Homework. Context Free Languages III. Languages. Plan for today. Context Free Languages. CFLs and Regular Languages. Homework #5 (due 10/22)
|
|
- Gloria Booth
- 6 years ago
- Views:
Transcription
1 Homework Context Free Lnguges III Prse Trees nd Homework #5 (due 10/22) From textbook 6.4,b 6.5b 6.9b,c Pln for tody Context Free Lnguges Next clss of lnguges in our quest! Lnguges Recll. Wht is lnguge? Wht is clss of lnguges? Context Free Lnguges Context Free Lnguges(CFL) is the next clss of lnguges outside of Regulr Lnguges: Mens for defining: Context Free Grmmr Mchine for ccepting: Pushdown Automt CFLs nd Regulr Lnguges Venn digrm of lnguges Context Free Lnguges Regulr Lnguges Finite Lnguges 1
2 Context Free Grmmrs Let s formlize this bit: A context free grmmr (CFG) is 4-tuple: (V, Σ,, P) where V is set of vribles Σ is set of terminls V nd Σ re disjoint (I.e. V Σ= ) V, is your strt symbol Context Free Grmmrs Let s formlize this bit: Production rules Of the form A βwhere A V β (V ) * string with symbols from V nd We sy tht γ cn be derived from α in one step: A βis rule α = α 1 A α 2 γ = α 1 βα 2 α γ Pln for tody Ambiguous Grmmrs nd Prse Trees Questions? Prse Trees Grphicl mens to illustrte derivtion of string from grmmr Root of the tree = strt vrible Interior nodes = other vribles Children of nodes = ppliction of production rule Lef nodes = Terminl symbols Another exmple Find CFG to describe: L = { i b j c k i = k} B (1) c (2) B bb (3) B Λ (4) Cn lso write s B c B bb Λ Another exmple Let s derive string from L: bbcc c rule 2 cc rule 2 Bcc rule 1 bbcc rule 3 bbbcc rule 3 bbλcc rule 4 = bbcc 2
3 An inorder trversl of the tree will give the the string derived. Prse Tree c c B b b B B Λ Rule 2 Rule 2 Rule 1 Rule 3 Rule 3 Rule 4 Recll our exmple from lst time Defining the grmmr for lgebric expressions Production rules + (1) (2) * (3) / (4) () (5) (6) One more exmple Prse Tree how derivtion for + * + rule * rule 3 + * + * + * + rule * rule 3 + * + * One more exmple Prse Tree Another derivtion for + * * rule 3 * + * rule 1 + * + * * + * rule 3 * + * rule 1 + * + * 3
4 Prse trees + * * + A CFG is sid to be mbiguous if there is t lest 1 string in L(G) hving two or more distinct derivtions. me string, 2 derivtions Fmous progrmming lnguge mbiguity Dngling else <> if (<expr>) <> if (<expr>) <> else <> <some_other_> if (expr1) if (expr2) f(); else g(); Fmous progrmming lnguge mbiguity if ( expr ) else expr1 if ( expr ) g(x); To which if does the else belong? expr2 f(x); In this derivtion, the else belongs to the 1 st if Fmous progrmming lnguge mbiguity Fmous progrmming lnguge mbiguity if ( expr ) expr1 A wy to fix this <> <s1> <s2> <s1> if (<expr>) <s1> else <s1> <other> <s2> if (<expr>) <> if (<expr>) <s1> else <s2> if ( expr ) expr2 f(x); else g(x); <s1> represents if sttements with mtching else <s2> represent if sttements with t lest 1 unmtched if The <s1> in the rule for <s2> will ssure tht ll sttements between if nd else will not hve dngling else. 4
5 Fmous progrmming lnguge mbiguity s2 if ( expr ) s1 expr1 if ( expr ) s1 expr2 f(x); else s1 g(x); ome lnguges re inherently mbiguous All possible grmmrs tht generte the lnguge re mbiguous Unfortuntely, there is no lgorithm tht cn tells us whether grmmr is mbiguous or not. howing grmmr is mbiguous is esy Find string x in the L(G) tht hs two derivtions howing prticulr grmmr is not mbiguous is usully difficult. howing tht ny grmmr is not mbiguous is not possible. Derivtions Leftmost derivtions A leftmost derivtion is one where the leftmost vrible in the current string is lwys the first to get replced vi production rule. A rightmost derivtion is one where the rightmost vrible in the current string is lwys the first to get replced vi production rule. Derivtions As it turns out (we won t prove this) In unmbiguous grmmrs,leftmost derivtions will lwys be unique. In unmbiguous grmmrs,rightmost derivtions will lwys be unique. rightmost derivtion leftmost derivtion 5
6 Removing mbiguities ince some lnguges re inherently mbiguous This cnnot lwys be done However, On cse by cse bsis, mbiguities cn be eliminted Exmple Abbrevited grmmr for lgebric expressions Production rules + (1) * (2) () (3) (4) Exmple This grmmr hs two problems 1. Precedence of opertors is not respected * + should be interpreted s (*) + 2. equence of identicl opertors cn be grouped either from the left or the right + + cn be interpreted s either (+)+ or + ( + ) Exmple olution Introduce some new vribles Fctor expression tht cnnot be broken up by either * or + () Term expression tht cnnot be broken up by + All Fctors T * F Expression ll possible expression All Terms + T Exmple Our new grmmr + T T T T * F F F () Note tht ll recursion is leftmost * hs higher precedent thn * is interpreted s ((+) + ) + (*) Exmple * + T + T T * F + T F F F 6
7 Exmple It cn be shown Tht every string x, tht is generted by this new grmmr, hs only one leftmost derivtion As such this new grmmr is unmbiguous Done using induction on the x. ummry A grmmr is mbiguous if there is string generted by the grmmr tht hs two distinct derivtions. ome lnguges re inherently mbiguous All grmmrs tht generte the lnguge re mbiguous There is no lgorithm to determine if ny given grmmr is mbiguous Proving grmmr to be mbiguous is esy Proving tht grmmr is not is hrd. Questions? 7
Homework. Context Free Languages. Before We Start. Announcements. Plan for today. Languages. Any questions? Recall. 1st half. 2nd half.
Homework Context Free Languages Homework #2 returned Homework #3 due today Homework #4 Pg 133 -- Exercise 1 (use structural induction) Pg 133 -- Exercise 3 Pg 134 -- Exercise 8b,c,d Pg 135 -- Exercise
More informationCSc 453 Compilers and Systems Software. 6 : Top-Down Parsing I
C 45 Compilers n ystems oftwre 6 : op-down Prsing I Christin Collberg Deprtment of Computer iene University of rizon ollberg@gmil.om Copyright 2009 Christin Collberg eptember 14, 2009 1 Overview 2 Compiler
More informationDefinition of Regular Expression
Definition of Regulr Expression After the definition of the string nd lnguges, we re redy to descrie regulr expressions, the nottion we shll use to define the clss of lnguges known s regulr sets. Recll
More informationCSE 401 Midterm Exam 11/5/10 Sample Solution
Question 1. egulr expressions (20 points) In the Ad Progrmming lnguge n integer constnt contins one or more digits, but it my lso contin embedded underscores. Any underscores must be preceded nd followed
More informationCS 321 Programming Languages and Compilers. Bottom Up Parsing
CS 321 Progrmming nguges nd Compilers Bottom Up Prsing Bottom-up Prsing: Shift-reduce prsing Grmmr H: fi ; fi b Input: ;;b hs prse tree ; ; b 2 Dt for Shift-reduce Prser Input string: sequence of tokens
More information10/12/17. Motivating Example. Lexical and Syntax Analysis (2) Recursive-Descent Parsing. Recursive-Descent Parsing. Recursive-Descent Parsing
Motivting Exmple Lexicl nd yntx Anlysis (2) In Text: Chpter 4 Consider the grmmr -> cad A -> b Input string: w = cd How to build prse tree top-down? 2 Initilly crete tree contining single node (the strt
More informationTheory of Computation CSE 105
$ $ $ Theory of Computtion CSE 105 Regulr Lnguges Study Guide nd Homework I Homework I: Solutions to the following problems should be turned in clss on July 1, 1999. Instructions: Write your nswers clerly
More informationOperator Precedence. Java CUP. E E + T T T * P P P id id id. Does a+b*c mean (a+b)*c or
Opertor Precedence Most progrmming lnguges hve opertor precedence rules tht stte the order in which opertors re pplied (in the sence of explicit prentheses). Thus in C nd Jv nd CSX, +*c mens compute *c,
More informationECE 468/573 Midterm 1 September 28, 2012
ECE 468/573 Midterm 1 September 28, 2012 Nme:! Purdue emil:! Plese sign the following: I ffirm tht the nswers given on this test re mine nd mine lone. I did not receive help from ny person or mteril (other
More informationLING/C SC/PSYC 438/538. Lecture 21 Sandiway Fong
LING/C SC/PSYC 438/538 Lecture 21 Sndiwy Fong Tody's Topics Homework 8 Review Optionl Homework 9 (mke up on Homework 7) Homework 8 Review Question1: write Prolog regulr grmmr for the following lnguge:
More informationCMSC 331 First Midterm Exam
0 00/ 1 20/ 2 05/ 3 15/ 4 15/ 5 15/ 6 20/ 7 30/ 8 30/ 150/ 331 First Midterm Exm 7 October 2003 CMC 331 First Midterm Exm Nme: mple Answers tudent ID#: You will hve seventy-five (75) minutes to complete
More informationCompilers Spring 2013 PRACTICE Midterm Exam
Compilers Spring 2013 PRACTICE Midterm Exm This is full length prctice midterm exm. If you wnt to tke it t exm pce, give yourself 7 minutes to tke the entire test. Just like the rel exm, ech question hs
More informationCMPSC 470: Compiler Construction
CMPSC 47: Compiler Construction Plese complete the following: Midterm (Type A) Nme Instruction: Mke sure you hve ll pges including this cover nd lnk pge t the end. Answer ech question in the spce provided.
More informationDr. D.M. Akbar Hussain
Dr. D.M. Akr Hussin Lexicl Anlysis. Bsic Ide: Red the source code nd generte tokens, it is similr wht humns will do to red in; just tking on the input nd reking it down in pieces. Ech token is sequence
More informationProblem Set 2 Fall 16 Due: Wednesday, September 21th, in class, before class begins.
Problem Set 2 Fll 16 Due: Wednesdy, September 21th, in clss, before clss begins. 1. LL Prsing For the following sub-problems, consider the following context-free grmmr: S T$ (1) T A (2) T bbb (3) A T (4)
More informationAssignment 4. Due 09/18/17
Assignment 4. ue 09/18/17 1. ). Write regulr expressions tht define the strings recognized by the following finite utomt: b d b b b c c b) Write FA tht recognizes the tokens defined by the following regulr
More informationFig.25: the Role of LEX
The Lnguge for Specifying Lexicl Anlyzer We shll now study how to uild lexicl nlyzer from specifiction of tokens in the form of list of regulr expressions The discussion centers round the design of n existing
More informationCSCE 531, Spring 2017, Midterm Exam Answer Key
CCE 531, pring 2017, Midterm Exm Answer Key 1. (15 points) Using the method descried in the ook or in clss, convert the following regulr expression into n equivlent (nondeterministic) finite utomton: (
More informationacronyms possibly used in this test: CFG :acontext free grammar CFSM :acharacteristic finite state machine DFA :adeterministic finite automata
EE573 Fll 2002, Exm open book, if question seems mbiguous, sk me to clrify the question. If my nswer doesn t stisfy you, plese stte your ssumptions. cronyms possibly used in this test: CFG :context free
More informationthis grammar generates the following language: Because this symbol will also be used in a later step, it receives the
LR() nlysis Drwcks of LR(). Look-hed symols s eplined efore, concerning LR(), it is possile to consult the net set to determine, in the reduction sttes, for which symols it would e possile to perform reductions.
More informationASTs, Regex, Parsing, and Pretty Printing
ASTs, Regex, Prsing, nd Pretty Printing CS 2112 Fll 2016 1 Algeric Expressions To strt, consider integer rithmetic. Suppose we hve the following 1. The lphet we will use is the digits {0, 1, 2, 3, 4, 5,
More informationIn the last lecture, we discussed how valid tokens may be specified by regular expressions.
LECTURE 5 Scnning SYNTAX ANALYSIS We know from our previous lectures tht the process of verifying the syntx of the progrm is performed in two stges: Scnning: Identifying nd verifying tokens in progrm.
More informationContext-Free Grammars
Context-Free Grmmrs Descriing Lnguges We've seen two models for the regulr lnguges: Finite utomt ccept precisely the strings in the lnguge. Regulr expressions descrie precisely the strings in the lnguge.
More informationSolving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence Winter 2016
Solving Prolems y Serching CS 486/686: Introduction to Artificil Intelligence Winter 2016 1 Introduction Serch ws one of the first topics studied in AI - Newell nd Simon (1961) Generl Prolem Solver Centrl
More informationContext-Free Grammars
Context-Free Grmmrs Descriing Lnguges We've seen two models for the regulr lnguges: Finite utomt ccept precisely the strings in the lnguge. Regulr expressions descrie precisely the strings in the lnguge.
More informationCS 340, Fall 2014 Dec 11 th /13 th Final Exam Note: in all questions, the special symbol ɛ (epsilon) is used to indicate the empty string.
CS 340, Fll 2014 Dec 11 th /13 th Finl Exm Nme: Note: in ll questions, the specil symol ɛ (epsilon) is used to indicte the empty string. Question 1. [5 points] Consider the following regulr expression;
More informationCSCI 3130: Formal Languages and Automata Theory Lecture 12 The Chinese University of Hong Kong, Fall 2011
CSCI 3130: Forml Lnguges nd utomt Theory Lecture 12 The Chinese University of Hong Kong, Fll 2011 ndrej Bogdnov In progrmming lnguges, uilding prse trees is significnt tsk ecuse prse trees tell us the
More informationCS 236 Language and Computation. Alphabet. Definition. I.2.1. Formal Languages (10.1)
C 236 Lnguge nd Computtion Course Notes Prt I: Grmmrs for Defining yntx (II) Chpter I.2: yntx nd Grmmrs (10, 12.1) Anton etzer (Bsed on ook drft y J. V. Tucker nd K. tephenson) Dept. of Computer cience,
More informationSome Thoughts on Grad School. Undergraduate Compilers Review and Intro to MJC. Structure of a Typical Compiler. Lexing and Parsing
Undergrdute Compilers Review nd Intro to MJC Announcements Miling list is in full swing Tody Some thoughts on grd school Finish prsing Semntic nlysis Visitor pttern for bstrct syntx trees Some Thoughts
More informationSample Midterm Solutions COMS W4115 Programming Languages and Translators Monday, October 12, 2009
Deprtment of Computer cience Columbi University mple Midterm olutions COM W4115 Progrmming Lnguges nd Trnsltors Mondy, October 12, 2009 Closed book, no ids. ch question is worth 20 points. Question 5(c)
More informationLanguages. L((a (b)(c))*) = { ε,a,bc,aa,abc,bca,... } εw = wε = w. εabba = abbaε = abba. (a (b)(c)) *
Pln for Tody nd Beginning Next week Interpreter nd Compiler Structure, or Softwre Architecture Overview of Progrmming Assignments The MeggyJv compiler we will e uilding. Regulr Expressions Finite Stte
More informationLecture T4: Pattern Matching
Introduction to Theoreticl CS Lecture T4: Pttern Mtching Two fundmentl questions. Wht cn computer do? How fst cn it do it? Generl pproch. Don t tlk bout specific mchines or problems. Consider miniml bstrct
More informationCS 430 Spring Mike Lam, Professor. Parsing
CS 430 Spring 2015 Mike Lm, Professor Prsing Syntx Anlysis We cn now formlly descrie lnguge's syntx Using regulr expressions nd BNF grmmrs How does tht help us? Syntx Anlysis We cn now formlly descrie
More informationIf you are at the university, either physically or via the VPN, you can download the chapters of this book as PDFs.
Lecture 5 Wlks, Trils, Pths nd Connectedness Reding: Some of the mteril in this lecture comes from Section 1.2 of Dieter Jungnickel (2008), Grphs, Networks nd Algorithms, 3rd edition, which is ville online
More informationMidterm I Solutions CS164, Spring 2006
Midterm I Solutions CS164, Spring 2006 Februry 23, 2006 Plese red ll instructions (including these) crefully. Write your nme, login, SID, nd circle the section time. There re 8 pges in this exm nd 4 questions,
More informationMATH 25 CLASS 5 NOTES, SEP
MATH 25 CLASS 5 NOTES, SEP 30 2011 Contents 1. A brief diversion: reltively prime numbers 1 2. Lest common multiples 3 3. Finding ll solutions to x + by = c 4 Quick links to definitions/theorems Euclid
More informationCS321 Languages and Compiler Design I. Winter 2012 Lecture 5
CS321 Lnguges nd Compiler Design I Winter 2012 Lecture 5 1 FINITE AUTOMATA A non-deterministic finite utomton (NFA) consists of: An input lphet Σ, e.g. Σ =,. A set of sttes S, e.g. S = {1, 3, 5, 7, 11,
More informationΕΠΛ323 - Θεωρία και Πρακτική Μεταγλωττιστών
ΕΠΛ323 - Θωρία και Πρακτική Μταγλωττιστών Lecture 3 Lexicl Anlysis Elis Athnsopoulos elisthn@cs.ucy.c.cy Recognition of Tokens if expressions nd reltionl opertors if è if then è then else è else relop
More informationDeterministic. Finite Automata. And Regular Languages. Fall 2018 Costas Busch - RPI 1
Deterministic Finite Automt And Regulr Lnguges Fll 2018 Costs Busch - RPI 1 Deterministic Finite Automton (DFA) Input Tpe String Finite Automton Output Accept or Reject Fll 2018 Costs Busch - RPI 2 Trnsition
More informationFinite Automata. Lecture 4 Sections Robb T. Koether. Hampden-Sydney College. Wed, Jan 21, 2015
Finite Automt Lecture 4 Sections 3.6-3.7 Ro T. Koether Hmpden-Sydney College Wed, Jn 21, 2015 Ro T. Koether (Hmpden-Sydney College) Finite Automt Wed, Jn 21, 2015 1 / 23 1 Nondeterministic Finite Automt
More informationMA1008. Calculus and Linear Algebra for Engineers. Course Notes for Section B. Stephen Wills. Department of Mathematics. University College Cork
MA1008 Clculus nd Liner Algebr for Engineers Course Notes for Section B Stephen Wills Deprtment of Mthemtics University College Cork s.wills@ucc.ie http://euclid.ucc.ie/pges/stff/wills/teching/m1008/ma1008.html
More informationCS311H: Discrete Mathematics. Graph Theory IV. A Non-planar Graph. Regions of a Planar Graph. Euler s Formula. Instructor: Işıl Dillig
CS311H: Discrete Mthemtics Grph Theory IV Instructor: Işıl Dillig Instructor: Işıl Dillig, CS311H: Discrete Mthemtics Grph Theory IV 1/25 A Non-plnr Grph Regions of Plnr Grph The plnr representtion of
More information2014 Haskell January Test Regular Expressions and Finite Automata
0 Hskell Jnury Test Regulr Expressions nd Finite Automt This test comprises four prts nd the mximum mrk is 5. Prts I, II nd III re worth 3 of the 5 mrks vilble. The 0 Hskell Progrmming Prize will be wrded
More informationLexical Analysis: Constructing a Scanner from Regular Expressions
Lexicl Anlysis: Constructing Scnner from Regulr Expressions Gol Show how to construct FA to recognize ny RE This Lecture Convert RE to n nondeterministic finite utomton (NFA) Use Thompson s construction
More informationJava CUP. Java CUP Specifications. User Code Additions. Package and Import Specifications
Jv CUP Jv CUP is prser-genertion tool, similr to Ycc. CUP uilds Jv prser for LALR(1) grmmrs from production rules nd ssocited Jv code frgments. When prticulr production is recognized, its ssocited code
More informationCS143 Handout 07 Summer 2011 June 24 th, 2011 Written Set 1: Lexical Analysis
CS143 Hndout 07 Summer 2011 June 24 th, 2011 Written Set 1: Lexicl Anlysis In this first written ssignment, you'll get the chnce to ply round with the vrious constructions tht come up when doing lexicl
More informationRegular Expression Matching with Multi-Strings and Intervals. Philip Bille Mikkel Thorup
Regulr Expression Mtching with Multi-Strings nd Intervls Philip Bille Mikkel Thorup Outline Definition Applictions Previous work Two new problems: Multi-strings nd chrcter clss intervls Algorithms Thompson
More informationScanner Termination. Multi Character Lookahead. to its physical end. Most parsers require an end of file token. Lex and Jlex automatically create an
Scnner Termintion A scnner reds input chrcters nd prtitions them into tokens. Wht hppens when the end of the input file is reched? It my be useful to crete n Eof pseudo-chrcter when this occurs. In Jv,
More informationEliminating left recursion grammar transformation. The transformed expression grammar
Eliminting left recursion grmmr trnsformtion Originl! rnsformed! 0 0! 0 α β α α α α α α α α β he two grmmrs generte the sme lnguge, but the one on the right genertes the rst, nd then string of s, using
More informationTO REGULAR EXPRESSIONS
Suject :- Computer Science Course Nme :- Theory Of Computtion DA TO REGULAR EXPRESSIONS Report Sumitted y:- Ajy Singh Meen 07000505 jysmeen@cse.iit.c.in BASIC DEINITIONS DA:- A finite stte mchine where
More informationImproper Integrals. October 4, 2017
Improper Integrls October 4, 7 Introduction We hve seen how to clculte definite integrl when the it is rel number. However, there re times when we re interested to compute the integrl sy for emple 3. Here
More informationContext-Free Grammars
Context-Free Grmmrs Describing Lnguges We've seen two models for the regulr lnguges: Finite utomt ccept precisely the strings in the lnguge. Regulr expressions describe precisely the strings in the lnguge.
More informationLexical analysis, scanners. Construction of a scanner
Lexicl nlysis scnners (NB. Pges 4-5 re for those who need to refresh their knowledge of DFAs nd NFAs. These re not presented during the lectures) Construction of scnner Tools: stte utomt nd trnsition digrms.
More informationUnit 5 Vocabulary. A function is a special relationship where each input has a single output.
MODULE 3 Terms Definition Picture/Exmple/Nottion 1 Function Nottion Function nottion is n efficient nd effective wy to write functions of ll types. This nottion llows you to identify the input vlue with
More informationQuiz2 45mins. Personal Number: Problem 1. (20pts) Here is an Table of Perl Regular Ex
Long Quiz2 45mins Nme: Personl Numer: Prolem. (20pts) Here is n Tle of Perl Regulr Ex Chrcter Description. single chrcter \s whitespce chrcter (spce, t, newline) \S non-whitespce chrcter \d digit (0-9)
More informationΕΠΛ323 - Θεωρία και Πρακτική Μεταγλωττιστών. Lecture 3b Lexical Analysis Elias Athanasopoulos
ΕΠΛ323 - Θωρία και Πρακτική Μταγλωττιστών Lecture 3 Lexicl Anlysis Elis Athnsopoulos elisthn@cs.ucy.c.cy RecogniNon of Tokens if expressions nd relnonl opertors if è if then è then else è else relop è
More informationSolving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence
Solving Prolems y Serching CS 486/686: Introduction to Artificil Intelligence 1 Introduction Serch ws one of the first topics studied in AI - Newell nd Simon (1961) Generl Prolem Solver Centrl component
More informationCS 340, Fall 2016 Sep 29th Exam 1 Note: in all questions, the special symbol ɛ (epsilon) is used to indicate the empty string.
CS 340, Fll 2016 Sep 29th Exm 1 Nme: Note: in ll questions, the speil symol ɛ (epsilon) is used to indite the empty string. Question 1. [10 points] Speify regulr expression tht genertes the lnguge over
More informationSection 3.1: Sequences and Series
Section.: Sequences d Series Sequences Let s strt out with the definition of sequence: sequence: ordered list of numbers, often with definite pttern Recll tht in set, order doesn t mtter so this is one
More informationLR Parsing, Part 2. Constructing Parse Tables. Need to Automatically Construct LR Parse Tables: Action and GOTO Table
TDDD55 Compilers nd Interpreters TDDB44 Compiler Construction LR Prsing, Prt 2 Constructing Prse Tles Prse tle construction Grmmr conflict hndling Ctegories of LR Grmmrs nd Prsers Peter Fritzson, Christoph
More informationbinary trees, expression trees
COMP 250 Lecture 21 binry trees, expression trees Oct. 27, 2017 1 Binry tree: ech node hs t most two children. 2 Mximum number of nodes in binry tree? Height h (e.g. 3) 3 Mximum number of nodes in binry
More information10.5 Graphing Quadratic Functions
0.5 Grphing Qudrtic Functions Now tht we cn solve qudrtic equtions, we wnt to lern how to grph the function ssocited with the qudrtic eqution. We cll this the qudrtic function. Grphs of Qudrtic Functions
More informationCS201 Discussion 10 DRAWTREE + TRIES
CS201 Discussion 10 DRAWTREE + TRIES DrwTree First instinct: recursion As very generic structure, we could tckle this problem s follows: drw(): Find the root drw(root) drw(root): Write the line for the
More informationMath 464 Fall 2012 Notes on Marginal and Conditional Densities October 18, 2012
Mth 464 Fll 2012 Notes on Mrginl nd Conditionl Densities klin@mth.rizon.edu October 18, 2012 Mrginl densities. Suppose you hve 3 continuous rndom vribles X, Y, nd Z, with joint density f(x,y,z. The mrginl
More informationCS 432 Fall Mike Lam, Professor a (bc)* Regular Expressions and Finite Automata
CS 432 Fll 2017 Mike Lm, Professor (c)* Regulr Expressions nd Finite Automt Compiltion Current focus "Bck end" Source code Tokens Syntx tree Mchine code chr dt[20]; int min() { flot x = 42.0; return 7;
More informationExample: 2:1 Multiplexer
Exmple: 2:1 Multiplexer Exmple #1 reg ; lwys @( or or s) egin if (s == 1') egin = ; else egin = ; 1 s B. Bs 114 Exmple: 2:1 Multiplexer Exmple #2 Normlly lwys include egin nd sttements even though they
More informationUnit #9 : Definite Integral Properties, Fundamental Theorem of Calculus
Unit #9 : Definite Integrl Properties, Fundmentl Theorem of Clculus Gols: Identify properties of definite integrls Define odd nd even functions, nd reltionship to integrl vlues Introduce the Fundmentl
More informationCS412/413. Introduction to Compilers Tim Teitelbaum. Lecture 4: Lexical Analyzers 28 Jan 08
CS412/413 Introduction to Compilers Tim Teitelum Lecture 4: Lexicl Anlyzers 28 Jn 08 Outline DFA stte minimiztion Lexicl nlyzers Automting lexicl nlysis Jlex lexicl nlyzer genertor CS 412/413 Spring 2008
More informationCOMP 423 lecture 11 Jan. 28, 2008
COMP 423 lecture 11 Jn. 28, 2008 Up to now, we hve looked t how some symols in n lphet occur more frequently thn others nd how we cn sve its y using code such tht the codewords for more frequently occuring
More informationUNIVERSITY OF EDINBURGH COLLEGE OF SCIENCE AND ENGINEERING SCHOOL OF INFORMATICS INFORMATICS 1 COMPUTATION & LOGIC INSTRUCTIONS TO CANDIDATES
UNIVERSITY OF EDINBURGH COLLEGE OF SCIENCE AND ENGINEERING SCHOOL OF INFORMATICS INFORMATICS COMPUTATION & LOGIC Sturdy st April 7 : to : INSTRUCTIONS TO CANDIDATES This is tke-home exercise. It will not
More information9 Graph Cutting Procedures
9 Grph Cutting Procedures Lst clss we begn looking t how to embed rbitrry metrics into distributions of trees, nd proved the following theorem due to Brtl (1996): Theorem 9.1 (Brtl (1996)) Given metric
More informationUNIT 11. Query Optimization
UNIT Query Optimiztion Contents Introduction to Query Optimiztion 2 The Optimiztion Process: An Overview 3 Optimiztion in System R 4 Optimiztion in INGRES 5 Implementing the Join Opertors Wei-Png Yng,
More informationDigital Design. Chapter 6: Optimizations and Tradeoffs
Digitl Design Chpter 6: Optimiztions nd Trdeoffs Slides to ccompny the tetbook Digitl Design, with RTL Design, VHDL, nd Verilog, 2nd Edition, by Frnk Vhid, John Wiley nd Sons Publishers, 2. http://www.ddvhid.com
More informationa(e, x) = x. Diagrammatically, this is encoded as the following commutative diagrams / X
4. Mon, Sept. 30 Lst time, we defined the quotient topology coming from continuous surjection q : X! Y. Recll tht q is quotient mp (nd Y hs the quotient topology) if V Y is open precisely when q (V ) X
More information12 <= rm <digit> 2 <= rm <no> 2 <= rm <no> <digit> <= rm <no> <= rm <number>
DDD16 Compilers nd Interpreters DDB44 Compiler Construction R Prsing Prt 1 R prsing concept Using prser genertor Prse ree Genertion Wht is R-prsing? eft-to-right scnning R Rigthmost derivtion in reverse
More informationCreating Flexible Interfaces. Friday, 24 April 2015
Creting Flexible Interfces 1 Requests, not Objects Domin objects re esy to find but they re not t the design center of your ppliction. Insted, they re trp for the unwry. Sequence digrms re vehicle for
More informationSection 10.4 Hyperbolas
66 Section 10.4 Hyperbols Objective : Definition of hyperbol & hyperbols centered t (0, 0). The third type of conic we will study is the hyperbol. It is defined in the sme mnner tht we defined the prbol
More informationTree Structured Symmetrical Systems of Linear Equations and their Graphical Solution
Proceedings of the World Congress on Engineering nd Computer Science 4 Vol I WCECS 4, -4 October, 4, Sn Frncisco, USA Tree Structured Symmetricl Systems of Liner Equtions nd their Grphicl Solution Jime
More informationCSc 453. Compilers and Systems Software. 4 : Lexical Analysis II. Department of Computer Science University of Arizona
CSc 453 Compilers nd Systems Softwre 4 : Lexicl Anlysis II Deprtment of Computer Science University of Arizon collerg@gmil.com Copyright c 2009 Christin Collerg Implementing Automt NFAs nd DFAs cn e hrd-coded
More informationMidterm 2 Sample solution
Nme: Instructions Midterm 2 Smple solution CMSC 430 Introduction to Compilers Fll 2012 November 28, 2012 This exm contins 9 pges, including this one. Mke sure you hve ll the pges. Write your nme on the
More information4452 Mathematical Modeling Lecture 4: Lagrange Multipliers
Mth Modeling Lecture 4: Lgrnge Multipliers Pge 4452 Mthemticl Modeling Lecture 4: Lgrnge Multipliers Lgrnge multipliers re high powered mthemticl technique to find the mximum nd minimum of multidimensionl
More informationTries. Yufei Tao KAIST. April 9, Y. Tao, April 9, 2013 Tries
Tries Yufei To KAIST April 9, 2013 Y. To, April 9, 2013 Tries In this lecture, we will discuss the following exct mtching prolem on strings. Prolem Let S e set of strings, ech of which hs unique integer
More informationMath 142, Exam 1 Information.
Mth 14, Exm 1 Informtion. 9/14/10, LC 41, 9:30-10:45. Exm 1 will be bsed on: Sections 7.1-7.5. The corresponding ssigned homework problems (see http://www.mth.sc.edu/ boyln/sccourses/14f10/14.html) At
More informationBefore We Begin. Introduction to Spatial Domain Filtering. Introduction to Digital Image Processing. Overview (1): Administrative Details (1):
Overview (): Before We Begin Administrtive detils Review some questions to consider Winter 2006 Imge Enhncement in the Sptil Domin: Bsics of Sptil Filtering, Smoothing Sptil Filters, Order Sttistics Filters
More informationThe Fundamental Theorem of Calculus
MATH 6 The Fundmentl Theorem of Clculus The Fundmentl Theorem of Clculus (FTC) gives method of finding the signed re etween the grph of f nd the x-xis on the intervl [, ]. The theorem is: FTC: If f is
More informationPointwise convergence need not behave well with respect to standard properties such as continuity.
Chpter 3 Uniform Convergence Lecture 9 Sequences of functions re of gret importnce in mny res of pure nd pplied mthemtics, nd their properties cn often be studied in the context of metric spces, s in Exmples
More informationsuch that the S i cover S, or equivalently S
MATH 55 Triple Integrls Fll 16 1. Definition Given solid in spce, prtition of consists of finite set of solis = { 1,, n } such tht the i cover, or equivlently n i. Furthermore, for ech i, intersects i
More informationCOMBINATORIAL PATTERN MATCHING
COMBINATORIAL PATTERN MATCHING Genomic Repets Exmple of repets: ATGGTCTAGGTCCTAGTGGTC Motivtion to find them: Genomic rerrngements re often ssocited with repets Trce evolutionry secrets Mny tumors re chrcterized
More informationMa/CS 6b Class 1: Graph Recap
M/CS 6 Clss 1: Grph Recp By Adm Sheffer Course Detils Adm Sheffer. Office hour: Tuesdys 4pm. dmsh@cltech.edu TA: Victor Kstkin. Office hour: Tuesdys 7pm. 1:00 Mondy, Wednesdy, nd Fridy. http://www.mth.cltech.edu/~2014-15/2term/m006/
More informationHomework. Announcements. Before We Start. Languages. Plan for today. Chomsky Normal Form. Final Exam Dates have been announced
Homework Homework #3 returned Homework #4 due today Homework #5 Pg 169 -- Exercise 4 Pg 183 -- Exercise 4c,e,i Pg 184 -- Exercise 10 Pg 184 -- Exercise 12 Pg 185 -- Exercise 17 Due 10 / 17 Announcements
More informationFrom Dependencies to Evaluation Strategies
From Dependencies to Evlution Strtegies Possile strtegies: 1 let the user define the evlution order 2 utomtic strtegy sed on the dependencies: use locl dependencies to determine which ttriutes to compute
More informationContext-Free Languages and Parse Trees
Context-Free Languages and Parse Trees Mridul Aanjaneya Stanford University July 12, 2012 Mridul Aanjaneya Automata Theory 1/ 41 Context-Free Grammars A context-free grammar is a notation for describing
More informationImplementing Automata. CSc 453. Compilers and Systems Software. 4 : Lexical Analysis II. Department of Computer Science University of Arizona
Implementing utomt Sc 5 ompilers nd Systems Softwre : Lexicl nlysis II Deprtment of omputer Science University of rizon collerg@gmil.com opyright c 009 hristin ollerg NFs nd DFs cn e hrd-coded using this
More informationAmbiguous Grammars and Compactification
Ambiguous Grammars and Compactification Mridul Aanjaneya Stanford University July 17, 2012 Mridul Aanjaneya Automata Theory 1/ 44 Midterm Review Mathematical Induction and Pigeonhole Principle Finite Automata
More informationWhat are suffix trees?
Suffix Trees 1 Wht re suffix trees? Allow lgorithm designers to store very lrge mount of informtion out strings while still keeping within liner spce Allow users to serch for new strings in the originl
More informationReducing Costs with Duck Typing. Structural
Reducing Costs with Duck Typing Structurl 1 Duck Typing In computer progrmming with object-oriented progrmming lnguges, duck typing is lyer of progrmming lnguge nd design rules on top of typing. Typing
More informationLecture 10 Evolutionary Computation: Evolution strategies and genetic programming
Lecture 10 Evolutionry Computtion: Evolution strtegies nd genetic progrmming Evolution strtegies Genetic progrmming Summry Negnevitsky, Person Eduction, 2011 1 Evolution Strtegies Another pproch to simulting
More informationTopic 2: Lexing and Flexing
Topic 2: Lexing nd Flexing COS 320 Compiling Techniques Princeton University Spring 2016 Lennrt Beringer 1 2 The Compiler Lexicl Anlysis Gol: rek strem of ASCII chrcters (source/input) into sequence of
More informationSIMPLIFYING ALGEBRA PASSPORT.
SIMPLIFYING ALGEBRA PASSPORT www.mthletics.com.u This booklet is ll bout turning complex problems into something simple. You will be ble to do something like this! ( 9- # + 4 ' ) ' ( 9- + 7-) ' ' Give
More informationSuffix Tries. Slides adapted from the course by Ben Langmead
Suffix Tries Slides dpted from the course y Ben Lngmed en.lngmed@gmil.com Indexing with suffixes Until now, our indexes hve een sed on extrcting sustrings from T A very different pproch is to extrct suffixes
More information