmrks, Informtion Theory: Entropy, etc. Proility Coding: Huffmn + Arithmetic Coding Applictions of Proility Coding: PPM + others Lempel-Ziv Algorithms: LZ77, gzip, LZ78, compress (Not covered in clss) Other Lossless Algorithms: Burrows-Wheeler Lossy lgorithms for imges: JPEG, MPEG,... Compressing grphs nd meshes: BBK Pge Pge 2 Lempel-Ziv Algorithms LZ77 (Sliding Window) Vrints: LZSS (Lempel-Ziv-Storer-Szymnski) Applictions: gzip, Squeeze, LHA, PKZIP, ZOO LZ78 (Dictionry Bsed) Vrints: LZW (Lempel-Ziv-Welch), LZC Applictions: compress, GIF, CCITT (modems), ARC, PAK Trditionlly LZ77 ws etter ut slower, ut the gzip version is lmost s fst s ny LZ Pge 3 LZ77: Sliding Window Lempel-Ziv c c c c Dictionry (previously coded) Cursor Lookhed Buffer Dictionry nd uffer windows re fixed length nd slide with the cursor Repet: Output (p, l, c) where p = position of the longest mtch tht strts in the dictionry (reltive to the cursor) l = length of longest mtch c = next chr in uffer eyond longest mtch Advnce window y l Pge 4 1
2 LZ77: Exmple c c c c (_,0,) c c c c (1,1,c) c c c c (3,4,) c c c c (3,3,) c c c c (1,2,c) Dictionry (size = 6) Longest mtch Buffer (size = 4) Next chrcter LZ77 Decoding Decoder keeps sme dictionry window s encoder. For ech messge it looks it up in the dictionry nd inserts copy t the end of the string Wht if l > p? (only prt of the messge is in the dictionry.) E.g. dict = cd, codeword = (2,9,e) Simply copy from left to right for (i = 0; i < length; i++) out[cursor+i] = out[cursor-offset+i] Out = cdcdcdcdcdce Pge Pge 6 LZ77 Optimiztions used y gzip LZSS: Output one of the following two formts (0, position, length) or (1,chr) Uses the second formt if length < 3. c c c c c c c c c c c c (1,) (1,) (1,c) c c c c (0,3,4) Optimiztions used y gzip (cont.) 1. Huffmn code the positions, lengths nd chrs 2. Non greedy: possily use shorter mtch so tht next mtch is etter 3. Use hsh tle to store the dictionry. Hsh keys re ll strings of length 3 in the dictionry window. Find the longest mtch within the correct hsh ucket. Puts limit on the length of the serch within ucket. Within ech ucket store in order of position Pge Pge 8 2
3 The Hsh Tle Theory ehind LZ c c c c Sliding Window LZ is Asymptoticlly Optiml [Wyner-Ziv,94] Will compress long enough strings to the source entropy s the window size goes to infinity. 1 H n = p( X )log n p( X ) X A c 19 c 15 c 11 c 10 c 12 c 9 c 7 c 8 H = lim H n n Uses logrithmic code (e.g. gmm) for the position. Prolem: long enough is relly relly long Pge Pge 10 Comprison to Lempel-Ziv 78 Both LZ77 nd LZ78 nd their vrints keep dictionry of recent strings tht hve een seen. The differences re: How the dictionry is stored (LZ78 is trie) How it is extended (LZ78 only extends n existing entry y one chrcter) How it is indexed (LZ78 indexes the nodes of the trie) How elements re removed Lempel-Ziv Algorithms Summry Adpts well to chnges in the file (e.g. Tr file with mny file types within it). Initil lgorithms did not use proility coding nd performed poorly in terms of compression. More modern versions (e.g. gzip) do use proility coding s second pss nd compress much etter. The lgorithms re ecoming outdted, ut ides re used in mny of the newer lgorithms Pge Pge 12 3
4 Compression Outline Introduction: Lossy vs. Lossless, Benchmrks, Informtion Theory: Entropy, etc. Proility Coding: Huffmn + Arithmetic Coding Applictions of Proility Coding: PPM + others Lempel-Ziv Algorithms: LZ77, gzip, compress, Other Lossless Algorithms: Burrows-Wheeler ACB Lossy lgorithms for imges: JPEG, MPEG,... Compressing grphs nd meshes: BBK Burrows -Wheeler Currently ner est lnced lgorithm for text Breks file into fixed-size locks nd encodes ech lock seprtely. For ech lock: Sort ech chrcter y its full context. This is clled the lock sorting trnsform. Use move-to-front trnsform to encode the sorted chrcters. The ingenious oservtion is tht the decoder only needs the sorted chrcters nd pointer to the first chrcter of the originl sequence Pge Pge 14 Burrows Wheeler: Exmple Let s encode: d 1 e 2 c 3 o 4 d 5 e 6 We ve numered the chrcters to distinguish them. Context wrps round. Lst chr is most significnt. Context Chr ecode 6 d 1 coded 1 e 2 Sort odede 2 c 3 Context dedec 3 o 4 edeco 4 d 5 decod 5 e 6 Context Output dedec 3 o 4 coded 1 e 2 decod 5 e 6 odede 2 c 3 ecode 6 d 1 edeco 4 d Pge 15 Burrows-Wheeler (Continued) Theorem: After sorting, equl vlued chrcters pper in the sme order in the output s in the most significnt position of the context. Proof sketch: Since the chrs hve equl vlue in the most-significntposition of the context, they will e ordered y the rest of the context, i.e. the previous chrs. This is lso the order of the output since it is sorted y the previous chrcters. Context Output dedec 3 o 4 coded 1 e 2 decod 5 e 6 odede 2 c 3 ecode 6 d 1 edeco 4 d Pge 16 4
5 Burrows-Wheeler: Decoding Burrows-Wheeler: Decoding Consider dropping ll ut the lst chrcter of the context. Wht follows the underlined? Wht follows the underlined? Wht is the whole string? Answer:,, c Context c Output c Wht out now? Answer: c Cn lso use the rnk. The rnk is the position of chrcter if it were sorted using stle sort. Context c Output Rnk c Pge Pge 18 Burrows-Wheeler Decode Decode Exmple Function BW_Decode(In, Strt, n) S = MoveToFrontDecode(In,n) R = Rnk(S) j = Strt for i=1 to n do Out[i] = S[j] j = R[j] Rnk gives position of ech chr in sorted order. 6 S Rnk(S) o 4 e 2 4 e 6 5 c 3 1 d 1 2 ( d 5 3 Out e 6 d 1 d 1 e 2 e 2 c 3 c 3 o 4 o 4 d 5 d 5 e Pge Pge 20 5
6 Overview of Text Compression ACB (Associte Coder of Buynovsky) PPM nd Burrows-Wheeler oth encode single chrcter sed on the immeditely preceding context. LZ77 nd LZ78 encode multiple chrcters sed on mtches found in lock of preceding text Cn you mix these ides, i.e., code multiple chrcters sed on immeditely preceding context? BZ does this, ut they don t give detils on how it works current est compressor ACB lso does this close to est Keep dictionry sorted y context (the lst chrcter is the most significnt) Find longest mtch for context Find longest mtch for contents Code Distnce etween mtches in the sorted order Length of contents mtch Hs spects of Burrows-Wheeler, nd LZ77 Context Contents decode dec ode d ecode decod e de code deco de Pge Pge 22 6
COMP 423 lecture 11 Jan. 28, 2008
COMP 423 lecture 11 Jn. 28, 2008 Up to now, we hve looked t how some symols in n lphet occur more frequently thn others nd how we cn sve its y using code such tht the codewords for more frequently occuring
More informationThe dictionary model allows several consecutive symbols, called phrases
A dptive Huffmn nd rithmetic methods re universl in the sense tht the encoder cn dpt to the sttistics of the source. But, dpttion is computtionlly expensive, prticulrly when k-th order Mrkov pproximtion
More informationAlgorithm Design (5) Text Search
Algorithm Design (5) Text Serch Tkshi Chikym School of Engineering The University of Tokyo Text Serch Find sustring tht mtches the given key string in text dt of lrge mount Key string: chr x[m] Text Dt:
More informationCS201 Discussion 10 DRAWTREE + TRIES
CS201 Discussion 10 DRAWTREE + TRIES DrwTree First instinct: recursion As very generic structure, we could tckle this problem s follows: drw(): Find the root drw(root) drw(root): Write the line for the
More information2 Computing all Intersections of a Set of Segments Line Segment Intersection
15-451/651: Design & Anlysis of Algorithms Novemer 14, 2016 Lecture #21 Sweep-Line nd Segment Intersection lst chnged: Novemer 8, 2017 1 Preliminries The sweep-line prdigm is very powerful lgorithmic design
More informationMa/CS 6b Class 1: Graph Recap
M/CS 6 Clss 1: Grph Recp By Adm Sheffer Course Detils Adm Sheffer. Office hour: Tuesdys 4pm. dmsh@cltech.edu TA: Victor Kstkin. Office hour: Tuesdys 7pm. 1:00 Mondy, Wednesdy, nd Fridy. http://www.mth.cltech.edu/~2014-15/2term/m006/
More informationWhat are suffix trees?
Suffix Trees 1 Wht re suffix trees? Allow lgorithm designers to store very lrge mount of informtion out strings while still keeping within liner spce Allow users to serch for new strings in the originl
More informationFig.25: the Role of LEX
The Lnguge for Specifying Lexicl Anlyzer We shll now study how to uild lexicl nlyzer from specifiction of tokens in the form of list of regulr expressions The discussion centers round the design of n existing
More informationTries. Yufei Tao KAIST. April 9, Y. Tao, April 9, 2013 Tries
Tries Yufei To KAIST April 9, 2013 Y. To, April 9, 2013 Tries In this lecture, we will discuss the following exct mtching prolem on strings. Prolem Let S e set of strings, ech of which hs unique integer
More informationCS321 Languages and Compiler Design I. Winter 2012 Lecture 5
CS321 Lnguges nd Compiler Design I Winter 2012 Lecture 5 1 FINITE AUTOMATA A non-deterministic finite utomton (NFA) consists of: An input lphet Σ, e.g. Σ =,. A set of sttes S, e.g. S = {1, 3, 5, 7, 11,
More informationReducing a DFA to a Minimal DFA
Lexicl Anlysis - Prt 4 Reducing DFA to Miniml DFA Input: DFA IN Assume DFA IN never gets stuck (dd ded stte if necessry) Output: DFA MIN An equivlent DFA with the minimum numer of sttes. Hrry H. Porter,
More informationPresentation Martin Randers
Presenttion Mrtin Rnders Outline Introduction Algorithms Implementtion nd experiments Memory consumption Summry Introduction Introduction Evolution of species cn e modelled in trees Trees consist of nodes
More informationSuffix trees, suffix arrays, BWT
ALGORITHMES POUR LA BIO-INFORMATIQUE ET LA VISUALISATION COURS 3 Rluc Uricru Suffix trees, suffix rrys, BWT Bsed on: Suffix trees nd suffix rrys presenttion y Him Kpln Suffix trees course y Pco Gomez Liner-Time
More informationIf you are at the university, either physically or via the VPN, you can download the chapters of this book as PDFs.
Lecture 5 Wlks, Trils, Pths nd Connectedness Reding: Some of the mteril in this lecture comes from Section 1.2 of Dieter Jungnickel (2008), Grphs, Networks nd Algorithms, 3rd edition, which is ville online
More informationCS311H: Discrete Mathematics. Graph Theory IV. A Non-planar Graph. Regions of a Planar Graph. Euler s Formula. Instructor: Işıl Dillig
CS311H: Discrete Mthemtics Grph Theory IV Instructor: Işıl Dillig Instructor: Işıl Dillig, CS311H: Discrete Mthemtics Grph Theory IV 1/25 A Non-plnr Grph Regions of Plnr Grph The plnr representtion of
More informationSolving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence Winter 2016
Solving Prolems y Serching CS 486/686: Introduction to Artificil Intelligence Winter 2016 1 Introduction Serch ws one of the first topics studied in AI - Newell nd Simon (1961) Generl Prolem Solver Centrl
More informationMTH 146 Conics Supplement
105- Review of Conics MTH 146 Conics Supplement In this section we review conics If ou ne more detils thn re present in the notes, r through section 105 of the ook Definition: A prol is the set of points
More informationCSc 453. Compilers and Systems Software. 4 : Lexical Analysis II. Department of Computer Science University of Arizona
CSc 453 Compilers nd Systems Softwre 4 : Lexicl Anlysis II Deprtment of Computer Science University of Arizon collerg@gmil.com Copyright c 2009 Christin Collerg Implementing Automt NFAs nd DFAs cn e hrd-coded
More informationSolving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence
Solving Prolems y Serching CS 486/686: Introduction to Artificil Intelligence 1 Introduction Serch ws one of the first topics studied in AI - Newell nd Simon (1961) Generl Prolem Solver Centrl component
More information10.5 Graphing Quadratic Functions
0.5 Grphing Qudrtic Functions Now tht we cn solve qudrtic equtions, we wnt to lern how to grph the function ssocited with the qudrtic eqution. We cll this the qudrtic function. Grphs of Qudrtic Functions
More informationImplementing Automata. CSc 453. Compilers and Systems Software. 4 : Lexical Analysis II. Department of Computer Science University of Arizona
Implementing utomt Sc 5 ompilers nd Systems Softwre : Lexicl nlysis II Deprtment of omputer Science University of rizon collerg@gmil.com opyright c 009 hristin ollerg NFs nd DFs cn e hrd-coded using this
More informationAgilent Mass Hunter Software
Agilent Mss Hunter Softwre Quick Strt Guide Use this guide to get strted with the Mss Hunter softwre. Wht is Mss Hunter Softwre? Mss Hunter is n integrl prt of Agilent TOF softwre (version A.02.00). Mss
More informationCOMBINATORIAL PATTERN MATCHING
COMBINATORIAL PATTERN MATCHING Genomic Repets Exmple of repets: ATGGTCTAGGTCCTAGTGGTC Motivtion to find them: Genomic rerrngements re often ssocited with repets Trce evolutionry secrets Mny tumors re chrcterized
More informationMa/CS 6b Class 1: Graph Recap
M/CS 6 Clss 1: Grph Recp By Adm Sheffer Course Detils Instructor: Adm Sheffer. TA: Cosmin Pohot. 1pm Mondys, Wednesdys, nd Fridys. http://mth.cltech.edu/~2015-16/2term/m006/ Min ook: Introduction to Grph
More informationSimple variant of coding with a variable number of symbols and fixlength codewords.
Dictionary coding Simple variant of coding with a variable number of symbols and fixlength codewords. Create a dictionary containing 2 b different symbol sequences and code them with codewords of length
More informationToday. CS 188: Artificial Intelligence Fall Recap: Search. Example: Pancake Problem. Example: Pancake Problem. General Tree Search.
CS 88: Artificil Intelligence Fll 00 Lecture : A* Serch 9//00 A* Serch rph Serch Tody Heuristic Design Dn Klein UC Berkeley Multiple slides from Sturt Russell or Andrew Moore Recp: Serch Exmple: Pncke
More informationAI Adjacent Fields. This slide deck courtesy of Dan Klein at UC Berkeley
AI Adjcent Fields Philosophy: Logic, methods of resoning Mind s physicl system Foundtions of lerning, lnguge, rtionlity Mthemtics Forml representtion nd proof Algorithms, computtion, (un)decidility, (in)trctility
More informationZZ - Advanced Math Review 2017
ZZ - Advnced Mth Review Mtrix Multipliction Given! nd! find the sum of the elements of the product BA First, rewrite the mtrices in the correct order to multiply The product is BA hs order x since B is
More informationOn String Matching in Chunked Texts
On String Mtching in Chunked Texts Hnnu Peltol nd Jorm Trhio {hpeltol, trhio}@cs.hut.fi Deprtment of Computer Science nd Engineering Helsinki University of Technology P.O. Box 5400, FI-02015 HUT, Finlnd
More informationCS481: Bioinformatics Algorithms
CS481: Bioinformtics Algorithms Cn Alkn EA509 clkn@cs.ilkent.edu.tr http://www.cs.ilkent.edu.tr/~clkn/teching/cs481/ EXACT STRING MATCHING Fingerprint ide Assume: We cn compute fingerprint f(p) of P in
More informationInformation Retrieval and Organisation
Informtion Retrievl nd Orgnistion Suffix Trees dpted from http://www.mth.tu.c.il/~himk/seminr02/suffixtrees.ppt Dell Zhng Birkeck, University of London Trie A tree representing set of strings { } eef d
More informationQuiz2 45mins. Personal Number: Problem 1. (20pts) Here is an Table of Perl Regular Ex
Long Quiz2 45mins Nme: Personl Numer: Prolem. (20pts) Here is n Tle of Perl Regulr Ex Chrcter Description. single chrcter \s whitespce chrcter (spce, t, newline) \S non-whitespce chrcter \d digit (0-9)
More informationLexical Analysis: Constructing a Scanner from Regular Expressions
Lexicl Anlysis: Constructing Scnner from Regulr Expressions Gol Show how to construct FA to recognize ny RE This Lecture Convert RE to n nondeterministic finite utomton (NFA) Use Thompson s construction
More informationAnnouncements. CS 188: Artificial Intelligence Fall Recap: Search. Today. Example: Pancake Problem. Example: Pancake Problem
Announcements Project : erch It s live! Due 9/. trt erly nd sk questions. It s longer thn most! Need prtner? Come up fter clss or try Pizz ections: cn go to ny, ut hve priority in your own C 88: Artificil
More information4-1 NAME DATE PERIOD. Study Guide. Parallel Lines and Planes P Q, O Q. Sample answers: A J, A F, and D E
4-1 NAME DATE PERIOD Pges 142 147 Prllel Lines nd Plnes When plnes do not intersect, they re sid to e prllel. Also, when lines in the sme plne do not intersect, they re prllel. But when lines re not in
More informationDefinition of Regular Expression
Definition of Regulr Expression After the definition of the string nd lnguges, we re redy to descrie regulr expressions, the nottion we shll use to define the clss of lnguges known s regulr sets. Recll
More informationOrthogonal line segment intersection
Computtionl Geometry [csci 3250] Line segment intersection The prolem (wht) Computtionl Geometry [csci 3250] Orthogonl line segment intersection Applictions (why) Algorithms (how) A specil cse: Orthogonl
More informationITEC2620 Introduction to Data Structures
ITEC0 Introduction to Dt Structures Lecture 7 Queues, Priority Queues Queues I A queue is First-In, First-Out = FIFO uffer e.g. line-ups People enter from the ck of the line People re served (exit) from
More informationGreedy Algorithm. Algorithm Fall Semester
Greey Algorithm Algorithm 0 Fll Semester Optimiztion prolems An optimiztion prolem is one in whih you wnt to fin, not just solution, ut the est solution A greey lgorithm sometimes works well for optimiztion
More informationApplied Databases. Sebastian Maneth. Lecture 13 Online Pattern Matching on Strings. University of Edinburgh - February 29th, 2016
Applied Dtses Lecture 13 Online Pttern Mtching on Strings Sestin Mneth University of Edinurgh - Ferury 29th, 2016 2 Outline 1. Nive Method 2. Automton Method 3. Knuth-Morris-Prtt Algorithm 4. Boyer-Moore
More information6.3 Volumes. Just as area is always positive, so is volume and our attitudes towards finding it.
6.3 Volumes Just s re is lwys positive, so is volume nd our ttitudes towrds finding it. Let s review how to find the volume of regulr geometric prism, tht is, 3-dimensionl oject with two regulr fces seprted
More informationSection 3.1: Sequences and Series
Section.: Sequences d Series Sequences Let s strt out with the definition of sequence: sequence: ordered list of numbers, often with definite pttern Recll tht in set, order doesn t mtter so this is one
More informationNOTES. Figure 1 illustrates typical hardware component connections required when using the JCM ICB Asset Ticket Generator software application.
ICB Asset Ticket Genertor Opertor s Guide Septemer, 2016 Septemer, 2016 NOTES Opertor s Guide ICB Asset Ticket Genertor Softwre Instlltion nd Opertion This document contins informtion for downloding, instlling,
More informationLecture 10 Evolutionary Computation: Evolution strategies and genetic programming
Lecture 10 Evolutionry Computtion: Evolution strtegies nd genetic progrmming Evolution strtegies Genetic progrmming Summry Negnevitsky, Person Eduction, 2011 1 Evolution Strtegies Another pproch to simulting
More informationLecture T4: Pattern Matching
Introduction to Theoreticl CS Lecture T4: Pttern Mtching Two fundmentl questions. Wht cn computer do? How fst cn it do it? Generl pproch. Don t tlk bout specific mchines or problems. Consider miniml bstrct
More informationLanguages. L((a (b)(c))*) = { ε,a,bc,aa,abc,bca,... } εw = wε = w. εabba = abbaε = abba. (a (b)(c)) *
Pln for Tody nd Beginning Next week Interpreter nd Compiler Structure, or Softwre Architecture Overview of Progrmming Assignments The MeggyJv compiler we will e uilding. Regulr Expressions Finite Stte
More informationLecture T1: Pattern Matching
Introduction to Theoreticl CS Lecture T: Pttern Mtchin Two fundmentl questions. Wht cn computer do? Wht cn computer do with limited resources? Generl pproch. Don t tlk out specific mchines or prolems.
More informationStart Here. Remove all tape and lift display. Locate components
HP Photosmrt 2600/2700 series ll-in-one User Guide Strt Here 1 USB cle users: Do not connect the USB cle until this guide instructs you to or the softwre my not instll properly. Use this guide to set up
More informationThe Math Learning Center PO Box 12929, Salem, Oregon Math Learning Center
Resource Overview Quntile Mesure: Skill or Concept: 80Q Multiply two frctions or frction nd whole numer. (QT N ) Excerpted from: The Mth Lerning Center PO Box 99, Slem, Oregon 9709 099 www.mthlerningcenter.org
More informationCS143 Handout 07 Summer 2011 June 24 th, 2011 Written Set 1: Lexical Analysis
CS143 Hndout 07 Summer 2011 June 24 th, 2011 Written Set 1: Lexicl Anlysis In this first written ssignment, you'll get the chnce to ply round with the vrious constructions tht come up when doing lexicl
More informationPPS: User Manual. Krishnendu Chatterjee, Martin Chmelik, Raghav Gupta, and Ayush Kanodia
PPS: User Mnul Krishnendu Chtterjee, Mrtin Chmelik, Rghv Gupt, nd Ayush Knodi IST Austri (Institute of Science nd Technology Austri), Klosterneuurg, Austri In this section we descrie the tool fetures,
More informationP(r)dr = probability of generating a random number in the interval dr near r. For this probability idea to make sense we must have
Rndom Numers nd Monte Crlo Methods Rndom Numer Methods The integrtion methods discussed so fr ll re sed upon mking polynomil pproximtions to the integrnd. Another clss of numericl methods relies upon using
More informationStudy of LZ77 and LZ78 Data Compression Techniques
Study of LZ77 and LZ78 Data Compression Techniques Suman M. Choudhary, Anjali S. Patel, Sonal J. Parmar Abstract Data Compression is defined as the science and art of the representation of information
More informationCompilers Spring 2013 PRACTICE Midterm Exam
Compilers Spring 2013 PRACTICE Midterm Exm This is full length prctice midterm exm. If you wnt to tke it t exm pce, give yourself 7 minutes to tke the entire test. Just like the rel exm, ech question hs
More informationLexical Analysis. Amitabha Sanyal. (www.cse.iitb.ac.in/ as) Department of Computer Science and Engineering, Indian Institute of Technology, Bombay
Lexicl Anlysis Amith Snyl (www.cse.iit.c.in/ s) Deprtment of Computer Science nd Engineering, Indin Institute of Technology, Bomy Septemer 27 College of Engineering, Pune Lexicl Anlysis: 2/6 Recp The input
More informationCS/COE 1501
CS/COE 1501 www.cs.pitt.edu/~lipschultz/cs1501/ Compression What is compression? Represent the same data using less storage space Can get more use out a disk of a given size Can get more use out of memory
More informationCS412/413. Introduction to Compilers Tim Teitelbaum. Lecture 4: Lexical Analyzers 28 Jan 08
CS412/413 Introduction to Compilers Tim Teitelum Lecture 4: Lexicl Anlyzers 28 Jn 08 Outline DFA stte minimiztion Lexicl nlyzers Automting lexicl nlysis Jlex lexicl nlyzer genertor CS 412/413 Spring 2008
More informationIntroduction to Integration
Introduction to Integrtion Definite integrls of piecewise constnt functions A constnt function is function of the form Integrtion is two things t the sme time: A form of summtion. The opposite of differentition.
More informationCS 221: Artificial Intelligence Fall 2011
CS 221: Artificil Intelligence Fll 2011 Lecture 2: Serch (Slides from Dn Klein, with help from Sturt Russell, Andrew Moore, Teg Grenger, Peter Norvig) Problem types! Fully observble, deterministic! single-belief-stte
More informationSystems I. Logic Design I. Topics Digital logic Logic gates Simple combinational logic circuits
Systems I Logic Design I Topics Digitl logic Logic gtes Simple comintionl logic circuits Simple C sttement.. C = + ; Wht pieces of hrdwre do you think you might need? Storge - for vlues,, C Computtion
More information1.5 Extrema and the Mean Value Theorem
.5 Extrem nd the Men Vlue Theorem.5. Mximum nd Minimum Vlues Definition.5. (Glol Mximum). Let f : D! R e function with domin D. Then f hs n glol mximum vlue t point c, iff(c) f(x) for ll x D. The vlue
More informationHyperbolas. Definition of Hyperbola
CHAT Pre-Clculus Hyperols The third type of conic is clled hyperol. For n ellipse, the sum of the distnces from the foci nd point on the ellipse is fixed numer. For hyperol, the difference of the distnces
More informationUNIT 11. Query Optimization
UNIT Query Optimiztion Contents Introduction to Query Optimiztion 2 The Optimiztion Process: An Overview 3 Optimiztion in System R 4 Optimiztion in INGRES 5 Implementing the Join Opertors Wei-Png Yng,
More informationLR Parsing, Part 2. Constructing Parse Tables. Need to Automatically Construct LR Parse Tables: Action and GOTO Table
TDDD55 Compilers nd Interpreters TDDB44 Compiler Construction LR Prsing, Prt 2 Constructing Prse Tles Prse tle construction Grmmr conflict hndling Ctegories of LR Grmmrs nd Prsers Peter Fritzson, Christoph
More informationa < a+ x < a+2 x < < a+n x = b, n A i n f(x i ) x. i=1 i=1
Mth 33 Volume Stewrt 5.2 Geometry of integrls. In this section, we will lern how to compute volumes using integrls defined by slice nlysis. First, we recll from Clculus I how to compute res. Given the
More informationbox Boxes and Arrows 3 true 7.59 'X' An object is drawn as a box that contains its data members, for example:
Boxes nd Arrows There re two kinds of vriles in Jv: those tht store primitive vlues nd those tht store references. Primitive vlues re vlues of type long, int, short, chr, yte, oolen, doule, nd flot. References
More informationΕΠΛ323 - Θεωρία και Πρακτική Μεταγλωττιστών
ΕΠΛ323 - Θωρία και Πρακτική Μταγλωττιστών Lecture 3 Lexicl Anlysis Elis Athnsopoulos elisthn@cs.ucy.c.cy Recognition of Tokens if expressions nd reltionl opertors if è if then è then else è else relop
More informationChapter 9. Greedy Technique. Copyright 2007 Pearson Addison-Wesley. All rights reserved.
Chpter 9 Greey Tehnique Copyright 2007 Person Aison-Wesley. All rights reserve. Greey Tehnique Construts solution to n optimiztion prolem piee y piee through sequene of hoies tht re: fesile lolly optiml
More informationUnit #9 : Definite Integral Properties, Fundamental Theorem of Calculus
Unit #9 : Definite Integrl Properties, Fundmentl Theorem of Clculus Gols: Identify properties of definite integrls Define odd nd even functions, nd reltionship to integrl vlues Introduce the Fundmentl
More informationThe Greedy Method. The Greedy Method
Lists nd Itertors /8/26 Presenttion for use with the textook, Algorithm Design nd Applictions, y M. T. Goodrich nd R. Tmssi, Wiley, 25 The Greedy Method The Greedy Method The greedy method is generl lgorithm
More informationAnnouncements. CS 188: Artificial Intelligence Fall Recap: Search. Today. General Tree Search. Uniform Cost. Lecture 3: A* Search 9/4/2007
CS 88: Artificil Intelligence Fll 2007 Lecture : A* Serch 9/4/2007 Dn Klein UC Berkeley Mny slides over the course dpted from either Sturt Russell or Andrew Moore Announcements Sections: New section 06:
More informationthis grammar generates the following language: Because this symbol will also be used in a later step, it receives the
LR() nlysis Drwcks of LR(). Look-hed symols s eplined efore, concerning LR(), it is possile to consult the net set to determine, in the reduction sttes, for which symols it would e possile to perform reductions.
More informationcisc1110 fall 2010 lecture VI.2 call by value function parameters another call by value example:
cisc1110 fll 2010 lecture VI.2 cll y vlue function prmeters more on functions more on cll y vlue nd cll y reference pssing strings to functions returning strings from functions vrile scope glol vriles
More informationOUTPUT DELIVERY SYSTEM
Differences in ODS formtting for HTML with Proc Print nd Proc Report Lur L. M. Thornton, USDA-ARS, Animl Improvement Progrms Lortory, Beltsville, MD ABSTRACT While Proc Print is terrific tool for dt checking
More informationTopic 2: Lexing and Flexing
Topic 2: Lexing nd Flexing COS 320 Compiling Techniques Princeton University Spring 2016 Lennrt Beringer 1 2 The Compiler Lexicl Anlysis Gol: rek strem of ASCII chrcters (source/input) into sequence of
More informationGraphs with at most two trees in a forest building process
Grphs with t most two trees in forest uilding process rxiv:802.0533v [mth.co] 4 Fe 208 Steve Butler Mis Hmnk Mrie Hrdt Astrct Given grph, we cn form spnning forest y first sorting the edges in some order,
More informationSuffix Tries. Slides adapted from the course by Ben Langmead
Suffix Tries Slides dpted from the course y Ben Lngmed en.lngmed@gmil.com Indexing with suffixes Until now, our indexes hve een sed on extrcting sustrings from T A very different pproch is to extrct suffixes
More informationRegular Expression Matching with Multi-Strings and Intervals. Philip Bille Mikkel Thorup
Regulr Expression Mtching with Multi-Strings nd Intervls Philip Bille Mikkel Thorup Outline Definition Applictions Previous work Two new problems: Multi-strings nd chrcter clss intervls Algorithms Thompson
More informationDynamic Programming. Andreas Klappenecker. [partially based on slides by Prof. Welch] Monday, September 24, 2012
Dynmic Progrmming Andres Klppenecker [prtilly bsed on slides by Prof. Welch] 1 Dynmic Progrmming Optiml substructure An optiml solution to the problem contins within it optiml solutions to subproblems.
More information8.2 Areas in the Plane
39 Chpter 8 Applictions of Definite Integrls 8. Ares in the Plne Wht ou will lern out... Are Between Curves Are Enclosed Intersecting Curves Boundries with Chnging Functions Integrting with Respect to
More informationFrom Dependencies to Evaluation Strategies
From Dependencies to Evlution Strtegies Possile strtegies: 1 let the user define the evlution order 2 utomtic strtegy sed on the dependencies: use locl dependencies to determine which ttriutes to compute
More informationA Tautology Checker loosely related to Stålmarck s Algorithm by Martin Richards
A Tutology Checker loosely relted to Stålmrck s Algorithm y Mrtin Richrds mr@cl.cm.c.uk http://www.cl.cm.c.uk/users/mr/ University Computer Lortory New Museum Site Pemroke Street Cmridge, CB2 3QG Mrtin
More informationLossless compression II
Lossless II D 44 R 52 B 81 C 84 D 86 R 82 A 85 A 87 A 83 R 88 A 8A B 89 A 8B Symbol Probability Range a 0.2 [0.0, 0.2) e 0.3 [0.2, 0.5) i 0.1 [0.5, 0.6) o 0.2 [0.6, 0.8) u 0.1 [0.8, 0.9)! 0.1 [0.9, 1.0)
More informationSlides for Data Mining by I. H. Witten and E. Frank
Slides for Dt Mining y I. H. Witten nd E. Frnk Simplicity first Simple lgorithms often work very well! There re mny kinds of simple structure, eg: One ttriute does ll the work All ttriutes contriute eqully
More informationCS/COE 1501
CS/COE 1501 www.cs.pitt.edu/~nlf4/cs1501/ Compression What is compression? Represent the same data using less storage space Can get more use out a disk of a given size Can get more use out of memory E.g.,
More informationUninformed Search. Hal Daumé III. Computer Science University of Maryland CS 421: Introduction to Artificial Intelligence 31 Jan 2012
1 Hl Dumé III (me@hl3.nme) Uninformed Serch Hl Dumé III Comuter Science University of Mrylnd me@hl3.nme CS 421: Introduction to Artificil Intelligence 31 Jn 2012 Mny slides courtesy of Dn Klein, Sturt
More informationHow to Design REST API? Written Date : March 23, 2015
Visul Prdigm How Design REST API? Turil How Design REST API? Written Dte : Mrch 23, 2015 REpresenttionl Stte Trnsfer, n rchitecturl style tht cn be used in building networked pplictions, is becoming incresingly
More informationI/O Efficient Dynamic Data Structures for Longest Prefix Queries
I/O Efficient Dynmic Dt Structures for Longest Prefix Queries Moshe Hershcovitch 1 nd Him Kpln 2 1 Fculty of Electricl Engineering, moshik1@gmil.com 2 School of Computer Science, himk@cs.tu.c.il, Tel Aviv
More informationWhat do all those bits mean now? Number Systems and Arithmetic. Introduction to Binary Numbers. Questions About Numbers
Wht do ll those bits men now? bits (...) Number Systems nd Arithmetic or Computers go to elementry school instruction R-formt I-formt... integer dt number text chrs... floting point signed unsigned single
More informationSection 10.4 Hyperbolas
66 Section 10.4 Hyperbols Objective : Definition of hyperbol & hyperbols centered t (0, 0). The third type of conic we will study is the hyperbol. It is defined in the sme mnner tht we defined the prbol
More informationPARALLEL AND DISTRIBUTED COMPUTING
PARALLEL AND DISTRIBUTED COMPUTING 2009/2010 1 st Semester Teste Jnury 9, 2010 Durtion: 2h00 - No extr mteril llowed. This includes notes, scrtch pper, clcultor, etc. - Give your nswers in the ville spce
More informationCS 432 Fall Mike Lam, Professor a (bc)* Regular Expressions and Finite Automata
CS 432 Fll 2017 Mike Lm, Professor (c)* Regulr Expressions nd Finite Automt Compiltion Current focus "Bck end" Source code Tokens Syntx tree Mchine code chr dt[20]; int min() { flot x = 42.0; return 7;
More informationCSCI 104. Rafael Ferreira da Silva. Slides adapted from: Mark Redekopp and David Kempe
CSCI 0 fel Ferreir d Silv rfsilv@isi.edu Slides dpted from: Mrk edekopp nd Dvid Kempe LOG STUCTUED MEGE TEES Series Summtion eview Let n = + + + + k $ = #%& #. Wht is n? n = k+ - Wht is log () + log ()
More informationCSCI1950 Z Computa4onal Methods for Biology Lecture 2. Ben Raphael January 26, hhp://cs.brown.edu/courses/csci1950 z/ Outline
CSCI1950 Z Comput4onl Methods for Biology Lecture 2 Ben Rphel Jnury 26, 2009 hhp://cs.brown.edu/courses/csci1950 z/ Outline Review of trees. Coun4ng fetures. Chrcter bsed phylogeny Mximum prsimony Mximum
More informationcalled the vertex. The line through the focus perpendicular to the directrix is called the axis of the parabola.
Review of conic sections Conic sections re grphs of the form REVIEW OF CONIC SECTIONS prols ellipses hperols P(, ) F(, p) O p =_p REVIEW OF CONIC SECTIONS In this section we give geometric definitions
More informationLecture 7: Integration Techniques
Lecture 7: Integrtion Techniques Antiderivtives nd Indefinite Integrls. In differentil clculus, we were interested in the derivtive of given rel-vlued function, whether it ws lgeric, eponentil or logrithmic.
More informationCMPUT101 Introduction to Computing - Summer 2002
CMPUT Introdution to Computing - Summer 22 %XLOGLQJ&RPSXWHU&LUFXLWV Chpter 4.4 3XUSRVH We hve looked t so fr how to uild logi gtes from trnsistors. Next we will look t how to uild iruits from logi gtes,
More informationIntermediate Information Structures
CPSC 335 Intermedite Informtion Structures LECTURE 13 Suffix Trees Jon Rokne Computer Science University of Clgry Cnd Modified from CMSC 423 - Todd Trengen UMD upd Preprocessing Strings We will look t
More informationToday. Search Problems. Uninformed Search Methods. Depth-First Search Breadth-First Search Uniform-Cost Search
Uninformed Serch [These slides were creted by Dn Klein nd Pieter Abbeel for CS188 Intro to AI t UC Berkeley. All CS188 mterils re vilble t http://i.berkeley.edu.] Tody Serch Problems Uninformed Serch Methods
More informationCOMPUTER SCIENCE 123. Foundations of Computer Science. 6. Tuples
COMPUTER SCIENCE 123 Foundtions of Computer Science 6. Tuples Summry: This lecture introduces tuples in Hskell. Reference: Thompson Sections 5.1 2 R.L. While, 2000 3 Tuples Most dt comes with structure
More information