CS321 Languages and Compiler Design I. Winter 2012 Lecture 5

Size: px
Start display at page:

Download "CS321 Languages and Compiler Design I. Winter 2012 Lecture 5"

Transcription

1 CS321 Lnguges nd Compiler Design I Winter 2012 Lecture 5 1

2 FINITE AUTOMATA A non-deterministic finite utomton (NFA) consists of: An input lphet Σ, e.g. Σ =,. A set of sttes S, e.g. S = {1, 3, 5, 7, 11, 97}. A designted strt stte, e.g. stte 1. A designted set of finl sttes, e.g. {5, 97}. A set of trnsitions from sttes to sttes, lelled y elements of Σ or ǫ, e.g PSU CS321 W 12 LECTURE 5 c ANDREW TOLMACH 2

3 NFA S ACCEPT STRINGS Cn lso write s trnsition tle. Input Stte ǫ 0 {0,1} {0} {2} {3} 2 - {3} An NFA ccepts the string x if there is pth from strt to finl stte leled y the the chrcters of x, possily including some ǫ s. Exmple: NFA ove ccepts the strings,, nd, mong mny others. PSU CS321 W 12 LECTURE 5 c ANDREW TOLMACH 3

4 NFA S AND REGULAR LANGUAGES An NFA ccepts the lnguge L if it ccepts exctly the strings in L. Exmple: NFA ove ccepts the lnguge defined y the R.E. ( ) ( ǫ ). Fct: For every regulr lnguge L, there exists n NFA tht ccepts L. PSU CS321 W 12 LECTURE 5 c ANDREW TOLMACH 4

5 NFA S FROM R.E. S Cn give n lgorithm for constructing n NFA from n R.E., such tht the NFA ccepts the lnguge defined y the R.E. Algorithm is recursive, nd is sed on the recursively defined structure of R.E. s. Mkes hevy use of ǫ -trnsitions. Bse Constructions in Σ Inductive Constructions uild new mchines y connecting existing mchines using ǫ -trnsitions to existing initil sttes nd from existing finl sttes. Note tht ech constructed mchine hs exctly one initil stte nd one finl stte. PSU CS321 W 12 LECTURE 5 c ANDREW TOLMACH 5

6 INDUCTIVE CONSTRUCTIONS R R 1 2 M 1 M 2 R 01 R 1 2 M 1 M 2 R * M PSU CS321 W 12 LECTURE 5 c ANDREW TOLMACH 6

7 Exmple: ( )* (c) NFA CONSTRUCTION EXAMPLE ( )* c c PSU CS321 W 12 LECTURE 5 c ANDREW TOLMACH 7

8 Exmple (continued) c c ( )* (c) c PSU CS321 W 12 LECTURE 5 c ANDREW TOLMACH 8

9 Exmple (continued) Cn simplify NFA s y removing useless empty-string trnsitions: ( )* (c) c Or even simpler: c PSU CS321 W 12 LECTURE 5 c ANDREW TOLMACH 9

10 NFA S FOR LEXICAL PATTERN R.E.S ID letter (letter digit)* Non-deterministic letter shorthnd letter digit or, simpler: letter letter digit Still non-deterministic (when to stop??) IF i f RELATION < = > = = Non-deterministic Resolve non-determinism y ccepting longest possile string! PSU CS321 W 12 LECTURE 5 c ANDREW TOLMACH 10

11 Lexicl nlyzer must find mong set of ptterns. est mtch Try: NFA for pttern #1 Then try: NFA for pttern #2... Finlly, try: NFA for pttern #n Must reset input string fter ech unsuccessful mtch ttempt. Alwys choose pttern tht llows longest input string to mtch. Must specify which pttern should win if two or more mtch the sme length of input. PSU CS321 W 12 LECTURE 5 c ANDREW TOLMACH 11

12 Alterntively, comine ll the NFA s into one gint NFA, with distinguished finl sttes: NFA for pttern #1 NFA for pttern # NFA for pttern #n Now cn hve non-determinism etween ptterns, s well s within single pttern, e.g: i letter f letter Found keyword IF Found n identifier digit PSU CS321 W 12 LECTURE 5 c ANDREW TOLMACH 12

13 IMPLEMENTING NFA S Behvior of n NFA on given input string is miguous. So NFA s don t led to deterministic computer progrm. Cn convert to deterministic finite utomton (DFA). (Also clled finite stte mchine. ) Like NFA, ut hs no ǫ -trnsitions nd no symol lels more thn one trnsition from ny given node. Esy to simulte on computer. There is n lgorithm ( suset construction ) tht cn convert ny NFA to DFA tht ccepts the sme lnguge. Alterntive pproch: Simulte NFA directly y pretending to follow ll possile pths t once. To hndle longest mtch requirement, must keep trck of lst finl stte entered, nd cktrck to tht stte ( unreding chrcters) if get stuck. PSU CS321 W 12 LECTURE 5 c ANDREW TOLMACH 13

14 DFA AND BACKTRACKING EXAMPLE Given the following set of ptterns: + We wnt to uild mchine to find the longest mtch; in cse of ties, fvor the pttern listed first. Here s the NFA: * PSU CS321 W 12 LECTURE 5 c ANDREW TOLMACH 14

15 * CORRESPONDING DFA * *+ Consider input : Mchine stops in stte ( ). Pttern is. Lexeme is. PSU CS321 W 12 LECTURE 5 c ANDREW TOLMACH 15

16 * CORRESPONDING DFA * *+ Conider input : Mchine stops in stte (8) Pttern is +. Lexeme is. PSU CS321 W 12 LECTURE 5 c ANDREW TOLMACH 16

17 * CORRESPONDING DFA * *+ Consider input : Mchine stops fter second in stte (6 8). Pttern is ecuse it comes first in spec. Lexeme is ; finl will e red gin next time. PSU CS321 W 12 LECTURE 5 c ANDREW TOLMACH 17

18 * CORRESPONDING DFA * *+ Consider input : Mchine gets stuck fter in stte (12). Bcks up to stte (5 8 11), unreding Pttern is + Lexeme is ; finl will e red gin next time. PSU CS321 W 12 LECTURE 5 c ANDREW TOLMACH 18

19 JFLEX JFlex is lexicl nlyzer genertor Jv version of originl AT&T lex tool for C; mny similr tools exist. Detils of use my vry. ccepts specifiction of lexicl nlyzer. produces Jv progrm tht implements specifiction. PSU CS321 W 12 LECTURE 5 c ANDREW TOLMACH 19

20 JFlex source JFlex (foo.lex) run y: jv JFlex.Min foo.lex Lexicl nlyzer clss Yylex method yylex() in Jv (Yylex.jv) Jv Compiler prser or driver source files Chrcter input strem Lexicl Anlyzer Executle Tokens PSU CS321 W 12 LECTURE 5 c ANDREW TOLMACH 20

21 JFLEX RULE SPECIFICATIONS The min input to JFlex is sequence of rules, ech consisting of Pttern regulr expression (using ASCII s lphet) Action frgment of Jv code When prefix of input mtches pttern, the generted nlyzer executes the corresponding ction. Actions cn mke use of uilt-in vriles nd methods yytext() returns lexeme s String yyline contins current line numer (must use %line option). PSU CS321 W 12 LECTURE 5 c ANDREW TOLMACH 21

22 JFLEX RULES EXAMPLE %% %% integer {println("found keyword INTEGER");} [0-9]+ {println("found numer");} [A-Z][A-Z]* {println("found ident " + yytext());} [ \t\n] { /* ignore white spce */ } As usul, if more thn one pttern mtches, the longest mtch is preferred; ties re roken in fvor of rule tht ppers first. PSU CS321 W 12 LECTURE 5 c ANDREW TOLMACH 22

23 JFLEX PATTERNS Ptterns include literl text nd met-level opertors. Pttern Mtches x chrcter x "x" chrcter x even if it s n opertor \x ditto [xy] x or y [x-y] chrcters etween x nd y inclusive [^s] ny chrcter not in set s. ny chrcter ut \n p? n optionl p p* zero or more p s p+ one or more p s p q p or q () grouping {d} sustitute definition for d PSU CS321 W 12 LECTURE 5 c ANDREW TOLMACH 23

24 JFLEX ACTIONS Actions cn e ny vlid Jv sttement lock. Ordinrily ech ction termintes with sttement return t; which cuses yylex() to return with the token vlue t. Otherwise, yylex() throws wy the lexeme nd continues serching for nother pttern. This is suitle for hndling white spce. The simplest possile ction is just the empty lock {}. yylex() rises n exception if no pttern mtches. So it is good ide to include ctch-ll pttern s the lst rule, e.g.:. { System.err.println("Unexpected chrcter"); } PSU CS321 W 12 LECTURE 5 c ANDREW TOLMACH 24

25 JFLEX DIRECTIVES The complete form of JFlex specifiction is: user code %% JFlex directives %% rules Directives include control instructions, such s %line, which sys the generted code should keep trck of line numers. Directives cn lso include mcro definitions, which revite regulr expressions for lter use in ptterns, e.g., %% LETTERS=[-zA-Z_] DIGITS=[0-9] %% {LETTERS}({LETTERS} {DIGITS})* {return new Token(ID);} PSU CS321 W 12 LECTURE 5 c ANDREW TOLMACH 25

26 JFLEX USER CODE User code is just copied directly to the top of the generted.jv file; it cn contin functions nd glols to e invoked from the ctions. Such code cn lso e included in the directives section if enclosed etween %{ nd %}; in this cse, it is copied into the inside of the generted Yylex clss. PSU CS321 W 12 LECTURE 5 c ANDREW TOLMACH 26

27 JFLEX STATES JFlex permits multiple sets of rules to coexist in the sme specifiction. Ech set of rules is ssocited with stte. Rules prefixed with <nme> re recognized (only) when yylex() is in the stte nme. When yylex() strts running it is in the stte with the predefined nme YYINITIAL. You declre new stte nmes in %stte line in the definitions section of the spec. You put yylex() into stte nme y including the method cll yyegin(nme); in n ction. PSU CS321 W 12 LECTURE 5 c ANDREW TOLMACH 27

28 EXAMPLE USING JFLEX STATES Exmple: multi-line comments in Jv. %% %stte COMMENT %% <YYINITIAL>"/*" { yyegin(comment); } <COMMENT>"*/" { yyegin(yyinitial); } <COMMENT>. "\n" { /* ignore comments */ } <YYINITIAL>... ordinry rules follow <YYINITIAL>... PSU CS321 W 12 LECTURE 5 c ANDREW TOLMACH 28

Fig.25: the Role of LEX

Fig.25: the Role of LEX The Lnguge for Specifying Lexicl Anlyzer We shll now study how to uild lexicl nlyzer from specifiction of tokens in the form of list of regulr expressions The discussion centers round the design of n existing

More information

CS412/413. Introduction to Compilers Tim Teitelbaum. Lecture 4: Lexical Analyzers 28 Jan 08

CS412/413. Introduction to Compilers Tim Teitelbaum. Lecture 4: Lexical Analyzers 28 Jan 08 CS412/413 Introduction to Compilers Tim Teitelum Lecture 4: Lexicl Anlyzers 28 Jn 08 Outline DFA stte minimiztion Lexicl nlyzers Automting lexicl nlysis Jlex lexicl nlyzer genertor CS 412/413 Spring 2008

More information

Topic 2: Lexing and Flexing

Topic 2: Lexing and Flexing Topic 2: Lexing nd Flexing COS 320 Compiling Techniques Princeton University Spring 2016 Lennrt Beringer 1 2 The Compiler Lexicl Anlysis Gol: rek strem of ASCII chrcters (source/input) into sequence of

More information

Dr. D.M. Akbar Hussain

Dr. D.M. Akbar Hussain Dr. D.M. Akr Hussin Lexicl Anlysis. Bsic Ide: Red the source code nd generte tokens, it is similr wht humns will do to red in; just tking on the input nd reking it down in pieces. Ech token is sequence

More information

Definition of Regular Expression

Definition of Regular Expression Definition of Regulr Expression After the definition of the string nd lnguges, we re redy to descrie regulr expressions, the nottion we shll use to define the clss of lnguges known s regulr sets. Recll

More information

Lexical Analysis: Constructing a Scanner from Regular Expressions

Lexical Analysis: Constructing a Scanner from Regular Expressions Lexicl Anlysis: Constructing Scnner from Regulr Expressions Gol Show how to construct FA to recognize ny RE This Lecture Convert RE to n nondeterministic finite utomton (NFA) Use Thompson s construction

More information

In the last lecture, we discussed how valid tokens may be specified by regular expressions.

In the last lecture, we discussed how valid tokens may be specified by regular expressions. LECTURE 5 Scnning SYNTAX ANALYSIS We know from our previous lectures tht the process of verifying the syntx of the progrm is performed in two stges: Scnning: Identifying nd verifying tokens in progrm.

More information

Reducing a DFA to a Minimal DFA

Reducing a DFA to a Minimal DFA Lexicl Anlysis - Prt 4 Reducing DFA to Miniml DFA Input: DFA IN Assume DFA IN never gets stuck (dd ded stte if necessry) Output: DFA MIN An equivlent DFA with the minimum numer of sttes. Hrry H. Porter,

More information

CS 432 Fall Mike Lam, Professor a (bc)* Regular Expressions and Finite Automata

CS 432 Fall Mike Lam, Professor a (bc)* Regular Expressions and Finite Automata CS 432 Fll 2017 Mike Lm, Professor (c)* Regulr Expressions nd Finite Automt Compiltion Current focus "Bck end" Source code Tokens Syntx tree Mchine code chr dt[20]; int min() { flot x = 42.0; return 7;

More information

Languages. L((a (b)(c))*) = { ε,a,bc,aa,abc,bca,... } εw = wε = w. εabba = abbaε = abba. (a (b)(c)) *

Languages. L((a (b)(c))*) = { ε,a,bc,aa,abc,bca,... } εw = wε = w. εabba = abbaε = abba. (a (b)(c)) * Pln for Tody nd Beginning Next week Interpreter nd Compiler Structure, or Softwre Architecture Overview of Progrmming Assignments The MeggyJv compiler we will e uilding. Regulr Expressions Finite Stte

More information

Example: Source Code. Lexical Analysis. The Lexical Structure. Tokens. What do we really care here? A Sample Toy Program:

Example: Source Code. Lexical Analysis. The Lexical Structure. Tokens. What do we really care here? A Sample Toy Program: Lexicl Anlysis Red source progrm nd produce list of tokens ( liner nlysis) source progrm The lexicl structure is specified using regulr expressions Other secondry tsks: (1) get rid of white spces (e.g.,

More information

CS143 Handout 07 Summer 2011 June 24 th, 2011 Written Set 1: Lexical Analysis

CS143 Handout 07 Summer 2011 June 24 th, 2011 Written Set 1: Lexical Analysis CS143 Hndout 07 Summer 2011 June 24 th, 2011 Written Set 1: Lexicl Anlysis In this first written ssignment, you'll get the chnce to ply round with the vrious constructions tht come up when doing lexicl

More information

CMPSC 470: Compiler Construction

CMPSC 470: Compiler Construction CMPSC 47: Compiler Construction Plese complete the following: Midterm (Type A) Nme Instruction: Mke sure you hve ll pges including this cover nd lnk pge t the end. Answer ech question in the spce provided.

More information

CS 430 Spring Mike Lam, Professor. Parsing

CS 430 Spring Mike Lam, Professor. Parsing CS 430 Spring 2015 Mike Lm, Professor Prsing Syntx Anlysis We cn now formlly descrie lnguge's syntx Using regulr expressions nd BNF grmmrs How does tht help us? Syntx Anlysis We cn now formlly descrie

More information

Scanner Termination. Multi Character Lookahead. to its physical end. Most parsers require an end of file token. Lex and Jlex automatically create an

Scanner Termination. Multi Character Lookahead. to its physical end. Most parsers require an end of file token. Lex and Jlex automatically create an Scnner Termintion A scnner reds input chrcters nd prtitions them into tokens. Wht hppens when the end of the input file is reched? It my be useful to crete n Eof pseudo-chrcter when this occurs. In Jv,

More information

CSCE 531, Spring 2017, Midterm Exam Answer Key

CSCE 531, Spring 2017, Midterm Exam Answer Key CCE 531, pring 2017, Midterm Exm Answer Key 1. (15 points) Using the method descried in the ook or in clss, convert the following regulr expression into n equivlent (nondeterministic) finite utomton: (

More information

ΕΠΛ323 - Θεωρία και Πρακτική Μεταγλωττιστών

ΕΠΛ323 - Θεωρία και Πρακτική Μεταγλωττιστών ΕΠΛ323 - Θωρία και Πρακτική Μταγλωττιστών Lecture 3 Lexicl Anlysis Elis Athnsopoulos elisthn@cs.ucy.c.cy Recognition of Tokens if expressions nd reltionl opertors if è if then è then else è else relop

More information

Compiler Construction D7011E

Compiler Construction D7011E Compiler Construction D7011E Lecture 3: Lexer genertors Viktor Leijon Slides lrgely y John Nordlnder with mteril generously provided y Mrk P. Jones. 1 Recp: Hndwritten Lexers: Don t require sophisticted

More information

Finite Automata. Lecture 4 Sections Robb T. Koether. Hampden-Sydney College. Wed, Jan 21, 2015

Finite Automata. Lecture 4 Sections Robb T. Koether. Hampden-Sydney College. Wed, Jan 21, 2015 Finite Automt Lecture 4 Sections 3.6-3.7 Ro T. Koether Hmpden-Sydney College Wed, Jn 21, 2015 Ro T. Koether (Hmpden-Sydney College) Finite Automt Wed, Jn 21, 2015 1 / 23 1 Nondeterministic Finite Automt

More information

Lexical analysis, scanners. Construction of a scanner

Lexical analysis, scanners. Construction of a scanner Lexicl nlysis scnners (NB. Pges 4-5 re for those who need to refresh their knowledge of DFAs nd NFAs. These re not presented during the lectures) Construction of scnner Tools: stte utomt nd trnsition digrms.

More information

Principles of Programming Languages

Principles of Programming Languages Principles of Progrmming Lnguges h"p://www.di.unipi.it/~ndre/did2c/plp- 14/ Prof. Andre Corrdini Deprtment of Computer Science, Pis Lesson 5! Gener;on of Lexicl Anlyzers Creting Lexicl Anlyzer with Lex

More information

Lexical Analysis. Amitabha Sanyal. (www.cse.iitb.ac.in/ as) Department of Computer Science and Engineering, Indian Institute of Technology, Bombay

Lexical Analysis. Amitabha Sanyal. (www.cse.iitb.ac.in/ as) Department of Computer Science and Engineering, Indian Institute of Technology, Bombay Lexicl Anlysis Amith Snyl (www.cse.iit.c.in/ s) Deprtment of Computer Science nd Engineering, Indin Institute of Technology, Bomy Septemer 27 College of Engineering, Pune Lexicl Anlysis: 2/6 Recp The input

More information

this grammar generates the following language: Because this symbol will also be used in a later step, it receives the

this grammar generates the following language: Because this symbol will also be used in a later step, it receives the LR() nlysis Drwcks of LR(). Look-hed symols s eplined efore, concerning LR(), it is possile to consult the net set to determine, in the reduction sttes, for which symols it would e possile to perform reductions.

More information

Lexical Analysis and Lexical Analyzer Generators

Lexical Analysis and Lexical Analyzer Generators 1 Lexicl Anlysis nd Lexicl Anlyzer Genertors Chpter 3 COP5621 Compiler Construction Copyright Roert vn Engelen, Florid Stte University, 2007-2009 2 The Reson Why Lexicl Anlysis is Seprte Phse Simplifies

More information

CSCI 3130: Formal Languages and Automata Theory Lecture 12 The Chinese University of Hong Kong, Fall 2011

CSCI 3130: Formal Languages and Automata Theory Lecture 12 The Chinese University of Hong Kong, Fall 2011 CSCI 3130: Forml Lnguges nd utomt Theory Lecture 12 The Chinese University of Hong Kong, Fll 2011 ndrej Bogdnov In progrmming lnguges, uilding prse trees is significnt tsk ecuse prse trees tell us the

More information

CSc 453. Compilers and Systems Software. 4 : Lexical Analysis II. Department of Computer Science University of Arizona

CSc 453. Compilers and Systems Software. 4 : Lexical Analysis II. Department of Computer Science University of Arizona CSc 453 Compilers nd Systems Softwre 4 : Lexicl Anlysis II Deprtment of Computer Science University of Arizon collerg@gmil.com Copyright c 2009 Christin Collerg Implementing Automt NFAs nd DFAs cn e hrd-coded

More information

Compilation

Compilation Compiltion 0368-3133 Lecture 2: Lexicl Anlysis Nom Rinetzky 1 2 Lexicl Anlysis Modern Compiler Design: Chpter 2.1 3 Conceptul Structure of Compiler Compiler Source text txt Frontend Semntic Representtion

More information

COMP 423 lecture 11 Jan. 28, 2008

COMP 423 lecture 11 Jan. 28, 2008 COMP 423 lecture 11 Jn. 28, 2008 Up to now, we hve looked t how some symols in n lphet occur more frequently thn others nd how we cn sve its y using code such tht the codewords for more frequently occuring

More information

CS 340, Fall 2014 Dec 11 th /13 th Final Exam Note: in all questions, the special symbol ɛ (epsilon) is used to indicate the empty string.

CS 340, Fall 2014 Dec 11 th /13 th Final Exam Note: in all questions, the special symbol ɛ (epsilon) is used to indicate the empty string. CS 340, Fll 2014 Dec 11 th /13 th Finl Exm Nme: Note: in ll questions, the specil symol ɛ (epsilon) is used to indicte the empty string. Question 1. [5 points] Consider the following regulr expression;

More information

Quiz2 45mins. Personal Number: Problem 1. (20pts) Here is an Table of Perl Regular Ex

Quiz2 45mins. Personal Number: Problem 1. (20pts) Here is an Table of Perl Regular Ex Long Quiz2 45mins Nme: Personl Numer: Prolem. (20pts) Here is n Tle of Perl Regulr Ex Chrcter Description. single chrcter \s whitespce chrcter (spce, t, newline) \S non-whitespce chrcter \d digit (0-9)

More information

ΕΠΛ323 - Θεωρία και Πρακτική Μεταγλωττιστών. Lecture 3b Lexical Analysis Elias Athanasopoulos

ΕΠΛ323 - Θεωρία και Πρακτική Μεταγλωττιστών. Lecture 3b Lexical Analysis Elias Athanasopoulos ΕΠΛ323 - Θωρία και Πρακτική Μταγλωττιστών Lecture 3 Lexicl Anlysis Elis Athnsopoulos elisthn@cs.ucy.c.cy RecogniNon of Tokens if expressions nd relnonl opertors if è if then è then else è else relop è

More information

Applied Databases. Sebastian Maneth. Lecture 13 Online Pattern Matching on Strings. University of Edinburgh - February 29th, 2016

Applied Databases. Sebastian Maneth. Lecture 13 Online Pattern Matching on Strings. University of Edinburgh - February 29th, 2016 Applied Dtses Lecture 13 Online Pttern Mtching on Strings Sestin Mneth University of Edinurgh - Ferury 29th, 2016 2 Outline 1. Nive Method 2. Automton Method 3. Knuth-Morris-Prtt Algorithm 4. Boyer-Moore

More information

Assignment 4. Due 09/18/17

Assignment 4. Due 09/18/17 Assignment 4. ue 09/18/17 1. ). Write regulr expressions tht define the strings recognized by the following finite utomt: b d b b b c c b) Write FA tht recognizes the tokens defined by the following regulr

More information

Implementing Automata. CSc 453. Compilers and Systems Software. 4 : Lexical Analysis II. Department of Computer Science University of Arizona

Implementing Automata. CSc 453. Compilers and Systems Software. 4 : Lexical Analysis II. Department of Computer Science University of Arizona Implementing utomt Sc 5 ompilers nd Systems Softwre : Lexicl nlysis II Deprtment of omputer Science University of rizon collerg@gmil.com opyright c 009 hristin ollerg NFs nd DFs cn e hrd-coded using this

More information

Scanner Termination. Multi Character Lookahead

Scanner Termination. Multi Character Lookahead If d.doublevlue() represents vlid integer, (int) d.doublevlue() will crete the pproprite integer vlue. If string representtion of n integer begins with ~ we cn strip the ~, convert to double nd then negte

More information

CS 241 Week 4 Tutorial Solutions

CS 241 Week 4 Tutorial Solutions CS 4 Week 4 Tutoril Solutions Writing n Assemler, Prt & Regulr Lnguges Prt Winter 8 Assemling instrutions utomtilly. slt $d, $s, $t. Solution: $d, $s, nd $t ll fit in -it signed integers sine they re 5-it

More information

CSE 401 Midterm Exam 11/5/10 Sample Solution

CSE 401 Midterm Exam 11/5/10 Sample Solution Question 1. egulr expressions (20 points) In the Ad Progrmming lnguge n integer constnt contins one or more digits, but it my lso contin embedded underscores. Any underscores must be preceded nd followed

More information

Deterministic. Finite Automata. And Regular Languages. Fall 2018 Costas Busch - RPI 1

Deterministic. Finite Automata. And Regular Languages. Fall 2018 Costas Busch - RPI 1 Deterministic Finite Automt And Regulr Lnguges Fll 2018 Costs Busch - RPI 1 Deterministic Finite Automton (DFA) Input Tpe String Finite Automton Output Accept or Reject Fll 2018 Costs Busch - RPI 2 Trnsition

More information

If you are at the university, either physically or via the VPN, you can download the chapters of this book as PDFs.

If you are at the university, either physically or via the VPN, you can download the chapters of this book as PDFs. Lecture 5 Wlks, Trils, Pths nd Connectedness Reding: Some of the mteril in this lecture comes from Section 1.2 of Dieter Jungnickel (2008), Grphs, Networks nd Algorithms, 3rd edition, which is ville online

More information

Fall Compiler Principles Lecture 1: Lexical Analysis. Roman Manevich Ben-Gurion University of the Negev

Fall Compiler Principles Lecture 1: Lexical Analysis. Roman Manevich Ben-Gurion University of the Negev Fll 2016-2017 Compiler Principles Lecture 1: Lexicl Anlysis Romn Mnevich Ben-Gurion University of the Negev Agend Understnd role of lexicl nlysis in compiler Regulr lnguges reminder Lexicl nlysis lgorithms

More information

Fall Compiler Principles Lecture 1: Lexical Analysis. Roman Manevich Ben-Gurion University

Fall Compiler Principles Lecture 1: Lexical Analysis. Roman Manevich Ben-Gurion University Fll 2014-2015 Compiler Principles Lecture 1: Lexicl Anlysis Romn Mnevich Ben-Gurion University Agend Understnd role of lexicl nlysis in compiler Lexicl nlysis theory Implementing professionl scnner vi

More information

LR Parsing, Part 2. Constructing Parse Tables. Need to Automatically Construct LR Parse Tables: Action and GOTO Table

LR Parsing, Part 2. Constructing Parse Tables. Need to Automatically Construct LR Parse Tables: Action and GOTO Table TDDD55 Compilers nd Interpreters TDDB44 Compiler Construction LR Prsing, Prt 2 Constructing Prse Tles Prse tle construction Grmmr conflict hndling Ctegories of LR Grmmrs nd Prsers Peter Fritzson, Christoph

More information

Operator Precedence. Java CUP. E E + T T T * P P P id id id. Does a+b*c mean (a+b)*c or

Operator Precedence. Java CUP. E E + T T T * P P P id id id. Does a+b*c mean (a+b)*c or Opertor Precedence Most progrmming lnguges hve opertor precedence rules tht stte the order in which opertors re pplied (in the sence of explicit prentheses). Thus in C nd Jv nd CSX, +*c mens compute *c,

More information

TO REGULAR EXPRESSIONS

TO REGULAR EXPRESSIONS Suject :- Computer Science Course Nme :- Theory Of Computtion DA TO REGULAR EXPRESSIONS Report Sumitted y:- Ajy Singh Meen 07000505 jysmeen@cse.iit.c.in BASIC DEINITIONS DA:- A finite stte mchine where

More information

Should be done. Do Soon. Structure of a Typical Compiler. Plan for Today. Lab hours and Office hours. Quiz 1 is due tonight, was posted Tuesday night

Should be done. Do Soon. Structure of a Typical Compiler. Plan for Today. Lab hours and Office hours. Quiz 1 is due tonight, was posted Tuesday night Should e done L hours nd Office hours Sign up for the miling list t, strting to send importnt info to list http://groups.google.com/group/cs453-spring-2011 Red Ch 1 nd skim Ch 2 through 2.6, red 3.3 nd

More information

2014 Haskell January Test Regular Expressions and Finite Automata

2014 Haskell January Test Regular Expressions and Finite Automata 0 Hskell Jnury Test Regulr Expressions nd Finite Automt This test comprises four prts nd the mximum mrk is 5. Prts I, II nd III re worth 3 of the 5 mrks vilble. The 0 Hskell Progrmming Prize will be wrded

More information

CMSC 331 First Midterm Exam

CMSC 331 First Midterm Exam 0 00/ 1 20/ 2 05/ 3 15/ 4 15/ 5 15/ 6 20/ 7 30/ 8 30/ 150/ 331 First Midterm Exm 7 October 2003 CMC 331 First Midterm Exm Nme: mple Answers tudent ID#: You will hve seventy-five (75) minutes to complete

More information

COS 333: Advanced Programming Techniques

COS 333: Advanced Programming Techniques COS 333: Advnced Progrmming Techniques Brin Kernighn wk@cs, www.cs.princeton.edu/~wk 311 CS Building 609-258-2089 (ut emil is lwys etter) TA's: Junwen Li, li@cs, CS 217,258-0451 Yong Wng,yongwng@cs, CS

More information

Theory of Computation CSE 105

Theory of Computation CSE 105 $ $ $ Theory of Computtion CSE 105 Regulr Lnguges Study Guide nd Homework I Homework I: Solutions to the following problems should be turned in clss on July 1, 1999. Instructions: Write your nswers clerly

More information

CMPT 379 Compilers. Lexical Analysis

CMPT 379 Compilers. Lexical Analysis CMPT 379 Compilers Anoop Srkr http://www.cs.sfu.c/~noop 9//7 Lexicl Anlysis Also clled scnning, tke input progrm string nd convert into tokens Exmple: T_DOUBLE ( doule ) T_IDENT ( f ) T_OP ( = ) doule

More information

CS201 Discussion 10 DRAWTREE + TRIES

CS201 Discussion 10 DRAWTREE + TRIES CS201 Discussion 10 DRAWTREE + TRIES DrwTree First instinct: recursion As very generic structure, we could tckle this problem s follows: drw(): Find the root drw(root) drw(root): Write the line for the

More information

Java CUP. Java CUP Specifications. User Code Additions. Package and Import Specifications

Java CUP. Java CUP Specifications. User Code Additions. Package and Import Specifications Jv CUP Jv CUP is prser-genertion tool, similr to Ycc. CUP uilds Jv prser for LALR(1) grmmrs from production rules nd ssocited Jv code frgments. When prticulr production is recognized, its ssocited code

More information

CS 340, Fall 2016 Sep 29th Exam 1 Note: in all questions, the special symbol ɛ (epsilon) is used to indicate the empty string.

CS 340, Fall 2016 Sep 29th Exam 1 Note: in all questions, the special symbol ɛ (epsilon) is used to indicate the empty string. CS 340, Fll 2016 Sep 29th Exm 1 Nme: Note: in ll questions, the speil symol ɛ (epsilon) is used to indite the empty string. Question 1. [10 points] Speify regulr expression tht genertes the lnguge over

More information

CS 241. Fall 2017 Midterm Review Solutions. October 24, Bits and Bytes 1. 3 MIPS Assembler 6. 4 Regular Languages 7.

CS 241. Fall 2017 Midterm Review Solutions. October 24, Bits and Bytes 1. 3 MIPS Assembler 6. 4 Regular Languages 7. CS 241 Fll 2017 Midterm Review Solutions Octoer 24, 2017 Contents 1 Bits nd Bytes 1 2 MIPS Assemly Lnguge Progrmming 2 3 MIPS Assemler 6 4 Regulr Lnguges 7 5 Scnning 9 1 Bits nd Bytes 1. Give two s complement

More information

ASTs, Regex, Parsing, and Pretty Printing

ASTs, Regex, Parsing, and Pretty Printing ASTs, Regex, Prsing, nd Pretty Printing CS 2112 Fll 2016 1 Algeric Expressions To strt, consider integer rithmetic. Suppose we hve the following 1. The lphet we will use is the digits {0, 1, 2, 3, 4, 5,

More information

CS481: Bioinformatics Algorithms

CS481: Bioinformatics Algorithms CS481: Bioinformtics Algorithms Cn Alkn EA509 clkn@cs.ilkent.edu.tr http://www.cs.ilkent.edu.tr/~clkn/teching/cs481/ EXACT STRING MATCHING Fingerprint ide Assume: We cn compute fingerprint f(p) of P in

More information

Compilers Spring 2013 PRACTICE Midterm Exam

Compilers Spring 2013 PRACTICE Midterm Exam Compilers Spring 2013 PRACTICE Midterm Exm This is full length prctice midterm exm. If you wnt to tke it t exm pce, give yourself 7 minutes to tke the entire test. Just like the rel exm, ech question hs

More information

Midterm I Solutions CS164, Spring 2006

Midterm I Solutions CS164, Spring 2006 Midterm I Solutions CS164, Spring 2006 Februry 23, 2006 Plese red ll instructions (including these) crefully. Write your nme, login, SID, nd circle the section time. There re 8 pges in this exm nd 4 questions,

More information

12 <= rm <digit> 2 <= rm <no> 2 <= rm <no> <digit> <= rm <no> <= rm <number>

12 <= rm <digit> 2 <= rm <no> 2 <= rm <no> <digit> <= rm <no> <= rm <number> DDD16 Compilers nd Interpreters DDB44 Compiler Construction R Prsing Prt 1 R prsing concept Using prser genertor Prse ree Genertion Wht is R-prsing? eft-to-right scnning R Rigthmost derivtion in reverse

More information

P(r)dr = probability of generating a random number in the interval dr near r. For this probability idea to make sense we must have

P(r)dr = probability of generating a random number in the interval dr near r. For this probability idea to make sense we must have Rndom Numers nd Monte Crlo Methods Rndom Numer Methods The integrtion methods discussed so fr ll re sed upon mking polynomil pproximtions to the integrnd. Another clss of numericl methods relies upon using

More information

COS 333: Advanced Programming Techniques

COS 333: Advanced Programming Techniques COS 333: Advnced Progrmming Techniques How to find me wk@cs, www.cs.princeton.edu/~wk 311 CS Building 609-258-2089 (ut emil is lwys etter) TA's: Mtvey Arye (rye), Tom Jlin (tjlin), Nick Johnson (npjohnso)

More information

What are suffix trees?

What are suffix trees? Suffix Trees 1 Wht re suffix trees? Allow lgorithm designers to store very lrge mount of informtion out strings while still keeping within liner spce Allow users to serch for new strings in the originl

More information

ECE 468/573 Midterm 1 September 28, 2012

ECE 468/573 Midterm 1 September 28, 2012 ECE 468/573 Midterm 1 September 28, 2012 Nme:! Purdue emil:! Plese sign the following: I ffirm tht the nswers given on this test re mine nd mine lone. I did not receive help from ny person or mteril (other

More information

Tries. Yufei Tao KAIST. April 9, Y. Tao, April 9, 2013 Tries

Tries. Yufei Tao KAIST. April 9, Y. Tao, April 9, 2013 Tries Tries Yufei To KAIST April 9, 2013 Y. To, April 9, 2013 Tries In this lecture, we will discuss the following exct mtching prolem on strings. Prolem Let S e set of strings, ech of which hs unique integer

More information

COMBINATORIAL PATTERN MATCHING

COMBINATORIAL PATTERN MATCHING COMBINATORIAL PATTERN MATCHING Genomic Repets Exmple of repets: ATGGTCTAGGTCCTAGTGGTC Motivtion to find them: Genomic rerrngements re often ssocited with repets Trce evolutionry secrets Mny tumors re chrcterized

More information

Information Retrieval and Organisation

Information Retrieval and Organisation Informtion Retrievl nd Orgnistion Suffix Trees dpted from http://www.mth.tu.c.il/~himk/seminr02/suffixtrees.ppt Dell Zhng Birkeck, University of London Trie A tree representing set of strings { } eef d

More information

Solving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence Winter 2016

Solving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence Winter 2016 Solving Prolems y Serching CS 486/686: Introduction to Artificil Intelligence Winter 2016 1 Introduction Serch ws one of the first topics studied in AI - Newell nd Simon (1961) Generl Prolem Solver Centrl

More information

Suffix trees, suffix arrays, BWT

Suffix trees, suffix arrays, BWT ALGORITHMES POUR LA BIO-INFORMATIQUE ET LA VISUALISATION COURS 3 Rluc Uricru Suffix trees, suffix rrys, BWT Bsed on: Suffix trees nd suffix rrys presenttion y Him Kpln Suffix trees course y Pco Gomez Liner-Time

More information

cisc1110 fall 2010 lecture VI.2 call by value function parameters another call by value example:

cisc1110 fall 2010 lecture VI.2 call by value function parameters another call by value example: cisc1110 fll 2010 lecture VI.2 cll y vlue function prmeters more on functions more on cll y vlue nd cll y reference pssing strings to functions returning strings from functions vrile scope glol vriles

More information

Context-Free Grammars

Context-Free Grammars Context-Free Grmmrs Descriing Lnguges We've seen two models for the regulr lnguges: Finite utomt ccept precisely the strings in the lnguge. Regulr expressions descrie precisely the strings in the lnguge.

More information

Regular Expressions and Automata using Miranda

Regular Expressions and Automata using Miranda Regulr Expressions nd Automt using Mirnd Simon Thompson Computing Lortory Univerisity of Kent t Cnterury My 1995 Contents 1 Introduction ::::::::::::::::::::::::::::::::: 1 2 Regulr Expressions :::::::::::::::::::::::::::::

More information

Scanning Theory and Practice

Scanning Theory and Practice CHAPTER 3 Scnning Theory nd Prctice 3.1 Overview The primry function of scnner is to red in chrcters from source file nd group them into tokens. A scnner is sometimes clled lexicl nlyzer or lexer. The

More information

Regular Expression Matching with Multi-Strings and Intervals. Philip Bille Mikkel Thorup

Regular Expression Matching with Multi-Strings and Intervals. Philip Bille Mikkel Thorup Regulr Expression Mtching with Multi-Strings nd Intervls Philip Bille Mikkel Thorup Outline Definition Applictions Previous work Two new problems: Multi-strings nd chrcter clss intervls Algorithms Thompson

More information

CS 321 Programming Languages and Compilers. Bottom Up Parsing

CS 321 Programming Languages and Compilers. Bottom Up Parsing CS 321 Progrmming nguges nd Compilers Bottom Up Prsing Bottom-up Prsing: Shift-reduce prsing Grmmr H: fi ; fi b Input: ;;b hs prse tree ; ; b 2 Dt for Shift-reduce Prser Input string: sequence of tokens

More information

Example: 2:1 Multiplexer

Example: 2:1 Multiplexer Exmple: 2:1 Multiplexer Exmple #1 reg ; lwys @( or or s) egin if (s == 1') egin = ; else egin = ; 1 s B. Bs 114 Exmple: 2:1 Multiplexer Exmple #2 Normlly lwys include egin nd sttements even though they

More information

Lecture 10 Evolutionary Computation: Evolution strategies and genetic programming

Lecture 10 Evolutionary Computation: Evolution strategies and genetic programming Lecture 10 Evolutionry Computtion: Evolution strtegies nd genetic progrmming Evolution strtegies Genetic progrmming Summry Negnevitsky, Person Eduction, 2011 1 Evolution Strtegies Another pproch to simulting

More information

Algorithm Design (5) Text Search

Algorithm Design (5) Text Search Algorithm Design (5) Text Serch Tkshi Chikym School of Engineering The University of Tokyo Text Serch Find sustring tht mtches the given key string in text dt of lrge mount Key string: chr x[m] Text Dt:

More information

LEX5: Regexps to NFA. Lexical Analysis. CMPT 379: Compilers Instructor: Anoop Sarkar. anoopsarkar.github.io/compilers-class

LEX5: Regexps to NFA. Lexical Analysis. CMPT 379: Compilers Instructor: Anoop Sarkar. anoopsarkar.github.io/compilers-class LEX5: Regexps to NFA Lexicl Anlysis CMPT 379: Compilers Instructor: Anoop Srkr noopsrkr.github.io/compilers-clss Building Lexicl Anlyzer Token POern POern Regulr Expression Regulr Expression NFA NFA DFA

More information

2 Computing all Intersections of a Set of Segments Line Segment Intersection

2 Computing all Intersections of a Set of Segments Line Segment Intersection 15-451/651: Design & Anlysis of Algorithms Novemer 14, 2016 Lecture #21 Sweep-Line nd Segment Intersection lst chnged: Novemer 8, 2017 1 Preliminries The sweep-line prdigm is very powerful lgorithmic design

More information

Lecture T1: Pattern Matching

Lecture T1: Pattern Matching Introduction to Theoreticl CS Lecture T: Pttern Mtchin Two fundmentl questions. Wht cn computer do? Wht cn computer do with limited resources? Generl pproch. Don t tlk out specific mchines or prolems.

More information

Solving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence

Solving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence Solving Prolems y Serching CS 486/686: Introduction to Artificil Intelligence 1 Introduction Serch ws one of the first topics studied in AI - Newell nd Simon (1961) Generl Prolem Solver Centrl component

More information

Slides for Data Mining by I. H. Witten and E. Frank

Slides for Data Mining by I. H. Witten and E. Frank Slides for Dt Mining y I. H. Witten nd E. Frnk Simplicity first Simple lgorithms often work very well! There re mny kinds of simple structure, eg: One ttriute does ll the work All ttriutes contriute eqully

More information

Mid-term exam. Scores. Fall term 2012 KAIST EE209 Programming Structures for EE. Thursday Oct 25, Student's name: Student ID:

Mid-term exam. Scores. Fall term 2012 KAIST EE209 Programming Structures for EE. Thursday Oct 25, Student's name: Student ID: Fll term 2012 KAIST EE209 Progrmming Structures for EE Mid-term exm Thursdy Oct 25, 2012 Student's nme: Student ID: The exm is closed book nd notes. Red the questions crefully nd focus your nswers on wht

More information

UNIVERSITY OF EDINBURGH COLLEGE OF SCIENCE AND ENGINEERING SCHOOL OF INFORMATICS INFORMATICS 1 COMPUTATION & LOGIC INSTRUCTIONS TO CANDIDATES

UNIVERSITY OF EDINBURGH COLLEGE OF SCIENCE AND ENGINEERING SCHOOL OF INFORMATICS INFORMATICS 1 COMPUTATION & LOGIC INSTRUCTIONS TO CANDIDATES UNIVERSITY OF EDINBURGH COLLEGE OF SCIENCE AND ENGINEERING SCHOOL OF INFORMATICS INFORMATICS COMPUTATION & LOGIC Sturdy st April 7 : to : INSTRUCTIONS TO CANDIDATES This is tke-home exercise. It will not

More information

Sample Midterm Solutions COMS W4115 Programming Languages and Translators Monday, October 12, 2009

Sample Midterm Solutions COMS W4115 Programming Languages and Translators Monday, October 12, 2009 Deprtment of Computer cience Columbi University mple Midterm olutions COM W4115 Progrmming Lnguges nd Trnsltors Mondy, October 12, 2009 Closed book, no ids. ch question is worth 20 points. Question 5(c)

More information

Fall 2018 Midterm 1 October 11, ˆ You may not ask questions about the exam except for language clarifications.

Fall 2018 Midterm 1 October 11, ˆ You may not ask questions about the exam except for language clarifications. 15-112 Fll 2018 Midterm 1 October 11, 2018 Nme: Andrew ID: Recittion Section: ˆ You my not use ny books, notes, extr pper, or electronic devices during this exm. There should be nothing on your desk or

More information

Control-Flow Analysis and Loop Detection

Control-Flow Analysis and Loop Detection ! Control-Flow Anlysis nd Loop Detection!Lst time! PRE!Tody! Control-flow nlysis! Loops! Identifying loops using domintors! Reducibility! Using loop identifiction to identify induction vribles CS553 Lecture

More information

Context-Free Grammars

Context-Free Grammars Context-Free Grmmrs Descriing Lnguges We've seen two models for the regulr lnguges: Finite utomt ccept precisely the strings in the lnguge. Regulr expressions descrie precisely the strings in the lnguge.

More information

Suffix Tries. Slides adapted from the course by Ben Langmead

Suffix Tries. Slides adapted from the course by Ben Langmead Suffix Tries Slides dpted from the course y Ben Lngmed en.lngmed@gmil.com Indexing with suffixes Until now, our indexes hve een sed on extrcting sustrings from T A very different pproch is to extrct suffixes

More information

From Dependencies to Evaluation Strategies

From Dependencies to Evaluation Strategies From Dependencies to Evlution Strtegies Possile strtegies: 1 let the user define the evlution order 2 utomtic strtegy sed on the dependencies: use locl dependencies to determine which ttriutes to compute

More information

Homework. Context Free Languages III. Languages. Plan for today. Context Free Languages. CFLs and Regular Languages. Homework #5 (due 10/22)

Homework. Context Free Languages III. Languages. Plan for today. Context Free Languages. CFLs and Regular Languages. Homework #5 (due 10/22) Homework Context Free Lnguges III Prse Trees nd Homework #5 (due 10/22) From textbook 6.4,b 6.5b 6.9b,c 6.13 6.22 Pln for tody Context Free Lnguges Next clss of lnguges in our quest! Lnguges Recll. Wht

More information

Ma/CS 6b Class 1: Graph Recap

Ma/CS 6b Class 1: Graph Recap M/CS 6 Clss 1: Grph Recp By Adm Sheffer Course Detils Adm Sheffer. Office hour: Tuesdys 4pm. dmsh@cltech.edu TA: Victor Kstkin. Office hour: Tuesdys 7pm. 1:00 Mondy, Wednesdy, nd Fridy. http://www.mth.cltech.edu/~2014-15/2term/m006/

More information

10/12/17. Motivating Example. Lexical and Syntax Analysis (2) Recursive-Descent Parsing. Recursive-Descent Parsing. Recursive-Descent Parsing

10/12/17. Motivating Example. Lexical and Syntax Analysis (2) Recursive-Descent Parsing. Recursive-Descent Parsing. Recursive-Descent Parsing Motivting Exmple Lexicl nd yntx Anlysis (2) In Text: Chpter 4 Consider the grmmr -> cad A -> b Input string: w = cd How to build prse tree top-down? 2 Initilly crete tree contining single node (the strt

More information

CS311H: Discrete Mathematics. Graph Theory IV. A Non-planar Graph. Regions of a Planar Graph. Euler s Formula. Instructor: Işıl Dillig

CS311H: Discrete Mathematics. Graph Theory IV. A Non-planar Graph. Regions of a Planar Graph. Euler s Formula. Instructor: Işıl Dillig CS311H: Discrete Mthemtics Grph Theory IV Instructor: Işıl Dillig Instructor: Işıl Dillig, CS311H: Discrete Mthemtics Grph Theory IV 1/25 A Non-plnr Grph Regions of Plnr Grph The plnr representtion of

More information

Intermediate Information Structures

Intermediate Information Structures CPSC 335 Intermedite Informtion Structures LECTURE 13 Suffix Trees Jon Rokne Computer Science University of Clgry Cnd Modified from CMSC 423 - Todd Trengen UMD upd Preprocessing Strings We will look t

More information

stack of states and grammar symbols Stack-Bottom marker C. Kessler, IDA, Linköpings universitet. 1. <list> -> <list>, <element> 2.

stack of states and grammar symbols Stack-Bottom marker C. Kessler, IDA, Linköpings universitet. 1. <list> -> <list>, <element> 2. TDDB9 Compilers nd Interpreters TDDB44 Compiler Construction LR Prsing Updted/New slide mteril 007: Pushdown Automton for LR-Prsing Finite-stte pushdown utomton contins lterntingly sttes nd symols in NUΣ

More information

A Tautology Checker loosely related to Stålmarck s Algorithm by Martin Richards

A Tautology Checker loosely related to Stålmarck s Algorithm by Martin Richards A Tutology Checker loosely relted to Stålmrck s Algorithm y Mrtin Richrds mr@cl.cm.c.uk http://www.cl.cm.c.uk/users/mr/ University Computer Lortory New Museum Site Pemroke Street Cmridge, CB2 3QG Mrtin

More information

MTH 146 Conics Supplement

MTH 146 Conics Supplement 105- Review of Conics MTH 146 Conics Supplement In this section we review conics If ou ne more detils thn re present in the notes, r through section 105 of the ook Definition: A prol is the set of points

More information

Topic: Software Model Checking via Counter-Example Guided Abstraction Refinement. Having a BLAST with SLAM. Combining Strengths. SLAM Overview SLAM

Topic: Software Model Checking via Counter-Example Guided Abstraction Refinement. Having a BLAST with SLAM. Combining Strengths. SLAM Overview SLAM Hving BLAST with SLAM Topic: Softwre Model Checking vi Counter-Exmple Guided Abstrction Refinement There re esily two dozen SLAM/BLAST/MAGIC ppers; I will skim. # # Theorem Proving Combining Strengths

More information

Lecture T4: Pattern Matching

Lecture T4: Pattern Matching Introduction to Theoreticl CS Lecture T4: Pttern Mtching Two fundmentl questions. Wht cn computer do? How fst cn it do it? Generl pproch. Don t tlk bout specific mchines or problems. Consider miniml bstrct

More information