Deterministic. Finite Automata. And Regular Languages. Fall 2018 Costas Busch - RPI 1

Size: px
Start display at page:

Download "Deterministic. Finite Automata. And Regular Languages. Fall 2018 Costas Busch - RPI 1"

Transcription

1 Deterministic Finite Automt And Regulr Lnguges Fll 2018 Costs Busch - RPI 1

2 Deterministic Finite Automton (DFA) Input Tpe String Finite Automton Output Accept or Reject Fll 2018 Costs Busch - RPI 2

3 Trnsition Grph q3 q4 initil stte stte trnsition ccepting stte Fll 2018 Costs Busch - RPI 3

4 Alphet {, } q3 q4 For every stte, there is trnsition for every symol in the lphet Fll 2018 Costs Busch - RPI 4

5 hed Initil Configurtion Input Tpe Input String q 0 q3 q4 Initil stte Fll 2018 Costs Busch - RPI 5

6 Scnning the Input q3 q4 Fll 2018 Costs Busch - RPI 6

7 q3 q4 Fll 2018 Costs Busch - RPI 7

8 q3 q4 Fll 2018 Costs Busch - RPI 8

9 Input finished q3 q4 ccept Fll 2018 Costs Busch - RPI 9

10 A Rejection Cse Input String q 0 q3 q4 Fll 2018 Costs Busch - RPI 10

11 q3 q4 Fll 2018 Costs Busch - RPI 11

12 q3 q4 Fll 2018 Costs Busch - RPI 12

13 Input finished q3 q4 reject Fll 2018 Costs Busch - RPI 13

14 Another Rejection Cse Tpe is empty () Input Finished q 0 q3 q4 reject Fll 2018 Costs Busch - RPI 14

15 Lnguge Accepted: L q3 q4 Fll 2018 Costs Busch - RPI 15

16 To ccept string: ll the input string is scnned nd the lst stte is ccepting To reject string: ll the input string is scnned nd the lst stte is non-ccepting Fll 2018 Costs Busch - RPI 16

17 Another Exmple L,, q3 q4 Fll 2018 Costs Busch - RPI 17 Accept Accept Accept stte stte stte

18 Empty Tpe () Input Finished q3 q4 ccept Fll 2018 Costs Busch - RPI 18

19 Another Exmple, Accept stte trp stte Fll 2018 Costs Busch - RPI 19

20 Input String, Fll 2018 Costs Busch - RPI 20

21 , Fll 2018 Costs Busch - RPI 21

22 , Fll 2018 Costs Busch - RPI 22

23 Input finished ccept, Fll 2018 Costs Busch - RPI 23

24 A rejection cse Input String, Fll 2018 Costs Busch - RPI 24

25 , Fll 2018 Costs Busch - RPI 25

26 , Fll 2018 Costs Busch - RPI 26

27 Input finished, reject Fll 2018 Costs Busch - RPI 27

28 Lnguge Accepted: L { : n 0} n, Fll 2018 Costs Busch - RPI 28

29 Another Exmple Alphet: {1} Lnguge Accepted: 1 1 EVEN { x : x * nd x is even} {, 11, 1111, , } Fll 2018 Costs Busch - RPI 29

30 Forml Definition Deterministic Finite Automton (DFA) M Q,,,, F Q : set of sttes : input lphet q 0 F : trnsition function : initil stte : set of ccepting sttes Fll 2018 Costs Busch - RPI 30

31 Set of Sttes Q Exmple Q q 0 1, 2, 3, 4,, q q q q q 5 q3 q4 Fll 2018 Costs Busch - RPI 31

32 Input Alphet :the input lphet never contins Exmple q3 q4 Fll 2018 Costs Busch - RPI 32

33 Initil Stte q 0 Exmple q 0 q3 q4 Fll 2018 Costs Busch - RPI 33

34 Set of Accepting Sttes F Q Exmple F q 4 q3 q 4 Fll 2018 Costs Busch - RPI 34

35 Trnsition Function : Q Q ( q, x ) q q x q Descries the result of trnsition from stte q with symol x Fll 2018 Costs Busch - RPI 35

36 Exmple:, q 1 q3 q4 Fll 2018 Costs Busch - RPI 36

37 , q5 q 0 q3 q4 Fll 2018 Costs Busch - RPI 37

38 3 2, q q q3 q4 Fll 2018 Costs Busch - RPI 38

39 Trnsition Tle for sttes q q 0 q 1 q 2 q 3 symols 5 q5 q q5 3 q q4 5 q 4 q3 q4 Fll 2018 Costs Busch - RPI 39

40 Extended Trnsition Function * : Q * Q * ( q, w ) q Descries the resulting stte fter scnning string w from stte q Fll 2018 Costs Busch - RPI 40

41 Exmple: * q, q 0 2 q 2 q3 q4 Fll 2018 Costs Busch - RPI 41

42 * q, q 0 5 q 0 q3 q4 Fll 2018 Costs Busch - RPI 42

43 * q, q 1 4 q3 q4 Fll 2018 Costs Busch - RPI 43

44 Specil cse: for ny stte q * q, q Fll 2018 Costs Busch - RPI 44

45 In generl: * q, w q implies tht there is wlk of trnsitions w 1 2 k q 1 2 k q sttes my e repeted q w q Fll 2018 Costs Busch - RPI 45

46 Lnguge Accepted y DFA Lnguge of DFA : M it is denoted s L ll the strings ccepted y M nd contins M We sy tht lnguge is ccepted (or recognized) y DFA M if L LM L Fll 2018 Costs Busch - RPI 46

47 For DFA M Q,,, q, 0 F M Lnguge ccepted y : L M w * * q, w : 0 F w q q F Fll 2018 Costs Busch - RPI 47

48 M Lnguge rejected y : L M w * * q, w : 0 F w q q F Fll 2018 Costs Busch - RPI 48

49 More DFA Exmples {, } q 0 q 0 L( M) { } Empty lnguge L( M) All strings * Fll 2018 Costs Busch - RPI 49

50 {, }, q 0 L( M) { } Lnguge of the empty string Fll 2018 Costs Busch - RPI 50

51 {, } L M = { ll strings with prefix } Communiction strings Preceding 01 or suffix 110 ccept q 3 Fll 2018 Costs Busch - RPI 51

52 L M = Wht is the lnguge??? { } , Fll 2018 Costs Busch - RPI 52

53 L M = { ll inry strings contining sustring 001} security codes 1 0 0, Fll 2018 Costs Busch - RPI 53

54 L M = Wht is the lnguge {??} ,1 Fll 2018 Costs Busch - RPI 54

55 L M = { ll inry strings without sustring 001 } ,1 Fll 2018 Costs Busch - RPI 55

56 L (M) = {??} q3 q 4 Fll 2018 Costs Busch - RPI 56

57 L( M) w : w, * q3 q 4 Fll 2018 Costs Busch - RPI 57

58 Definition: A lnguge M L Regulr Lnguges is regulr if there is DFA tht ccepts it ( L( M) L ) The lnguges ccepted y ll DFAs form the fmily of regulr lnguges Fll 2018 Costs Busch - RPI 58

59 Exmple regulr lnguges:,, { n : n 0} { ll strings in {}* with prefix } { ll inry strings without sustring 001} { x : x { } {} {1} * nd {, There exist utomt tht ccept these lnguges (see previous slides). x * } w Fll 2018 Costs Busch - RPI 59 : w, is even} *

60 There exist lnguges which re not Regulr: L n n { : n 0} ADDITION { x y z : x 1 n, y 1 m,z 1 k, n m k } There is no DFA tht ccepts these lnguges (we will prove this in lter clss) Fll 2018 Costs Busch - RPI 60

61 Exmple Build nd utomt which ccepts the regulr lnguge L = { 2 2 W, W ε {} * } Fll 2018 Costs Busch - RPI 61

Finite Automata. Lecture 4 Sections Robb T. Koether. Hampden-Sydney College. Wed, Jan 21, 2015

Finite Automata. Lecture 4 Sections Robb T. Koether. Hampden-Sydney College. Wed, Jan 21, 2015 Finite Automt Lecture 4 Sections 3.6-3.7 Ro T. Koether Hmpden-Sydney College Wed, Jn 21, 2015 Ro T. Koether (Hmpden-Sydney College) Finite Automt Wed, Jn 21, 2015 1 / 23 1 Nondeterministic Finite Automt

More information

Definition of Regular Expression

Definition of Regular Expression Definition of Regulr Expression After the definition of the string nd lnguges, we re redy to descrie regulr expressions, the nottion we shll use to define the clss of lnguges known s regulr sets. Recll

More information

CS 432 Fall Mike Lam, Professor a (bc)* Regular Expressions and Finite Automata

CS 432 Fall Mike Lam, Professor a (bc)* Regular Expressions and Finite Automata CS 432 Fll 2017 Mike Lm, Professor (c)* Regulr Expressions nd Finite Automt Compiltion Current focus "Bck end" Source code Tokens Syntx tree Mchine code chr dt[20]; int min() { flot x = 42.0; return 7;

More information

Lexical analysis, scanners. Construction of a scanner

Lexical analysis, scanners. Construction of a scanner Lexicl nlysis scnners (NB. Pges 4-5 re for those who need to refresh their knowledge of DFAs nd NFAs. These re not presented during the lectures) Construction of scnner Tools: stte utomt nd trnsition digrms.

More information

Languages. L((a (b)(c))*) = { ε,a,bc,aa,abc,bca,... } εw = wε = w. εabba = abbaε = abba. (a (b)(c)) *

Languages. L((a (b)(c))*) = { ε,a,bc,aa,abc,bca,... } εw = wε = w. εabba = abbaε = abba. (a (b)(c)) * Pln for Tody nd Beginning Next week Interpreter nd Compiler Structure, or Softwre Architecture Overview of Progrmming Assignments The MeggyJv compiler we will e uilding. Regulr Expressions Finite Stte

More information

Should be done. Do Soon. Structure of a Typical Compiler. Plan for Today. Lab hours and Office hours. Quiz 1 is due tonight, was posted Tuesday night

Should be done. Do Soon. Structure of a Typical Compiler. Plan for Today. Lab hours and Office hours. Quiz 1 is due tonight, was posted Tuesday night Should e done L hours nd Office hours Sign up for the miling list t, strting to send importnt info to list http://groups.google.com/group/cs453-spring-2011 Red Ch 1 nd skim Ch 2 through 2.6, red 3.3 nd

More information

Lexical Analysis: Constructing a Scanner from Regular Expressions

Lexical Analysis: Constructing a Scanner from Regular Expressions Lexicl Anlysis: Constructing Scnner from Regulr Expressions Gol Show how to construct FA to recognize ny RE This Lecture Convert RE to n nondeterministic finite utomton (NFA) Use Thompson s construction

More information

ΕΠΛ323 - Θεωρία και Πρακτική Μεταγλωττιστών

ΕΠΛ323 - Θεωρία και Πρακτική Μεταγλωττιστών ΕΠΛ323 - Θωρία και Πρακτική Μταγλωττιστών Lecture 3 Lexicl Anlysis Elis Athnsopoulos elisthn@cs.ucy.c.cy Recognition of Tokens if expressions nd reltionl opertors if è if then è then else è else relop

More information

Fig.25: the Role of LEX

Fig.25: the Role of LEX The Lnguge for Specifying Lexicl Anlyzer We shll now study how to uild lexicl nlyzer from specifiction of tokens in the form of list of regulr expressions The discussion centers round the design of n existing

More information

In the last lecture, we discussed how valid tokens may be specified by regular expressions.

In the last lecture, we discussed how valid tokens may be specified by regular expressions. LECTURE 5 Scnning SYNTAX ANALYSIS We know from our previous lectures tht the process of verifying the syntx of the progrm is performed in two stges: Scnning: Identifying nd verifying tokens in progrm.

More information

Assignment 4. Due 09/18/17

Assignment 4. Due 09/18/17 Assignment 4. ue 09/18/17 1. ). Write regulr expressions tht define the strings recognized by the following finite utomt: b d b b b c c b) Write FA tht recognizes the tokens defined by the following regulr

More information

Dr. D.M. Akbar Hussain

Dr. D.M. Akbar Hussain Dr. D.M. Akr Hussin Lexicl Anlysis. Bsic Ide: Red the source code nd generte tokens, it is similr wht humns will do to red in; just tking on the input nd reking it down in pieces. Ech token is sequence

More information

Topic 2: Lexing and Flexing

Topic 2: Lexing and Flexing Topic 2: Lexing nd Flexing COS 320 Compiling Techniques Princeton University Spring 2016 Lennrt Beringer 1 2 The Compiler Lexicl Anlysis Gol: rek strem of ASCII chrcters (source/input) into sequence of

More information

CS412/413. Introduction to Compilers Tim Teitelbaum. Lecture 4: Lexical Analyzers 28 Jan 08

CS412/413. Introduction to Compilers Tim Teitelbaum. Lecture 4: Lexical Analyzers 28 Jan 08 CS412/413 Introduction to Compilers Tim Teitelum Lecture 4: Lexicl Anlyzers 28 Jn 08 Outline DFA stte minimiztion Lexicl nlyzers Automting lexicl nlysis Jlex lexicl nlyzer genertor CS 412/413 Spring 2008

More information

CS 340, Fall 2014 Dec 11 th /13 th Final Exam Note: in all questions, the special symbol ɛ (epsilon) is used to indicate the empty string.

CS 340, Fall 2014 Dec 11 th /13 th Final Exam Note: in all questions, the special symbol ɛ (epsilon) is used to indicate the empty string. CS 340, Fll 2014 Dec 11 th /13 th Finl Exm Nme: Note: in ll questions, the specil symol ɛ (epsilon) is used to indicte the empty string. Question 1. [5 points] Consider the following regulr expression;

More information

CS 340, Fall 2016 Sep 29th Exam 1 Note: in all questions, the special symbol ɛ (epsilon) is used to indicate the empty string.

CS 340, Fall 2016 Sep 29th Exam 1 Note: in all questions, the special symbol ɛ (epsilon) is used to indicate the empty string. CS 340, Fll 2016 Sep 29th Exm 1 Nme: Note: in ll questions, the speil symol ɛ (epsilon) is used to indite the empty string. Question 1. [10 points] Speify regulr expression tht genertes the lnguge over

More information

Theory of Computation CSE 105

Theory of Computation CSE 105 $ $ $ Theory of Computtion CSE 105 Regulr Lnguges Study Guide nd Homework I Homework I: Solutions to the following problems should be turned in clss on July 1, 1999. Instructions: Write your nswers clerly

More information

CS321 Languages and Compiler Design I. Winter 2012 Lecture 5

CS321 Languages and Compiler Design I. Winter 2012 Lecture 5 CS321 Lnguges nd Compiler Design I Winter 2012 Lecture 5 1 FINITE AUTOMATA A non-deterministic finite utomton (NFA) consists of: An input lphet Σ, e.g. Σ =,. A set of sttes S, e.g. S = {1, 3, 5, 7, 11,

More information

ΕΠΛ323 - Θεωρία και Πρακτική Μεταγλωττιστών. Lecture 3b Lexical Analysis Elias Athanasopoulos

ΕΠΛ323 - Θεωρία και Πρακτική Μεταγλωττιστών. Lecture 3b Lexical Analysis Elias Athanasopoulos ΕΠΛ323 - Θωρία και Πρακτική Μταγλωττιστών Lecture 3 Lexicl Anlysis Elis Athnsopoulos elisthn@cs.ucy.c.cy RecogniNon of Tokens if expressions nd relnonl opertors if è if then è then else è else relop è

More information

TO REGULAR EXPRESSIONS

TO REGULAR EXPRESSIONS Suject :- Computer Science Course Nme :- Theory Of Computtion DA TO REGULAR EXPRESSIONS Report Sumitted y:- Ajy Singh Meen 07000505 jysmeen@cse.iit.c.in BASIC DEINITIONS DA:- A finite stte mchine where

More information

Languages and Finite Automata

Languages and Finite Automata Languages and Finite Automata or how to talk to machines... Costas Busch - RPI 1 Languages A language is a set of strings String: A sequence of letters (a word) Examples: cat, dog, house, Defined over

More information

this grammar generates the following language: Because this symbol will also be used in a later step, it receives the

this grammar generates the following language: Because this symbol will also be used in a later step, it receives the LR() nlysis Drwcks of LR(). Look-hed symols s eplined efore, concerning LR(), it is possile to consult the net set to determine, in the reduction sttes, for which symols it would e possile to perform reductions.

More information

ASTs, Regex, Parsing, and Pretty Printing

ASTs, Regex, Parsing, and Pretty Printing ASTs, Regex, Prsing, nd Pretty Printing CS 2112 Fll 2016 1 Algeric Expressions To strt, consider integer rithmetic. Suppose we hve the following 1. The lphet we will use is the digits {0, 1, 2, 3, 4, 5,

More information

Compilers Spring 2013 PRACTICE Midterm Exam

Compilers Spring 2013 PRACTICE Midterm Exam Compilers Spring 2013 PRACTICE Midterm Exm This is full length prctice midterm exm. If you wnt to tke it t exm pce, give yourself 7 minutes to tke the entire test. Just like the rel exm, ech question hs

More information

Reducing a DFA to a Minimal DFA

Reducing a DFA to a Minimal DFA Lexicl Anlysis - Prt 4 Reducing DFA to Miniml DFA Input: DFA IN Assume DFA IN never gets stuck (dd ded stte if necessry) Output: DFA MIN An equivlent DFA with the minimum numer of sttes. Hrry H. Porter,

More information

Lecture T1: Pattern Matching

Lecture T1: Pattern Matching Introduction to Theoreticl CS Lecture T: Pttern Mtchin Two fundmentl questions. Wht cn computer do? Wht cn computer do with limited resources? Generl pproch. Don t tlk out specific mchines or prolems.

More information

CSc 453. Compilers and Systems Software. 4 : Lexical Analysis II. Department of Computer Science University of Arizona

CSc 453. Compilers and Systems Software. 4 : Lexical Analysis II. Department of Computer Science University of Arizona CSc 453 Compilers nd Systems Softwre 4 : Lexicl Anlysis II Deprtment of Computer Science University of Arizon collerg@gmil.com Copyright c 2009 Christin Collerg Implementing Automt NFAs nd DFAs cn e hrd-coded

More information

CS 241 Week 4 Tutorial Solutions

CS 241 Week 4 Tutorial Solutions CS 4 Week 4 Tutoril Solutions Writing n Assemler, Prt & Regulr Lnguges Prt Winter 8 Assemling instrutions utomtilly. slt $d, $s, $t. Solution: $d, $s, nd $t ll fit in -it signed integers sine they re 5-it

More information

12 <= rm <digit> 2 <= rm <no> 2 <= rm <no> <digit> <= rm <no> <= rm <number>

12 <= rm <digit> 2 <= rm <no> 2 <= rm <no> <digit> <= rm <no> <= rm <number> DDD16 Compilers nd Interpreters DDB44 Compiler Construction R Prsing Prt 1 R prsing concept Using prser genertor Prse ree Genertion Wht is R-prsing? eft-to-right scnning R Rigthmost derivtion in reverse

More information

Scanner Termination. Multi Character Lookahead. to its physical end. Most parsers require an end of file token. Lex and Jlex automatically create an

Scanner Termination. Multi Character Lookahead. to its physical end. Most parsers require an end of file token. Lex and Jlex automatically create an Scnner Termintion A scnner reds input chrcters nd prtitions them into tokens. Wht hppens when the end of the input file is reched? It my be useful to crete n Eof pseudo-chrcter when this occurs. In Jv,

More information

CSE 401 Midterm Exam 11/5/10 Sample Solution

CSE 401 Midterm Exam 11/5/10 Sample Solution Question 1. egulr expressions (20 points) In the Ad Progrmming lnguge n integer constnt contins one or more digits, but it my lso contin embedded underscores. Any underscores must be preceded nd followed

More information

CS 430 Spring Mike Lam, Professor. Parsing

CS 430 Spring Mike Lam, Professor. Parsing CS 430 Spring 2015 Mike Lm, Professor Prsing Syntx Anlysis We cn now formlly descrie lnguge's syntx Using regulr expressions nd BNF grmmrs How does tht help us? Syntx Anlysis We cn now formlly descrie

More information

CS143 Handout 07 Summer 2011 June 24 th, 2011 Written Set 1: Lexical Analysis

CS143 Handout 07 Summer 2011 June 24 th, 2011 Written Set 1: Lexical Analysis CS143 Hndout 07 Summer 2011 June 24 th, 2011 Written Set 1: Lexicl Anlysis In this first written ssignment, you'll get the chnce to ply round with the vrious constructions tht come up when doing lexicl

More information

Implementing Automata. CSc 453. Compilers and Systems Software. 4 : Lexical Analysis II. Department of Computer Science University of Arizona

Implementing Automata. CSc 453. Compilers and Systems Software. 4 : Lexical Analysis II. Department of Computer Science University of Arizona Implementing utomt Sc 5 ompilers nd Systems Softwre : Lexicl nlysis II Deprtment of omputer Science University of rizon collerg@gmil.com opyright c 009 hristin ollerg NFs nd DFs cn e hrd-coded using this

More information

Midterm I Solutions CS164, Spring 2006

Midterm I Solutions CS164, Spring 2006 Midterm I Solutions CS164, Spring 2006 Februry 23, 2006 Plese red ll instructions (including these) crefully. Write your nme, login, SID, nd circle the section time. There re 8 pges in this exm nd 4 questions,

More information

Applied Databases. Sebastian Maneth. Lecture 13 Online Pattern Matching on Strings. University of Edinburgh - February 29th, 2016

Applied Databases. Sebastian Maneth. Lecture 13 Online Pattern Matching on Strings. University of Edinburgh - February 29th, 2016 Applied Dtses Lecture 13 Online Pttern Mtching on Strings Sestin Mneth University of Edinurgh - Ferury 29th, 2016 2 Outline 1. Nive Method 2. Automton Method 3. Knuth-Morris-Prtt Algorithm 4. Boyer-Moore

More information

UNIVERSITY OF EDINBURGH COLLEGE OF SCIENCE AND ENGINEERING SCHOOL OF INFORMATICS INFORMATICS 1 COMPUTATION & LOGIC INSTRUCTIONS TO CANDIDATES

UNIVERSITY OF EDINBURGH COLLEGE OF SCIENCE AND ENGINEERING SCHOOL OF INFORMATICS INFORMATICS 1 COMPUTATION & LOGIC INSTRUCTIONS TO CANDIDATES UNIVERSITY OF EDINBURGH COLLEGE OF SCIENCE AND ENGINEERING SCHOOL OF INFORMATICS INFORMATICS COMPUTATION & LOGIC Sturdy st April 7 : to : INSTRUCTIONS TO CANDIDATES This is tke-home exercise. It will not

More information

Tries. Yufei Tao KAIST. April 9, Y. Tao, April 9, 2013 Tries

Tries. Yufei Tao KAIST. April 9, Y. Tao, April 9, 2013 Tries Tries Yufei To KAIST April 9, 2013 Y. To, April 9, 2013 Tries In this lecture, we will discuss the following exct mtching prolem on strings. Prolem Let S e set of strings, ech of which hs unique integer

More information

Principles of Programming Languages

Principles of Programming Languages Principles of Progrmming Lnguges h"p://www.di.unipi.it/~ndre/did2c/plp- 14/ Prof. Andre Corrdini Deprtment of Computer Science, Pis Lesson 5! Gener;on of Lexicl Anlyzers Creting Lexicl Anlyzer with Lex

More information

acronyms possibly used in this test: CFG :acontext free grammar CFSM :acharacteristic finite state machine DFA :adeterministic finite automata

acronyms possibly used in this test: CFG :acontext free grammar CFSM :acharacteristic finite state machine DFA :adeterministic finite automata EE573 Fll 2002, Exm open book, if question seems mbiguous, sk me to clrify the question. If my nswer doesn t stisfy you, plese stte your ssumptions. cronyms possibly used in this test: CFG :context free

More information

COMP 423 lecture 11 Jan. 28, 2008

COMP 423 lecture 11 Jan. 28, 2008 COMP 423 lecture 11 Jn. 28, 2008 Up to now, we hve looked t how some symols in n lphet occur more frequently thn others nd how we cn sve its y using code such tht the codewords for more frequently occuring

More information

LR Parsing, Part 2. Constructing Parse Tables. Need to Automatically Construct LR Parse Tables: Action and GOTO Table

LR Parsing, Part 2. Constructing Parse Tables. Need to Automatically Construct LR Parse Tables: Action and GOTO Table TDDD55 Compilers nd Interpreters TDDB44 Compiler Construction LR Prsing, Prt 2 Constructing Prse Tles Prse tle construction Grmmr conflict hndling Ctegories of LR Grmmrs nd Prsers Peter Fritzson, Christoph

More information

LEX5: Regexps to NFA. Lexical Analysis. CMPT 379: Compilers Instructor: Anoop Sarkar. anoopsarkar.github.io/compilers-class

LEX5: Regexps to NFA. Lexical Analysis. CMPT 379: Compilers Instructor: Anoop Sarkar. anoopsarkar.github.io/compilers-class LEX5: Regexps to NFA Lexicl Anlysis CMPT 379: Compilers Instructor: Anoop Srkr noopsrkr.github.io/compilers-clss Building Lexicl Anlyzer Token POern POern Regulr Expression Regulr Expression NFA NFA DFA

More information

Lexical Analysis. Amitabha Sanyal. (www.cse.iitb.ac.in/ as) Department of Computer Science and Engineering, Indian Institute of Technology, Bombay

Lexical Analysis. Amitabha Sanyal. (www.cse.iitb.ac.in/ as) Department of Computer Science and Engineering, Indian Institute of Technology, Bombay Lexicl Anlysis Amith Snyl (www.cse.iit.c.in/ s) Deprtment of Computer Science nd Engineering, Indin Institute of Technology, Bomy Septemer 27 College of Engineering, Pune Lexicl Anlysis: 2/6 Recp The input

More information

CS 241. Fall 2017 Midterm Review Solutions. October 24, Bits and Bytes 1. 3 MIPS Assembler 6. 4 Regular Languages 7.

CS 241. Fall 2017 Midterm Review Solutions. October 24, Bits and Bytes 1. 3 MIPS Assembler 6. 4 Regular Languages 7. CS 241 Fll 2017 Midterm Review Solutions Octoer 24, 2017 Contents 1 Bits nd Bytes 1 2 MIPS Assemly Lnguge Progrmming 2 3 MIPS Assemler 6 4 Regulr Lnguges 7 5 Scnning 9 1 Bits nd Bytes 1. Give two s complement

More information

CSCE 531, Spring 2017, Midterm Exam Answer Key

CSCE 531, Spring 2017, Midterm Exam Answer Key CCE 531, pring 2017, Midterm Exm Answer Key 1. (15 points) Using the method descried in the ook or in clss, convert the following regulr expression into n equivlent (nondeterministic) finite utomton: (

More information

CS 321 Programming Languages and Compilers. Bottom Up Parsing

CS 321 Programming Languages and Compilers. Bottom Up Parsing CS 321 Progrmming nguges nd Compilers Bottom Up Prsing Bottom-up Prsing: Shift-reduce prsing Grmmr H: fi ; fi b Input: ;;b hs prse tree ; ; b 2 Dt for Shift-reduce Prser Input string: sequence of tokens

More information

Homework. Context Free Languages III. Languages. Plan for today. Context Free Languages. CFLs and Regular Languages. Homework #5 (due 10/22)

Homework. Context Free Languages III. Languages. Plan for today. Context Free Languages. CFLs and Regular Languages. Homework #5 (due 10/22) Homework Context Free Lnguges III Prse Trees nd Homework #5 (due 10/22) From textbook 6.4,b 6.5b 6.9b,c 6.13 6.22 Pln for tody Context Free Lnguges Next clss of lnguges in our quest! Lnguges Recll. Wht

More information

Fall Compiler Principles Lecture 1: Lexical Analysis. Roman Manevich Ben-Gurion University of the Negev

Fall Compiler Principles Lecture 1: Lexical Analysis. Roman Manevich Ben-Gurion University of the Negev Fll 2016-2017 Compiler Principles Lecture 1: Lexicl Anlysis Romn Mnevich Ben-Gurion University of the Negev Agend Understnd role of lexicl nlysis in compiler Regulr lnguges reminder Lexicl nlysis lgorithms

More information

Lexical Analysis and Lexical Analyzer Generators

Lexical Analysis and Lexical Analyzer Generators 1 Lexicl Anlysis nd Lexicl Anlyzer Genertors Chpter 3 COP5621 Compiler Construction Copyright Roert vn Engelen, Florid Stte University, 2007-2009 2 The Reson Why Lexicl Anlysis is Seprte Phse Simplifies

More information

CSCI 3130: Formal Languages and Automata Theory Lecture 12 The Chinese University of Hong Kong, Fall 2011

CSCI 3130: Formal Languages and Automata Theory Lecture 12 The Chinese University of Hong Kong, Fall 2011 CSCI 3130: Forml Lnguges nd utomt Theory Lecture 12 The Chinese University of Hong Kong, Fll 2011 ndrej Bogdnov In progrmming lnguges, uilding prse trees is significnt tsk ecuse prse trees tell us the

More information

Lecture T4: Pattern Matching

Lecture T4: Pattern Matching Introduction to Theoreticl CS Lecture T4: Pttern Mtching Two fundmentl questions. Wht cn computer do? How fst cn it do it? Generl pproch. Don t tlk bout specific mchines or problems. Consider miniml bstrct

More information

CMPT 379 Compilers. Lexical Analysis

CMPT 379 Compilers. Lexical Analysis CMPT 379 Compilers Anoop Srkr http://www.cs.sfu.c/~noop 9//7 Lexicl Anlysis Also clled scnning, tke input progrm string nd convert into tokens Exmple: T_DOUBLE ( doule ) T_IDENT ( f ) T_OP ( = ) doule

More information

Solving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence Winter 2016

Solving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence Winter 2016 Solving Prolems y Serching CS 486/686: Introduction to Artificil Intelligence Winter 2016 1 Introduction Serch ws one of the first topics studied in AI - Newell nd Simon (1961) Generl Prolem Solver Centrl

More information

Lecture 18: Theory of Computation

Lecture 18: Theory of Computation Introduction to Theoreticl CS ecture 18: Theory of Computtion Two fundmentl questions. Wht cn computer do? Wht cn computer do with limited resources? Generl pproch. Pentium IV running inux kernel.4. Don't

More information

What are suffix trees?

What are suffix trees? Suffix Trees 1 Wht re suffix trees? Allow lgorithm designers to store very lrge mount of informtion out strings while still keeping within liner spce Allow users to serch for new strings in the originl

More information

Solving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence

Solving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence Solving Prolems y Serching CS 486/686: Introduction to Artificil Intelligence 1 Introduction Serch ws one of the first topics studied in AI - Newell nd Simon (1961) Generl Prolem Solver Centrl component

More information

Compilation

Compilation Compiltion 0368-3133 Lecture 2: Lexicl Anlysis Nom Rinetzky 1 2 Lexicl Anlysis Modern Compiler Design: Chpter 2.1 3 Conceptul Structure of Compiler Compiler Source text txt Frontend Semntic Representtion

More information

stack of states and grammar symbols Stack-Bottom marker C. Kessler, IDA, Linköpings universitet. 1. <list> -> <list>, <element> 2.

stack of states and grammar symbols Stack-Bottom marker C. Kessler, IDA, Linköpings universitet. 1. <list> -> <list>, <element> 2. TDDB9 Compilers nd Interpreters TDDB44 Compiler Construction LR Prsing Updted/New slide mteril 007: Pushdown Automton for LR-Prsing Finite-stte pushdown utomton contins lterntingly sttes nd symols in NUΣ

More information

CS481: Bioinformatics Algorithms

CS481: Bioinformatics Algorithms CS481: Bioinformtics Algorithms Cn Alkn EA509 clkn@cs.ilkent.edu.tr http://www.cs.ilkent.edu.tr/~clkn/teching/cs481/ EXACT STRING MATCHING Fingerprint ide Assume: We cn compute fingerprint f(p) of P in

More information

ECE 468/573 Midterm 1 September 28, 2012

ECE 468/573 Midterm 1 September 28, 2012 ECE 468/573 Midterm 1 September 28, 2012 Nme:! Purdue emil:! Plese sign the following: I ffirm tht the nswers given on this test re mine nd mine lone. I did not receive help from ny person or mteril (other

More information

Suffix Tries. Slides adapted from the course by Ben Langmead

Suffix Tries. Slides adapted from the course by Ben Langmead Suffix Tries Slides dpted from the course y Ben Lngmed en.lngmed@gmil.com Indexing with suffixes Until now, our indexes hve een sed on extrcting sustrings from T A very different pproch is to extrct suffixes

More information

2014 Haskell January Test Regular Expressions and Finite Automata

2014 Haskell January Test Regular Expressions and Finite Automata 0 Hskell Jnury Test Regulr Expressions nd Finite Automt This test comprises four prts nd the mximum mrk is 5. Prts I, II nd III re worth 3 of the 5 mrks vilble. The 0 Hskell Progrmming Prize will be wrded

More information

CMPSC 470: Compiler Construction

CMPSC 470: Compiler Construction CMPSC 47: Compiler Construction Plese complete the following: Midterm (Type A) Nme Instruction: Mke sure you hve ll pges including this cover nd lnk pge t the end. Answer ech question in the spce provided.

More information

MTH 146 Conics Supplement

MTH 146 Conics Supplement 105- Review of Conics MTH 146 Conics Supplement In this section we review conics If ou ne more detils thn re present in the notes, r through section 105 of the ook Definition: A prol is the set of points

More information

Example: Source Code. Lexical Analysis. The Lexical Structure. Tokens. What do we really care here? A Sample Toy Program:

Example: Source Code. Lexical Analysis. The Lexical Structure. Tokens. What do we really care here? A Sample Toy Program: Lexicl Anlysis Red source progrm nd produce list of tokens ( liner nlysis) source progrm The lexicl structure is specified using regulr expressions Other secondry tsks: (1) get rid of white spces (e.g.,

More information

COMBINATORIAL PATTERN MATCHING

COMBINATORIAL PATTERN MATCHING COMBINATORIAL PATTERN MATCHING Genomic Repets Exmple of repets: ATGGTCTAGGTCCTAGTGGTC Motivtion to find them: Genomic rerrngements re often ssocited with repets Trce evolutionry secrets Mny tumors re chrcterized

More information

Fall Compiler Principles Lecture 1: Lexical Analysis. Roman Manevich Ben-Gurion University

Fall Compiler Principles Lecture 1: Lexical Analysis. Roman Manevich Ben-Gurion University Fll 2014-2015 Compiler Principles Lecture 1: Lexicl Anlysis Romn Mnevich Ben-Gurion University Agend Understnd role of lexicl nlysis in compiler Lexicl nlysis theory Implementing professionl scnner vi

More information

Regular Expressions and Automata using Miranda

Regular Expressions and Automata using Miranda Regulr Expressions nd Automt using Mirnd Simon Thompson Computing Lortory Univerisity of Kent t Cnterury My 1995 Contents 1 Introduction ::::::::::::::::::::::::::::::::: 1 2 Regulr Expressions :::::::::::::::::::::::::::::

More information

Local Search Heuristics for NFA State Minimization Problem *

Local Search Heuristics for NFA State Minimization Problem * Int. J. Communictions, etwork nd System Sciences, 0, 5, 638-63 http://dx.doi.org/0.36/ijcns.0.5907 Pulished Online Septemer 0 (http://www.scirp.org/journl/ijcns) Locl Serch Heuristics for FA Stte inimiztion

More information

Algorithm Design (5) Text Search

Algorithm Design (5) Text Search Algorithm Design (5) Text Serch Tkshi Chikym School of Engineering The University of Tokyo Text Serch Find sustring tht mtches the given key string in text dt of lrge mount Key string: chr x[m] Text Dt:

More information

Intermediate Information Structures

Intermediate Information Structures CPSC 335 Intermedite Informtion Structures LECTURE 13 Suffix Trees Jon Rokne Computer Science University of Clgry Cnd Modified from CMSC 423 - Todd Trengen UMD upd Preprocessing Strings We will look t

More information

Compiler Construction D7011E

Compiler Construction D7011E Compiler Construction D7011E Lecture 3: Lexer genertors Viktor Leijon Slides lrgely y John Nordlnder with mteril generously provided y Mrk P. Jones. 1 Recp: Hndwritten Lexers: Don t require sophisticted

More information

Scanner Termination. Multi Character Lookahead

Scanner Termination. Multi Character Lookahead If d.doublevlue() represents vlid integer, (int) d.doublevlue() will crete the pproprite integer vlue. If string representtion of n integer begins with ~ we cn strip the ~, convert to double nd then negte

More information

Top-down vs Bottom-up. Bottom up parsing. Sentential form. Handles. Handles in expression example

Top-down vs Bottom-up. Bottom up parsing. Sentential form. Handles. Handles in expression example Bottom up prsing Generl e LR0) LR LR1) LLR o est exploit JvCUP, should understnd the theoreticl sis LR prsing); op-down vs Bottom-up Bottom-up more powerful thn top-down; Cn process more powerful grmmr

More information

If you are at the university, either physically or via the VPN, you can download the chapters of this book as PDFs.

If you are at the university, either physically or via the VPN, you can download the chapters of this book as PDFs. Lecture 5 Wlks, Trils, Pths nd Connectedness Reding: Some of the mteril in this lecture comes from Section 1.2 of Dieter Jungnickel (2008), Grphs, Networks nd Algorithms, 3rd edition, which is ville online

More information

Context-Free Grammars

Context-Free Grammars Context-Free Grmmrs Descriing Lnguges We've seen two models for the regulr lnguges: Finite utomt ccept precisely the strings in the lnguge. Regulr expressions descrie precisely the strings in the lnguge.

More information

String Searching. String Search. Applications. Brute Force: Typical Case

String Searching. String Search. Applications. Brute Force: Typical Case String Serch String Serching String serch. Given pttern string p, find first mtch in text t. Model. Cn't fford to preprocess the text. Prmeters. N = length of text, M = length of pttern. typiclly N >>

More information

Regular Expression Matching with Multi-Strings and Intervals. Philip Bille Mikkel Thorup

Regular Expression Matching with Multi-Strings and Intervals. Philip Bille Mikkel Thorup Regulr Expression Mtching with Multi-Strings nd Intervls Philip Bille Mikkel Thorup Outline Definition Applictions Previous work Two new problems: Multi-strings nd chrcter clss intervls Algorithms Thompson

More information

Announcements. CS 188: Artificial Intelligence Fall Recap: Search. Today. Example: Pancake Problem. Example: Pancake Problem

Announcements. CS 188: Artificial Intelligence Fall Recap: Search. Today. Example: Pancake Problem. Example: Pancake Problem Announcements Project : erch It s live! Due 9/. trt erly nd sk questions. It s longer thn most! Need prtner? Come up fter clss or try Pizz ections: cn go to ny, ut hve priority in your own C 88: Artificil

More information

CS201 Discussion 10 DRAWTREE + TRIES

CS201 Discussion 10 DRAWTREE + TRIES CS201 Discussion 10 DRAWTREE + TRIES DrwTree First instinct: recursion As very generic structure, we could tckle this problem s follows: drw(): Find the root drw(root) drw(root): Write the line for the

More information

Suffix trees, suffix arrays, BWT

Suffix trees, suffix arrays, BWT ALGORITHMES POUR LA BIO-INFORMATIQUE ET LA VISUALISATION COURS 3 Rluc Uricru Suffix trees, suffix rrys, BWT Bsed on: Suffix trees nd suffix rrys presenttion y Him Kpln Suffix trees course y Pco Gomez Liner-Time

More information

Allocator Basics. Dynamic Memory Allocation in the Heap (malloc and free) Allocator Goals: malloc/free. Internal Fragmentation

Allocator Basics. Dynamic Memory Allocation in the Heap (malloc and free) Allocator Goals: malloc/free. Internal Fragmentation Alloctor Bsics Dynmic Memory Alloction in the Hep (mlloc nd free) Pges too corse-grined for llocting individul objects. Insted: flexible-sized, word-ligned blocks. Allocted block (4 words) Free block (3

More information

CSEP 573 Artificial Intelligence Winter 2016

CSEP 573 Artificial Intelligence Winter 2016 CSEP 573 Artificil Intelligence Winter 2016 Luke Zettlemoyer Problem Spces nd Serch slides from Dn Klein, Sturt Russell, Andrew Moore, Dn Weld, Pieter Abbeel, Ali Frhdi Outline Agents tht Pln Ahed Serch

More information

Knowledge States: A Tool in Randomized Online Algorithms

Knowledge States: A Tool in Randomized Online Algorithms : A Tool in Rndomized Online Algorithms Center for the Advnced Study of Algorithms School of Computer Science University of Nevd, Ls Vegs ADS 2007 couthors: Lwrence L. Lrmore, John Nog, Rüdiger Reischuk

More information

Operator Precedence. Java CUP. E E + T T T * P P P id id id. Does a+b*c mean (a+b)*c or

Operator Precedence. Java CUP. E E + T T T * P P P id id id. Does a+b*c mean (a+b)*c or Opertor Precedence Most progrmming lnguges hve opertor precedence rules tht stte the order in which opertors re pplied (in the sence of explicit prentheses). Thus in C nd Jv nd CSX, +*c mens compute *c,

More information

AI Adjacent Fields. This slide deck courtesy of Dan Klein at UC Berkeley

AI Adjacent Fields. This slide deck courtesy of Dan Klein at UC Berkeley AI Adjcent Fields Philosophy: Logic, methods of resoning Mind s physicl system Foundtions of lerning, lnguge, rtionlity Mthemtics Forml representtion nd proof Algorithms, computtion, (un)decidility, (in)trctility

More information

Mid-term exam. Scores. Fall term 2012 KAIST EE209 Programming Structures for EE. Thursday Oct 25, Student's name: Student ID:

Mid-term exam. Scores. Fall term 2012 KAIST EE209 Programming Structures for EE. Thursday Oct 25, Student's name: Student ID: Fll term 2012 KAIST EE209 Progrmming Structures for EE Mid-term exm Thursdy Oct 25, 2012 Student's nme: Student ID: The exm is closed book nd notes. Red the questions crefully nd focus your nswers on wht

More information

Sample Midterm Solutions COMS W4115 Programming Languages and Translators Monday, October 12, 2009

Sample Midterm Solutions COMS W4115 Programming Languages and Translators Monday, October 12, 2009 Deprtment of Computer cience Columbi University mple Midterm olutions COM W4115 Progrmming Lnguges nd Trnsltors Mondy, October 12, 2009 Closed book, no ids. ch question is worth 20 points. Question 5(c)

More information

Ma/CS 6b Class 1: Graph Recap

Ma/CS 6b Class 1: Graph Recap M/CS 6 Clss 1: Grph Recp By Adm Sheffer Course Detils Adm Sheffer. Office hour: Tuesdys 4pm. dmsh@cltech.edu TA: Victor Kstkin. Office hour: Tuesdys 7pm. 1:00 Mondy, Wednesdy, nd Fridy. http://www.mth.cltech.edu/~2014-15/2term/m006/

More information

From Indexing Data Structures to de Bruijn Graphs

From Indexing Data Structures to de Bruijn Graphs From Indexing Dt Structures to de Bruijn Grphs Bstien Czux, Thierry Lecroq, Eric Rivls LIRMM & IBC, Montpellier - LITIS Rouen June 1, 201 Czux, Lecroq, Rivls (LIRMM) Generlized Suffix Tree & DBG June 1,

More information

Information Retrieval and Organisation

Information Retrieval and Organisation Informtion Retrievl nd Orgnistion Suffix Trees dpted from http://www.mth.tu.c.il/~himk/seminr02/suffixtrees.ppt Dell Zhng Birkeck, University of London Trie A tree representing set of strings { } eef d

More information

Today. CS 188: Artificial Intelligence Fall Recap: Search. Example: Pancake Problem. Example: Pancake Problem. General Tree Search.

Today. CS 188: Artificial Intelligence Fall Recap: Search. Example: Pancake Problem. Example: Pancake Problem. General Tree Search. CS 88: Artificil Intelligence Fll 00 Lecture : A* Serch 9//00 A* Serch rph Serch Tody Heuristic Design Dn Klein UC Berkeley Multiple slides from Sturt Russell or Andrew Moore Recp: Serch Exmple: Pncke

More information

Problem Set 2 Fall 16 Due: Wednesday, September 21th, in class, before class begins.

Problem Set 2 Fall 16 Due: Wednesday, September 21th, in class, before class begins. Problem Set 2 Fll 16 Due: Wednesdy, September 21th, in clss, before clss begins. 1. LL Prsing For the following sub-problems, consider the following context-free grmmr: S T$ (1) T A (2) T bbb (3) A T (4)

More information

Today. Search Problems. Uninformed Search Methods. Depth-First Search Breadth-First Search Uniform-Cost Search

Today. Search Problems. Uninformed Search Methods. Depth-First Search Breadth-First Search Uniform-Cost Search Uninformed Serch [These slides were creted by Dn Klein nd Pieter Abbeel for CS188 Intro to AI t UC Berkeley. All CS188 mterils re vilble t http://i.berkeley.edu.] Tody Serch Problems Uninformed Serch Methods

More information

1.1. Interval Notation and Set Notation Essential Question When is it convenient to use set-builder notation to represent a set of numbers?

1.1. Interval Notation and Set Notation Essential Question When is it convenient to use set-builder notation to represent a set of numbers? 1.1 TEXAS ESSENTIAL KNOWLEDGE AND SKILLS Prepring for 2A.6.K, 2A.7.I Intervl Nottion nd Set Nottion Essentil Question When is it convenient to use set-uilder nottion to represent set of numers? A collection

More information

Objective: Students will understand what it means to describe, graph and write the equation of a parabola. Parabolas

Objective: Students will understand what it means to describe, graph and write the equation of a parabola. Parabolas Pge 1 of 8 Ojective: Students will understnd wht it mens to descrie, grph nd write the eqution of prol. Prols Prol: collection of ll points P in plne tht re the sme distnce from fixed point, the focus

More information

Java CUP. Java CUP Specifications. User Code Additions. Package and Import Specifications

Java CUP. Java CUP Specifications. User Code Additions. Package and Import Specifications Jv CUP Jv CUP is prser-genertion tool, similr to Ycc. CUP uilds Jv prser for LALR(1) grmmrs from production rules nd ssocited Jv code frgments. When prticulr production is recognized, its ssocited code

More information

5 Regular 4-Sided Composition

5 Regular 4-Sided Composition Xilinx-Lv User Guide 5 Regulr 4-Sided Composition This tutoril shows how regulr circuits with 4-sided elements cn be described in Lv. The type of regulr circuits tht re discussed in this tutoril re those

More information

Control-Flow Analysis and Loop Detection

Control-Flow Analysis and Loop Detection ! Control-Flow Anlysis nd Loop Detection!Lst time! PRE!Tody! Control-flow nlysis! Loops! Identifying loops using domintors! Reducibility! Using loop identifiction to identify induction vribles CS553 Lecture

More information