Compiler Construction D7011E
|
|
- Job Booth
- 6 years ago
- Views:
Transcription
1 Compiler Construction D7011E Lecture 3: Lexer genertors Viktor Leijon Slides lrgely y John Nordlnder with mteril generously provided y Mrk P. Jones. 1
2 Recp: Hndwritten Lexers: Don t require sophisticted progrmming. Often requires cre to void non-determinism, or potentilly expensive cktrcking. Cn e fine tuned for performnce nd for the lnguge concerned. But it might lso e something we would wnt to utomte 2
3 Cn Mchine do Better? It cn e hrd to write (correct) lexer y hnd But tht s not surprising: finite stte mchines re low level n ssemly lnguge of lexicl nlysis Cn we uild lexicl nlyzer genertor tht will tke cre of ll the dirty detils, nd let the humns work t higher level? If so, wht would its input look like? 3
4 Forml Lnguges: Pick n lphet A: set of symols. n n For lexicl nlysis, symol = chrcter. For prsing, symol = token. The set of ll finite strings of symols tken from A is written A*. A lnguge (over A) is suset of A* Two issues: n How do we descrie certin lnguge over A (suset of A*)? n How do we check whether string elongs to the lnguge? 4
5 Regulr Expressions: A syntx for descriing regulr lnguges. A widely used nottion for descriing ptterns in text strings: emcs, vi, grep, wk, perl, ut lso good for descriing the lexicl structure of progrmming lnguge 5
6 Regulr Expressions: Expression r 1 r 2 r 1 r 2 Mening Sequencing: text mtching r 1 followed y text mtching r 2. Alterntives: text mtching r 1 or text mtching r 2. r* Repetition: text mtching r zero or more times. 'c' Constnt: mtches text c literlly 'c 1 '..'c 2 ' Rnge: mtches single chrcter in the rnge etween c1 nd c2, inclusively. 6
7 Regulr Expressions: Expression r + Mening Repetition: text mtching r one ore more times. r + = rr* ( r ) Grouping: text mtching r. r? Optionl: Optionl text mtching r.. Wildcrd: Mtches ny single chrcter. ~r Negtion: Mtches ny single chrcter not mtched y r. R Rule: Mtches the sme text mtched y the regulr expression nmed R. 7
8 Relevnt Exmples: Expression ('0'..'9') + 'if' ('A'..'Z' ''..'z')('a'..'z' ''..'z' '0'..'9' '_')* (' ' '\t' '\n')+ '//'.* '\n' INT FRAC? EXP? frgment INT : ('0'..'9')+ FRAC : '.' INT EXP : ('E' 'e') ('+' '-')? INT Possile Use Integer literls The keyword if Identifier in C++ Whitespce C++ comment Floting point literl 8
9 Automted Lexer Genertors 9
10 The lex Fmily: lex is clssicl Unix tool for generting C progrms to implement lexicl nlyzers. It cn lso e used s quick wy of generting simple text processing utilities. lex dtes from the mid-seventies nd hs spwned fmily of clones: flex, ML lex, JLex, JFlex, Alex, etc Lex nd its successors re ll sed on ides from the theory of forml lnguges nd utomt 10
11 Vritions on the Theme: There re quite few lex-like tools ech ctering to prticulr n n progrmming lnguges operting system/environments They vry in minor detils of syntx etc., ut the lex heritge is usully pretty cler. Most of them hve lot of fetures; red the mnuls! In this course we will use ANTLR ( which is powerful tool for generting oth lexers nd prsers from common syntctic specifiction. 11
12 The Ins nd Outs of ANTLR: The input to ANTLR is grmmr file which my contin either lexer specifiction, or prser specifiction, or oth. If ANTLR is given lexer grmmr in file MyLex.g, its output is file MyLex.jv defining clss MyLex tht extends lirry clss Lexer. The importnt method of clss Lexer is Token nexttoken(); 12
13 The Ins nd Outs of ANTLR: The importnt methods of interfce Token re int gettype(); String gettext(); The importnt ttriutes of clss MyLex re integer constnts denoting token types, with one constnt defined for ech lexer rule in MyLex.g. To seprte lexer rules from prser rules, the former nmes lwys strt with Cpitl letter 13
14 ANTLR lexer grmmr formt: In file MyLex.g: lexer grmmr MyLex; optionl declrtions RULE 1 : regexp 1 { optionl Jv ctions } ; RULE n : regexp n { optionl Jv ctions } ; 14
15 Simple ANTLR lexicl rules: Lexer rules must egin with n uppercse letter: ID : (''..'z')+ ; Actions re optionl, the most useful ction prevents the mtched token from eing returned: WS : (' ' '\n') { skip(); } ; 15
16 Simple ANTLR lexicl rules: Tokens re normlly consumed y the code tht clls lexer.nexttoken() However, rule ctions my lso produce nother strem of output Current lexeme text is ville vi gettext(). Exmple: rule for copying input to System.out without ny chnge: TEXT :. { System.out.print(getText());} ; 16
17 Simple ANTLR lexicl rules: The mtched lexeme text my lso e mnipulted vi method settext(). A glol serch nd replce utility: CR : ('\r\n' '\n') { settext("\n"); }; THING : 'compiler' { settext("thing"); }; TEXT :. ; 17
18 Simple ANTLR lexicl rules: Suexpressions in rules my e referenced using the $NNN nottion. SPEC : ID '#' { settext($id.text); } ; ID : ''..'z'+ ; SEP : ('#' ' ' '\n' '\r')+ ; 18
19 Simple ANTLR lexicl rules: Alterntively, explicit nming of suexpressions my e used. SPEC : i=id '#' ID? { settext($i.text); } ; ID : ''..'z'+ ; SEP : ('#' ' ' '\n' '\r')+ ; 19
20 Simple ANTLR lexicl rules: Output for given pttern my depend on { oolen flg = flse; } BEGIN : 'BEGIN' { flg = true; } ; END : 'END' { flg = flse; } ; ID : (''..'z')+ { if (!flg) skip(); } ; WS : ' ' '\n' ; 20
21 Simple ANTLR lexicl rules: The mximl munch rule pplies DOUBLE : ' ' { settext("="); } ; SINGLE : ' ' { settext("-"); } ; TEXT :. ; 21
22 Simple ANTLR lexicl rules: If two rules mtch the sme lexeme, the first one wins: IF : 'if' { settext("if"); }; ID : (''..'z')+ WS : ' ' '\n' 22
23 Towrds n ANTLR lexer: A "complete" lexer grmmr file. lexer grmmr MyLex; IF : 'if' ; ELSE : 'else' ; IDENT LPAR : '(' ; RPAR : ')' ; : ('A'..'Z' ''..'z') ('A'..'Z' ''..'z' '0'..'9')* ; WS : (' ' '\n' '\t')+ { skip(); } ; COMMENT : '//'.* '\n' { skip(); } ; 23
24 Towrds n ANTLR lexer: Clling the lexer repetedly: ANTLRInputStrem input = new ANTLRInputStrem(System.in); MyLex lexer = new MyLex(input); Token t; do { t = lexer.nexttoken(); } while (t.gettype()!= MyLex.EOF); System.out.println("Success"); Filures throw n exception, defult hndling is utomticlly in plce! 24
25 The Theory Behind Regulr Expression Recognition 25
26 How lex & friends work: Lex, et el., tckle the genertion of lexers vi two intermedite stges: regulr expression 26
27 How lex & friends work: Lex, et el., tckle the genertion of lexers vi two intermedite stges: regulr expression A non-deterministic finite utomton (NFA) 26
28 How lex & friends work: Lex, et el., tckle the genertion of lexers vi two intermedite stges: regulr expression A non-deterministic finite utomton (NFA) A deterministic finite utomton (DFA) 26
29 How lex & friends work: Lex, et el., tckle the genertion of lexers vi two intermedite stges: regulr expression A non-deterministic finite utomton (NFA) A deterministic finite utomton (DFA) C/Jv/ code 26
30 Finite Automt Astrct devices for recognizing (checking) whether string elongs to some regulr lnguge For given string, finite utomton either ccepts it (the string elongs to the corresponding lnguge), or rejects it Intuitive wy of opertion: sed on the current stte nd the next input chrcter, either reject the chrcter, or ccept it nd go to the next stte 27
31 Finite Automt: We will use the following symols to descrie utomt: n stte numer n n stte numer n, ccepting A trnsition on symol A trnsition without ny input 28
32 (Non) Deterministic? A mchine is non-deterministic (n NFA) if there is stte with: n n more thn one trnsition on the sme symol; or with n trnsition. Otherwise, the mchine is deterministic ( DFA). 29
33 Exmple: Given regulr expression ( )*, we cn uild corresponding NFA: An equivlent DFA:
34 Building NFAs: We will descrie the construction of NFAs s process tht tkes: n A regulr expression r; nd n A pointer s to nother mchine. The result is mchine: NFA(r,s) r s which recognizes r, nd then goes to s. 31
35 Building the Min Recognizer: For n input file with ptterns r 1,,r n nd corresponding ctions 1,, n, we construct the following NFA: r 1 r n Do ction 1 if we ccept here Do ction n if we ccept here 32
36 Simple Cses: NFA(, s) = s NFA(c, ) = s c s NFA(r 1 r 2, ) s = NFA(r 1, NFA(r 2, s )) = r 1 r 2 s 33
37 Alterntives nd Repetition: NFA(r 1 r 2, ) = s r 1 r 2 s s NFA(r*, s ) = s r 34
38 Following the Algorithm: Let s use the lgorithm to uild n NFA for the regulr expression ( )*: 35
39 Following the Algorithm: Let s use the lgorithm to uild n NFA for the regulr expression ( )*: NFA(( )*, s) ( )* s 35
40 Following the Algorithm: NFA(( )*, NFA(, s)) ( )* NFA(, s) s 36
41 Following the Algorithm: NFA(( )*, NFA(, s)) NFA(,NFA(, s)) ( )* NFA(,s) s 37
42 Following the Algorithm: NFA(( )*, NFA(, s)) NFA(,s 1 ) s 1 ( )* 38
43 Following the Algorithm: NFA(( )*, s 2 ) s 2 ( )* 39
44 Following the Algorithm: NFA(( )*, s 2 ) NFA(, m) s 2 m 40
45 Following the Algorithm: NFA(( )*, s 2 ) NFA(,m) s 2 m NFA(,m) 41
46 Following the Algorithm: NFA(( )*, s 2 ) s 2 m NFA(,m) 42
47 Following the Algorithm: NFA(( )*, s 2 ) s 2 m 43
48 Following the Algorithm: NFA(( )*, s 2 ) s 2 m The right structure, ut more complex thn we might hve hoped we ll fix this soon 43
49 From NFAs to DFAs: Consider the simple NFA for ( )*: How do we know which rnch to tke in stte 0 when we see n? n We might end up in stte 0 or in stte 1. n Let s mke this lterntive explicit! 44
50 Illustrting NFA to DFA: Key ide: lel every stte in the DFA with set of NFA sttes: {0} {0,1} {0,2} 45
51 Mking DFA for the Exmple: Strt stte is {0} From {0}, we cn rech {0,1,2,3,4} without ny input (this is the -closure of {0}). {0,1,2,3,4} goes to {0,5}, hence {0,1,2,3,4,5} on. {0,1,2,3,4} goes to {0}, hence {0,1,2,3,4} on. 46
52 -closure: If S is set of NFA sttes, the -closure of S is the set of ll sttes tht cn e reched from S y n -trnsition. If s S, then s -closure(s). If s -closure(s), nd there is n -trnsition from s to t, then t -closure(s). 47
53 Mking DFA for the Exmple: {0,1,2,3,4,5} goes to {0,5}, hence {0,1,2,3,4,5} on. {0,1,2,3,4,5} goes to {0,6}, hence {0,1,2,3,4,6} on. 48
54 Mking DFA for the Exmple: {0,1,2,3,4,6} goes to {0,5}, hence {0,1,2,3,4,5} on. {0,1,2,3,4,6} goes to {0}, hence {0,1,2,3,4,6} on. {0,1,2,3,4,6} is n ccept stte in the DFA ecuse 6 is n ccept in the NFA. 49
55 The Finl DFA: 0,1,2, 3,4 0,1,2,3, 4,5 0,1,2,3, 4,6 50
56 More Formlly: If the strt stte of the NFA is leled n, then the strt stte of the DFA is leled -closure({n}). For ech chrcter A nd for ech stte X, there is single trnsition from X on which goes to the stte: Y = -closure({ y x X nd x goes to y on in the NFA }) A stte X in the DFA is n ccept stte if ny x X is n ccept stte in the NFA. We cn delete/ignore ny trnsitions to the empty stte, {}, ecuse trnsition to {} will never led to n ccept stte. 51
57 Stte Explosion? In theory, given n NFA with n distinct sttes, the corresponding DFA might hve s mny s 2 n distinct sttes! In prctice, we need only consider those sttes tht re rechle from the initil strt stte; this is usully much lower thn 2 n. 52
58 DFA Minimiztion: Is this DFA the only DFA tht will recognize ( )*? Clerly not: But every regulr set is recognized y minimum stte DFA tht is unique up to stte nmes. DFA minimiztion, however, is eyond the scope of this clss 53
59 From DFA to Implementtion: The lex pproch use generl, tle driven lgorithm: for (;;) { stte = tle[stte][getchr()]; if (stte==accept) rek; if (stte == X) throw (new ScnError()); } /* user code */ return TOKEN23; Stte c d e ACCEPT X X 54
60 From DFA to Implementtion: The flex pproch generte custom executle code: stte34 : switch(getchr()) { cse : goto stte37; cse : goto stte14; cse c : goto ccept; defult : goto stuck; } ccept: /* user code */ { return TOKEN23; } 55
61 From DFA to Implementtion: The ANTLR pproch tle-driven s lex, ut DFAs re customized for ech decision point (in oth the lexer nd the prser) int lt = dfn.predict(input); switch (lt) { cse 1 : mtchident(); rek; cse 2 : mtchint(); rek; cse 3 : mtchfloat(); rek; cse 4 : mtchcomment(); continue; } return stte.token; More on this technique in reltion to prsing! 56
62 Hndwritten or Mchine Generted? A mildly controversil topic! Issues include: n How efficient is the generted lexer? n How esily does it interfce to other code? n How nturl is the input? If the lnguge you re compiling hs some wkwrd fetures, the lexers produced y tool might need some mssging to do the right thing. n How good re the error messges? 57
63 Summry: Regulr expressions provide high-level lnguge for descriing lexemes. lex is useful tool for text processing nd lso for writing lexers lex works y mpping regulr expressions to NFAs, nd then mpping them to DFAs. n Automtes the tsk of removing non-determinism. We use ANTLR in the course project, ut fter tht, the choice is yours! 58
64 L Project (step 1): Implement lexer for MiniJv, using ANTLR. The clss Min shll contin min method tht clls the lexer repetedly when given -l s rgument., nd print Lexicl nlysis succeeded/filed s pproprite. The lexer shll hndle the MiniJv test suite correctly. There is n utomtic testsuite on the student mchines: /fs/ltu.se/students/l/e/leijon/testsuite/testsuite.pl The MiniJv syntx is descried in Appel, Appendix 1, ut we dd one exception: No /* nested /* comments */ necessry! */ See the wepge for detils, dedline on the 24th. 59
65 Reding instructions You should now hve finished Chpter 3. n Next we move on to prsing. Strt with chpter , Grmmrs & Top- Down prsing. 60
Fig.25: the Role of LEX
The Lnguge for Specifying Lexicl Anlyzer We shll now study how to uild lexicl nlyzer from specifiction of tokens in the form of list of regulr expressions The discussion centers round the design of n existing
More informationCS321 Languages and Compiler Design I. Winter 2012 Lecture 5
CS321 Lnguges nd Compiler Design I Winter 2012 Lecture 5 1 FINITE AUTOMATA A non-deterministic finite utomton (NFA) consists of: An input lphet Σ, e.g. Σ =,. A set of sttes S, e.g. S = {1, 3, 5, 7, 11,
More informationDr. D.M. Akbar Hussain
Dr. D.M. Akr Hussin Lexicl Anlysis. Bsic Ide: Red the source code nd generte tokens, it is similr wht humns will do to red in; just tking on the input nd reking it down in pieces. Ech token is sequence
More informationIn the last lecture, we discussed how valid tokens may be specified by regular expressions.
LECTURE 5 Scnning SYNTAX ANALYSIS We know from our previous lectures tht the process of verifying the syntx of the progrm is performed in two stges: Scnning: Identifying nd verifying tokens in progrm.
More informationCS 432 Fall Mike Lam, Professor a (bc)* Regular Expressions and Finite Automata
CS 432 Fll 2017 Mike Lm, Professor (c)* Regulr Expressions nd Finite Automt Compiltion Current focus "Bck end" Source code Tokens Syntx tree Mchine code chr dt[20]; int min() { flot x = 42.0; return 7;
More informationTopic 2: Lexing and Flexing
Topic 2: Lexing nd Flexing COS 320 Compiling Techniques Princeton University Spring 2016 Lennrt Beringer 1 2 The Compiler Lexicl Anlysis Gol: rek strem of ASCII chrcters (source/input) into sequence of
More informationCS412/413. Introduction to Compilers Tim Teitelbaum. Lecture 4: Lexical Analyzers 28 Jan 08
CS412/413 Introduction to Compilers Tim Teitelum Lecture 4: Lexicl Anlyzers 28 Jn 08 Outline DFA stte minimiztion Lexicl nlyzers Automting lexicl nlysis Jlex lexicl nlyzer genertor CS 412/413 Spring 2008
More informationLexical Analysis: Constructing a Scanner from Regular Expressions
Lexicl Anlysis: Constructing Scnner from Regulr Expressions Gol Show how to construct FA to recognize ny RE This Lecture Convert RE to n nondeterministic finite utomton (NFA) Use Thompson s construction
More informationDefinition of Regular Expression
Definition of Regulr Expression After the definition of the string nd lnguges, we re redy to descrie regulr expressions, the nottion we shll use to define the clss of lnguges known s regulr sets. Recll
More informationΕΠΛ323 - Θεωρία και Πρακτική Μεταγλωττιστών
ΕΠΛ323 - Θωρία και Πρακτική Μταγλωττιστών Lecture 3 Lexicl Anlysis Elis Athnsopoulos elisthn@cs.ucy.c.cy Recognition of Tokens if expressions nd reltionl opertors if è if then è then else è else relop
More informationCS 430 Spring Mike Lam, Professor. Parsing
CS 430 Spring 2015 Mike Lm, Professor Prsing Syntx Anlysis We cn now formlly descrie lnguge's syntx Using regulr expressions nd BNF grmmrs How does tht help us? Syntx Anlysis We cn now formlly descrie
More informationLexical Analysis. Amitabha Sanyal. (www.cse.iitb.ac.in/ as) Department of Computer Science and Engineering, Indian Institute of Technology, Bombay
Lexicl Anlysis Amith Snyl (www.cse.iit.c.in/ s) Deprtment of Computer Science nd Engineering, Indin Institute of Technology, Bomy Septemer 27 College of Engineering, Pune Lexicl Anlysis: 2/6 Recp The input
More informationReducing a DFA to a Minimal DFA
Lexicl Anlysis - Prt 4 Reducing DFA to Miniml DFA Input: DFA IN Assume DFA IN never gets stuck (dd ded stte if necessry) Output: DFA MIN An equivlent DFA with the minimum numer of sttes. Hrry H. Porter,
More informationCSc 453. Compilers and Systems Software. 4 : Lexical Analysis II. Department of Computer Science University of Arizona
CSc 453 Compilers nd Systems Softwre 4 : Lexicl Anlysis II Deprtment of Computer Science University of Arizon collerg@gmil.com Copyright c 2009 Christin Collerg Implementing Automt NFAs nd DFAs cn e hrd-coded
More informationLexical analysis, scanners. Construction of a scanner
Lexicl nlysis scnners (NB. Pges 4-5 re for those who need to refresh their knowledge of DFAs nd NFAs. These re not presented during the lectures) Construction of scnner Tools: stte utomt nd trnsition digrms.
More informationCompilation
Compiltion 0368-3133 Lecture 2: Lexicl Anlysis Nom Rinetzky 1 2 Lexicl Anlysis Modern Compiler Design: Chpter 2.1 3 Conceptul Structure of Compiler Compiler Source text txt Frontend Semntic Representtion
More informationScanner Termination. Multi Character Lookahead. to its physical end. Most parsers require an end of file token. Lex and Jlex automatically create an
Scnner Termintion A scnner reds input chrcters nd prtitions them into tokens. Wht hppens when the end of the input file is reched? It my be useful to crete n Eof pseudo-chrcter when this occurs. In Jv,
More informationImplementing Automata. CSc 453. Compilers and Systems Software. 4 : Lexical Analysis II. Department of Computer Science University of Arizona
Implementing utomt Sc 5 ompilers nd Systems Softwre : Lexicl nlysis II Deprtment of omputer Science University of rizon collerg@gmil.com opyright c 009 hristin ollerg NFs nd DFs cn e hrd-coded using this
More informationLanguages. L((a (b)(c))*) = { ε,a,bc,aa,abc,bca,... } εw = wε = w. εabba = abbaε = abba. (a (b)(c)) *
Pln for Tody nd Beginning Next week Interpreter nd Compiler Structure, or Softwre Architecture Overview of Progrmming Assignments The MeggyJv compiler we will e uilding. Regulr Expressions Finite Stte
More informationLexical Analysis and Lexical Analyzer Generators
1 Lexicl Anlysis nd Lexicl Anlyzer Genertors Chpter 3 COP5621 Compiler Construction Copyright Roert vn Engelen, Florid Stte University, 2007-2009 2 The Reson Why Lexicl Anlysis is Seprte Phse Simplifies
More informationCSCE 531, Spring 2017, Midterm Exam Answer Key
CCE 531, pring 2017, Midterm Exm Answer Key 1. (15 points) Using the method descried in the ook or in clss, convert the following regulr expression into n equivlent (nondeterministic) finite utomton: (
More informationCS143 Handout 07 Summer 2011 June 24 th, 2011 Written Set 1: Lexical Analysis
CS143 Hndout 07 Summer 2011 June 24 th, 2011 Written Set 1: Lexicl Anlysis In this first written ssignment, you'll get the chnce to ply round with the vrious constructions tht come up when doing lexicl
More informationFall Compiler Principles Lecture 1: Lexical Analysis. Roman Manevich Ben-Gurion University
Fll 2014-2015 Compiler Principles Lecture 1: Lexicl Anlysis Romn Mnevich Ben-Gurion University Agend Understnd role of lexicl nlysis in compiler Lexicl nlysis theory Implementing professionl scnner vi
More informationFall Compiler Principles Lecture 1: Lexical Analysis. Roman Manevich Ben-Gurion University of the Negev
Fll 2016-2017 Compiler Principles Lecture 1: Lexicl Anlysis Romn Mnevich Ben-Gurion University of the Negev Agend Understnd role of lexicl nlysis in compiler Regulr lnguges reminder Lexicl nlysis lgorithms
More informationExample: Source Code. Lexical Analysis. The Lexical Structure. Tokens. What do we really care here? A Sample Toy Program:
Lexicl Anlysis Red source progrm nd produce list of tokens ( liner nlysis) source progrm The lexicl structure is specified using regulr expressions Other secondry tsks: (1) get rid of white spces (e.g.,
More informationΕΠΛ323 - Θεωρία και Πρακτική Μεταγλωττιστών. Lecture 3b Lexical Analysis Elias Athanasopoulos
ΕΠΛ323 - Θωρία και Πρακτική Μταγλωττιστών Lecture 3 Lexicl Anlysis Elis Athnsopoulos elisthn@cs.ucy.c.cy RecogniNon of Tokens if expressions nd relnonl opertors if è if then è then else è else relop è
More informationCSCI 3130: Formal Languages and Automata Theory Lecture 12 The Chinese University of Hong Kong, Fall 2011
CSCI 3130: Forml Lnguges nd utomt Theory Lecture 12 The Chinese University of Hong Kong, Fll 2011 ndrej Bogdnov In progrmming lnguges, uilding prse trees is significnt tsk ecuse prse trees tell us the
More informationthis grammar generates the following language: Because this symbol will also be used in a later step, it receives the
LR() nlysis Drwcks of LR(). Look-hed symols s eplined efore, concerning LR(), it is possile to consult the net set to determine, in the reduction sttes, for which symols it would e possile to perform reductions.
More informationCMPSC 470: Compiler Construction
CMPSC 47: Compiler Construction Plese complete the following: Midterm (Type A) Nme Instruction: Mke sure you hve ll pges including this cover nd lnk pge t the end. Answer ech question in the spce provided.
More informationSome Thoughts on Grad School. Undergraduate Compilers Review and Intro to MJC. Structure of a Typical Compiler. Lexing and Parsing
Undergrdute Compilers Review nd Intro to MJC Announcements Miling list is in full swing Tody Some thoughts on grd school Finish prsing Semntic nlysis Visitor pttern for bstrct syntx trees Some Thoughts
More informationPrinciples of Programming Languages
Principles of Progrmming Lnguges h"p://www.di.unipi.it/~ndre/did2c/plp- 14/ Prof. Andre Corrdini Deprtment of Computer Science, Pis Lesson 5! Gener;on of Lexicl Anlyzers Creting Lexicl Anlyzer with Lex
More informationFinite Automata. Lecture 4 Sections Robb T. Koether. Hampden-Sydney College. Wed, Jan 21, 2015
Finite Automt Lecture 4 Sections 3.6-3.7 Ro T. Koether Hmpden-Sydney College Wed, Jn 21, 2015 Ro T. Koether (Hmpden-Sydney College) Finite Automt Wed, Jn 21, 2015 1 / 23 1 Nondeterministic Finite Automt
More informationCOS 333: Advanced Programming Techniques
COS 333: Advnced Progrmming Techniques Brin Kernighn wk@cs, www.cs.princeton.edu/~wk 311 CS Building 609-258-2089 (ut emil is lwys etter) TA's: Junwen Li, li@cs, CS 217,258-0451 Yong Wng,yongwng@cs, CS
More informationCompilers Spring 2013 PRACTICE Midterm Exam
Compilers Spring 2013 PRACTICE Midterm Exm This is full length prctice midterm exm. If you wnt to tke it t exm pce, give yourself 7 minutes to tke the entire test. Just like the rel exm, ech question hs
More informationCOMP 423 lecture 11 Jan. 28, 2008
COMP 423 lecture 11 Jn. 28, 2008 Up to now, we hve looked t how some symols in n lphet occur more frequently thn others nd how we cn sve its y using code such tht the codewords for more frequently occuring
More informationECE 468/573 Midterm 1 September 28, 2012
ECE 468/573 Midterm 1 September 28, 2012 Nme:! Purdue emil:! Plese sign the following: I ffirm tht the nswers given on this test re mine nd mine lone. I did not receive help from ny person or mteril (other
More informationDeterministic. Finite Automata. And Regular Languages. Fall 2018 Costas Busch - RPI 1
Deterministic Finite Automt And Regulr Lnguges Fll 2018 Costs Busch - RPI 1 Deterministic Finite Automton (DFA) Input Tpe String Finite Automton Output Accept or Reject Fll 2018 Costs Busch - RPI 2 Trnsition
More informationCMPT 379 Compilers. Lexical Analysis
CMPT 379 Compilers Anoop Srkr http://www.cs.sfu.c/~noop 9//7 Lexicl Anlysis Also clled scnning, tke input progrm string nd convert into tokens Exmple: T_DOUBLE ( doule ) T_IDENT ( f ) T_OP ( = ) doule
More informationTO REGULAR EXPRESSIONS
Suject :- Computer Science Course Nme :- Theory Of Computtion DA TO REGULAR EXPRESSIONS Report Sumitted y:- Ajy Singh Meen 07000505 jysmeen@cse.iit.c.in BASIC DEINITIONS DA:- A finite stte mchine where
More informationShould be done. Do Soon. Structure of a Typical Compiler. Plan for Today. Lab hours and Office hours. Quiz 1 is due tonight, was posted Tuesday night
Should e done L hours nd Office hours Sign up for the miling list t, strting to send importnt info to list http://groups.google.com/group/cs453-spring-2011 Red Ch 1 nd skim Ch 2 through 2.6, red 3.3 nd
More informationCOS 333: Advanced Programming Techniques
COS 333: Advnced Progrmming Techniques How to find me wk@cs, www.cs.princeton.edu/~wk 311 CS Building 609-258-2089 (ut emil is lwys etter) TA's: Mtvey Arye (rye), Tom Jlin (tjlin), Nick Johnson (npjohnso)
More informationScanner Termination. Multi Character Lookahead
If d.doublevlue() represents vlid integer, (int) d.doublevlue() will crete the pproprite integer vlue. If string representtion of n integer begins with ~ we cn strip the ~, convert to double nd then negte
More informationCSE 401 Midterm Exam 11/5/10 Sample Solution
Question 1. egulr expressions (20 points) In the Ad Progrmming lnguge n integer constnt contins one or more digits, but it my lso contin embedded underscores. Any underscores must be preceded nd followed
More informationCS 340, Fall 2014 Dec 11 th /13 th Final Exam Note: in all questions, the special symbol ɛ (epsilon) is used to indicate the empty string.
CS 340, Fll 2014 Dec 11 th /13 th Finl Exm Nme: Note: in ll questions, the specil symol ɛ (epsilon) is used to indicte the empty string. Question 1. [5 points] Consider the following regulr expression;
More informationAssignment 4. Due 09/18/17
Assignment 4. ue 09/18/17 1. ). Write regulr expressions tht define the strings recognized by the following finite utomt: b d b b b c c b) Write FA tht recognizes the tokens defined by the following regulr
More informationLR Parsing, Part 2. Constructing Parse Tables. Need to Automatically Construct LR Parse Tables: Action and GOTO Table
TDDD55 Compilers nd Interpreters TDDB44 Compiler Construction LR Prsing, Prt 2 Constructing Prse Tles Prse tle construction Grmmr conflict hndling Ctegories of LR Grmmrs nd Prsers Peter Fritzson, Christoph
More informationCS 340, Fall 2016 Sep 29th Exam 1 Note: in all questions, the special symbol ɛ (epsilon) is used to indicate the empty string.
CS 340, Fll 2016 Sep 29th Exm 1 Nme: Note: in ll questions, the speil symol ɛ (epsilon) is used to indite the empty string. Question 1. [10 points] Speify regulr expression tht genertes the lnguge over
More informationASTs, Regex, Parsing, and Pretty Printing
ASTs, Regex, Prsing, nd Pretty Printing CS 2112 Fll 2016 1 Algeric Expressions To strt, consider integer rithmetic. Suppose we hve the following 1. The lphet we will use is the digits {0, 1, 2, 3, 4, 5,
More informationContext-Free Grammars
Context-Free Grmmrs Descriing Lnguges We've seen two models for the regulr lnguges: Finite utomt ccept precisely the strings in the lnguge. Regulr expressions descrie precisely the strings in the lnguge.
More informationRegular Expressions and Automata using Miranda
Regulr Expressions nd Automt using Mirnd Simon Thompson Computing Lortory Univerisity of Kent t Cnterury My 1995 Contents 1 Introduction ::::::::::::::::::::::::::::::::: 1 2 Regulr Expressions :::::::::::::::::::::::::::::
More informationContext-Free Grammars
Context-Free Grmmrs Descriing Lnguges We've seen two models for the regulr lnguges: Finite utomt ccept precisely the strings in the lnguge. Regulr expressions descrie precisely the strings in the lnguge.
More information2014 Haskell January Test Regular Expressions and Finite Automata
0 Hskell Jnury Test Regulr Expressions nd Finite Automt This test comprises four prts nd the mximum mrk is 5. Prts I, II nd III re worth 3 of the 5 mrks vilble. The 0 Hskell Progrmming Prize will be wrded
More informationVirtual Machine (Part I)
Hrvrd University CS Fll 2, Shimon Schocken Virtul Mchine (Prt I) Elements of Computing Systems Virtul Mchine I (Ch. 7) Motivtion clss clss Min Min sttic sttic x; x; function function void void min() min()
More informationLecture T4: Pattern Matching
Introduction to Theoreticl CS Lecture T4: Pttern Mtching Two fundmentl questions. Wht cn computer do? How fst cn it do it? Generl pproch. Don t tlk bout specific mchines or problems. Consider miniml bstrct
More informationQuiz2 45mins. Personal Number: Problem 1. (20pts) Here is an Table of Perl Regular Ex
Long Quiz2 45mins Nme: Personl Numer: Prolem. (20pts) Here is n Tle of Perl Regulr Ex Chrcter Description. single chrcter \s whitespce chrcter (spce, t, newline) \S non-whitespce chrcter \d digit (0-9)
More informationCS 321 Programming Languages and Compilers. Bottom Up Parsing
CS 321 Progrmming nguges nd Compilers Bottom Up Prsing Bottom-up Prsing: Shift-reduce prsing Grmmr H: fi ; fi b Input: ;;b hs prse tree ; ; b 2 Dt for Shift-reduce Prser Input string: sequence of tokens
More informationFrom Dependencies to Evaluation Strategies
From Dependencies to Evlution Strtegies Possile strtegies: 1 let the user define the evlution order 2 utomtic strtegy sed on the dependencies: use locl dependencies to determine which ttriutes to compute
More informationUNIVERSITY OF EDINBURGH COLLEGE OF SCIENCE AND ENGINEERING SCHOOL OF INFORMATICS INFORMATICS 1 COMPUTATION & LOGIC INSTRUCTIONS TO CANDIDATES
UNIVERSITY OF EDINBURGH COLLEGE OF SCIENCE AND ENGINEERING SCHOOL OF INFORMATICS INFORMATICS COMPUTATION & LOGIC Sturdy st April 7 : to : INSTRUCTIONS TO CANDIDATES This is tke-home exercise. It will not
More information12 <= rm <digit> 2 <= rm <no> 2 <= rm <no> <digit> <= rm <no> <= rm <number>
DDD16 Compilers nd Interpreters DDB44 Compiler Construction R Prsing Prt 1 R prsing concept Using prser genertor Prse ree Genertion Wht is R-prsing? eft-to-right scnning R Rigthmost derivtion in reverse
More informationTheory of Computation CSE 105
$ $ $ Theory of Computtion CSE 105 Regulr Lnguges Study Guide nd Homework I Homework I: Solutions to the following problems should be turned in clss on July 1, 1999. Instructions: Write your nswers clerly
More informationIf you are at the university, either physically or via the VPN, you can download the chapters of this book as PDFs.
Lecture 5 Wlks, Trils, Pths nd Connectedness Reding: Some of the mteril in this lecture comes from Section 1.2 of Dieter Jungnickel (2008), Grphs, Networks nd Algorithms, 3rd edition, which is ville online
More informationCMSC 331 First Midterm Exam
0 00/ 1 20/ 2 05/ 3 15/ 4 15/ 5 15/ 6 20/ 7 30/ 8 30/ 150/ 331 First Midterm Exm 7 October 2003 CMC 331 First Midterm Exm Nme: mple Answers tudent ID#: You will hve seventy-five (75) minutes to complete
More information10/12/17. Motivating Example. Lexical and Syntax Analysis (2) Recursive-Descent Parsing. Recursive-Descent Parsing. Recursive-Descent Parsing
Motivting Exmple Lexicl nd yntx Anlysis (2) In Text: Chpter 4 Consider the grmmr -> cad A -> b Input string: w = cd How to build prse tree top-down? 2 Initilly crete tree contining single node (the strt
More informationOperator Precedence. Java CUP. E E + T T T * P P P id id id. Does a+b*c mean (a+b)*c or
Opertor Precedence Most progrmming lnguges hve opertor precedence rules tht stte the order in which opertors re pplied (in the sence of explicit prentheses). Thus in C nd Jv nd CSX, +*c mens compute *c,
More informationScanning Theory and Practice
CHAPTER 3 Scnning Theory nd Prctice 3.1 Overview The primry function of scnner is to red in chrcters from source file nd group them into tokens. A scnner is sometimes clled lexicl nlyzer or lexer. The
More informationcisc1110 fall 2010 lecture VI.2 call by value function parameters another call by value example:
cisc1110 fll 2010 lecture VI.2 cll y vlue function prmeters more on functions more on cll y vlue nd cll y reference pssing strings to functions returning strings from functions vrile scope glol vriles
More informationApplied Databases. Sebastian Maneth. Lecture 13 Online Pattern Matching on Strings. University of Edinburgh - February 29th, 2016
Applied Dtses Lecture 13 Online Pttern Mtching on Strings Sestin Mneth University of Edinurgh - Ferury 29th, 2016 2 Outline 1. Nive Method 2. Automton Method 3. Knuth-Morris-Prtt Algorithm 4. Boyer-Moore
More informationLecture 10 Evolutionary Computation: Evolution strategies and genetic programming
Lecture 10 Evolutionry Computtion: Evolution strtegies nd genetic progrmming Evolution strtegies Genetic progrmming Summry Negnevitsky, Person Eduction, 2011 1 Evolution Strtegies Another pproch to simulting
More informationJava CUP. Java CUP Specifications. User Code Additions. Package and Import Specifications
Jv CUP Jv CUP is prser-genertion tool, similr to Ycc. CUP uilds Jv prser for LALR(1) grmmrs from production rules nd ssocited Jv code frgments. When prticulr production is recognized, its ssocited code
More informationCS 241 Week 4 Tutorial Solutions
CS 4 Week 4 Tutoril Solutions Writing n Assemler, Prt & Regulr Lnguges Prt Winter 8 Assemling instrutions utomtilly. slt $d, $s, $t. Solution: $d, $s, nd $t ll fit in -it signed integers sine they re 5-it
More informationLab 1 - Counter. Create a project. Add files to the project. Compile design files. Run simulation. Debug results
1 L 1 - Counter A project is collection mechnism for n HDL design under specifiction or test. Projects in ModelSim ese interction nd re useful for orgnizing files nd specifying simultion settings. The
More informationSlides for Data Mining by I. H. Witten and E. Frank
Slides for Dt Mining y I. H. Witten nd E. Frnk Simplicity first Simple lgorithms often work very well! There re mny kinds of simple structure, eg: One ttriute does ll the work All ttriutes contriute eqully
More informationMidterm I Solutions CS164, Spring 2006
Midterm I Solutions CS164, Spring 2006 Februry 23, 2006 Plese red ll instructions (including these) crefully. Write your nme, login, SID, nd circle the section time. There re 8 pges in this exm nd 4 questions,
More informationCOMPUTER SCIENCE 123. Foundations of Computer Science. 6. Tuples
COMPUTER SCIENCE 123 Foundtions of Computer Science 6. Tuples Summry: This lecture introduces tuples in Hskell. Reference: Thompson Sections 5.1 2 R.L. While, 2000 3 Tuples Most dt comes with structure
More informationToday. CS 188: Artificial Intelligence Fall Recap: Search. Example: Pancake Problem. Example: Pancake Problem. General Tree Search.
CS 88: Artificil Intelligence Fll 00 Lecture : A* Serch 9//00 A* Serch rph Serch Tody Heuristic Design Dn Klein UC Berkeley Multiple slides from Sturt Russell or Andrew Moore Recp: Serch Exmple: Pncke
More informationCS 241. Fall 2017 Midterm Review Solutions. October 24, Bits and Bytes 1. 3 MIPS Assembler 6. 4 Regular Languages 7.
CS 241 Fll 2017 Midterm Review Solutions Octoer 24, 2017 Contents 1 Bits nd Bytes 1 2 MIPS Assemly Lnguge Progrmming 2 3 MIPS Assemler 6 4 Regulr Lnguges 7 5 Scnning 9 1 Bits nd Bytes 1. Give two s complement
More informationSuffix trees, suffix arrays, BWT
ALGORITHMES POUR LA BIO-INFORMATIQUE ET LA VISUALISATION COURS 3 Rluc Uricru Suffix trees, suffix rrys, BWT Bsed on: Suffix trees nd suffix rrys presenttion y Him Kpln Suffix trees course y Pco Gomez Liner-Time
More informationWhat are suffix trees?
Suffix Trees 1 Wht re suffix trees? Allow lgorithm designers to store very lrge mount of informtion out strings while still keeping within liner spce Allow users to serch for new strings in the originl
More informationPPS: User Manual. Krishnendu Chatterjee, Martin Chmelik, Raghav Gupta, and Ayush Kanodia
PPS: User Mnul Krishnendu Chtterjee, Mrtin Chmelik, Rghv Gupt, nd Ayush Knodi IST Austri (Institute of Science nd Technology Austri), Klosterneuurg, Austri In this section we descrie the tool fetures,
More informationCS481: Bioinformatics Algorithms
CS481: Bioinformtics Algorithms Cn Alkn EA509 clkn@cs.ilkent.edu.tr http://www.cs.ilkent.edu.tr/~clkn/teching/cs481/ EXACT STRING MATCHING Fingerprint ide Assume: We cn compute fingerprint f(p) of P in
More informationCOMBINATORIAL PATTERN MATCHING
COMBINATORIAL PATTERN MATCHING Genomic Repets Exmple of repets: ATGGTCTAGGTCCTAGTGGTC Motivtion to find them: Genomic rerrngements re often ssocited with repets Trce evolutionry secrets Mny tumors re chrcterized
More informationDiscussion 1 Recap. COP4600 Discussion 2 OS concepts, System call, and Assignment 1. Questions. Questions. Outline. Outline 10/24/2010
COP4600 Discussion 2 OS concepts, System cll, nd Assignment 1 TA: Hufeng Jin hj0@cise.ufl.edu Discussion 1 Recp Introduction to C C Bsic Types (chr, int, long, flot, doule, ) C Preprocessors (#include,
More informationMid-term exam. Scores. Fall term 2012 KAIST EE209 Programming Structures for EE. Thursday Oct 25, Student's name: Student ID:
Fll term 2012 KAIST EE209 Progrmming Structures for EE Mid-term exm Thursdy Oct 25, 2012 Student's nme: Student ID: The exm is closed book nd notes. Red the questions crefully nd focus your nswers on wht
More informationstack of states and grammar symbols Stack-Bottom marker C. Kessler, IDA, Linköpings universitet. 1. <list> -> <list>, <element> 2.
TDDB9 Compilers nd Interpreters TDDB44 Compiler Construction LR Prsing Updted/New slide mteril 007: Pushdown Automton for LR-Prsing Finite-stte pushdown utomton contins lterntingly sttes nd symols in NUΣ
More informationSystems I. Logic Design I. Topics Digital logic Logic gates Simple combinational logic circuits
Systems I Logic Design I Topics Digitl logic Logic gtes Simple comintionl logic circuits Simple C sttement.. C = + ; Wht pieces of hrdwre do you think you might need? Storge - for vlues,, C Computtion
More informationCS 236 Language and Computation. Alphabet. Definition. I.2.1. Formal Languages (10.1)
C 236 Lnguge nd Computtion Course Notes Prt I: Grmmrs for Defining yntx (II) Chpter I.2: yntx nd Grmmrs (10, 12.1) Anton etzer (Bsed on ook drft y J. V. Tucker nd K. tephenson) Dept. of Computer cience,
More informationP(r)dr = probability of generating a random number in the interval dr near r. For this probability idea to make sense we must have
Rndom Numers nd Monte Crlo Methods Rndom Numer Methods The integrtion methods discussed so fr ll re sed upon mking polynomil pproximtions to the integrnd. Another clss of numericl methods relies upon using
More informationFunctor (1A) Young Won Lim 10/5/17
Copyright (c) 2016-2017 Young W. Lim. Permission is grnted to copy, distribute nd/or modify this document under the terms of the GNU Free Documenttion License, Version 1.2 or ny lter version published
More informationRecognition of Tokens
42 Recognton o Tokens The queston s how to recognze the tokens? Exmple: ssume the ollowng grmmr rgment to generte specc lnguge: stmt expr expr then stmt expr then stmt else stmt term relop term term term
More informationHomework. Context Free Languages III. Languages. Plan for today. Context Free Languages. CFLs and Regular Languages. Homework #5 (due 10/22)
Homework Context Free Lnguges III Prse Trees nd Homework #5 (due 10/22) From textbook 6.4,b 6.5b 6.9b,c 6.13 6.22 Pln for tody Context Free Lnguges Next clss of lnguges in our quest! Lnguges Recll. Wht
More informationDistributed Systems Principles and Paradigms
Distriuted Systems Principles nd Prdigms Chpter 11 (version April 7, 2008) Mrten vn Steen Vrije Universiteit Amsterdm, Fculty of Science Dept. Mthemtics nd Computer Science Room R4.20. Tel: (020) 598 7784
More informationProblem Set 2 Fall 16 Due: Wednesday, September 21th, in class, before class begins.
Problem Set 2 Fll 16 Due: Wednesdy, September 21th, in clss, before clss begins. 1. LL Prsing For the following sub-problems, consider the following context-free grmmr: S T$ (1) T A (2) T bbb (3) A T (4)
More informationCPSC 213. Polymorphism. Introduction to Computer Systems. Readings for Next Two Lectures. Back to Procedure Calls
Redings for Next Two Lectures Text CPSC 213 Switch Sttements, Understnding Pointers - 2nd ed: 3.6.7, 3.10-1st ed: 3.6.6, 3.11 Introduction to Computer Systems Unit 1f Dynmic Control Flow Polymorphism nd
More informationInformation Retrieval and Organisation
Informtion Retrievl nd Orgnistion Suffix Trees dpted from http://www.mth.tu.c.il/~himk/seminr02/suffixtrees.ppt Dell Zhng Birkeck, University of London Trie A tree representing set of strings { } eef d
More informationAnnouncements. CS 188: Artificial Intelligence Fall Recap: Search. Today. Example: Pancake Problem. Example: Pancake Problem
Announcements Project : erch It s live! Due 9/. trt erly nd sk questions. It s longer thn most! Need prtner? Come up fter clss or try Pizz ections: cn go to ny, ut hve priority in your own C 88: Artificil
More informationacronyms possibly used in this test: CFG :acontext free grammar CFSM :acharacteristic finite state machine DFA :adeterministic finite automata
EE573 Fll 2002, Exm open book, if question seems mbiguous, sk me to clrify the question. If my nswer doesn t stisfy you, plese stte your ssumptions. cronyms possibly used in this test: CFG :context free
More informationStack Manipulation. Other Issues. How about larger constants? Frame Pointer. PowerPC. Alternative Architectures
Other Issues Stck Mnipultion support for procedures (Refer to section 3.6), stcks, frmes, recursion mnipulting strings nd pointers linkers, loders, memory lyout Interrupts, exceptions, system clls nd conventions
More informationFunctor (1A) Young Won Lim 8/2/17
Copyright (c) 2016-2017 Young W. Lim. Permission is grnted to copy, distribute nd/or modify this document under the terms of the GNU Free Documenttion License, Version 1.2 or ny lter version published
More informationGeorge Boole. IT 3123 Hardware and Software Concepts. Switching Algebra. Boolean Functions. Boolean Functions. Truth Tables
George Boole IT 3123 Hrdwre nd Softwre Concepts My 28 Digitl Logic The Little Mn Computer 1815 1864 British mthemticin nd philosopher Mny contriutions to mthemtics. Boolen lger: n lger over finite sets
More informationTries. Yufei Tao KAIST. April 9, Y. Tao, April 9, 2013 Tries
Tries Yufei To KAIST April 9, 2013 Y. To, April 9, 2013 Tries In this lecture, we will discuss the following exct mtching prolem on strings. Prolem Let S e set of strings, ech of which hs unique integer
More information