Solutions Exercise Set 3 Author: Charmi Panchal
|
|
- Fay Gloria Walters
- 6 years ago
- Views:
Transcription
1 Solutions Exercise Set 3 Author: Charmi Panchal Problem 1: Suppose we have following fragments: f1 = ATCCTTAACCCC f2 = TTAACTCA f3 = TTAATACTCCC f4 = ATCTTTC f5 = CACTCCCACACA f6 = CACAATCCTTAACCC f7 = CTCATTAATA f8 = CCCATACTT We know that the total length of the target molecule is about 50bp and may be ready to accept a solution of length between 45 and 55 bp. Assemble these fragments and obtain a consensus sequence. Be prepared to deal with errors. You may also have to use the reverse complement of some of the fragments. Fragments f1 = ATCCTTAACCCC f2 = TTAACTCA f3 = TTAATACTCCC f4 = ATCTTTC f5 = CACTCCC ACACA f6 = CACAATCCTTAACCC f7 = CTCATTAATA f8 = CCCATACTT Reversed and complemented CCCCCTTCAACAT CCTCATTAA CCATACTTAA CCCACACAAT TTTCATC CCCCCTTCAACATCTT TACTTAACTCA AATACTCCCC Starting with f2 and f3 CCTCATTAA TTAATACTCCC CCTCATTAATACT CCC AATACTCCCC CCTCATTAATACTCCCC CTCATTAATA CCTCATTAACTACTCCCC CCCCCTTCAACAT CCTCATTAACTACTCCCCCTTCAACAT CCCCCTTCAACATCTT CCTCATTAACTACTCCCCCTTCAACATCTT (f8 ) (f7) (f1 ) (f6 )
2 CCTCATTAACTACTCCCCCTTCAACATCTT ATCTTTC TTTCATC CCTCATTAACTACTCCCCCTTCAACATCTTTCATC (last superstring) (f4) (f5) Problem 2: Let F={ATC, TC, AAC}. Find the best layout for this collection according to the sequence reconstruction model, with error level e=0.1. The same problem for e=0.25. Be sure to consider also reverse complements. With e = 0.1 -For f1= ATC it matches well with substring a = ATC, d(f1,a) = 0<0.3 ( because f1 = 3 and e* f1 =0.3). -For f2= TC it matches well with substring a = ATC, d(f2,a) = 0<0.3 ( because f2 = 3 and e* f2 =0.3). -For f3= AAC, e* f3 =0.4. If f3= AAC is considered and it is matched with substring a = ATC, then d(f3,a) = (because f3 =4). Taking reverse complement f3 = CTT. f3 matches well with a=ctt (see the table with error level 0.1 ), d(f3,a) = 0. A T C T C A A C A T C Error level 0.25 One error is allowed. A T C T C C T T A T C T T Error level 0.1 No errors are allowed. Considering e= For f1= ATC it matches well with substring a = ATC, d(f1,a) = 0<0.75 ( because f1 = 3 and e* f1 =0.75). -For f2= TC it matches well with substring a = ATC, d(f2,a) = 0<0.75 ( because f2 = 3 and e* f2 =0.75). -For f3= AAC, If f3= AAC is considered and it is matched with substring a = ATC, then d(f3,a) = 1=1 (because f3 =4 and e = 0.25, e* f3 = 1). Problem 3: a) You want to use the sequencing by hybridization method (SBH) to sequence a DNA fragment. For this, you are using a DNA array containing all DNA sequences of length 3 and test which of these sequences bind to your target. As a result, you find out that the target sequence has the following substrings of length 3: { AT, CT, CT, T, T, TA, TC, T } Find at least 2 DNA sequences validating this data. b) How many solutions do you have if, using a DNA array containing all sequences of length 4, you obtain that the target sequence has the following substrings of length 4: {AT, CTA, CT, T, TC, TCT, TT }?
3 (a) AT T CT T T T C A Following the Eulerian paths AT T C CT T T T A One possible sequence ATCTTA AT T T T C CT T A Another possible sequence ATTCTA (b) {AT, CTA, CT, T, TC, TCT, TT} T T T T TC C AT T T CT CT TA T CT One Eulerian path possible AT T T T TC CT CT TA ATTCTA Problem 4: You are assembling a DNA sequence containing a repeat of the form XXX. Having given the fragments AT, CTTAT, TT, TTCA, TCAAT, TTAACT, find at least two such DNA sequences knowing that - No fragment is included into some other - The fragments provide good linkage, in the sense that all fragments (except the one covering the ends of the sequence) overlap with at least one fragment at left and with another at right. AT CTTAT TT TTCA TCAAT TTAACT Fragments CAT ATCAA ACA TACA ATCTA ATTACA Reversed and complemented
4 One possible solution: A T C A A A T T A C A _ C A T T T T A C A A T C T A A T C A A T T A C A T T A C A T C T A Other possible solutions : Fragment 4 and 5 Alignment 1 T T C A _ T C A A T T T C A A T Fragments 2 and 6 Alignment 2 _ C T T A T T T A A C T T T A A C T T A T Consider above two alignments. It is clear that TT must be part of the repeat. One solution could be : T T C A A T T T A A C T T A T - - A T T T T T C A A T T A A C T T A T T Another solution : T T A A C T T A T A T T T C A A T _ T T T T A A C T T A T T C A A T T More possibilities: Result 3: AT + Alignment 1 + TT + Alignment 2: ATTCAATTTAACTTAT length 21. Result 4: AT + Alignment 2 + TT + Alignment 1: ATTAACTTATTTCAAT length 21.
5 Problem 5. a) Assemble the following error-free fragments using the shotgun approach: ATT, CCCA, TCC, TTCC. b) The same problem as above, replacing the second fragment above with CCCCA. Assemble the fragments using the shotgun approach. Assemble the fragments using also the SBH-style shotgun approach. Compare the results and also with the result obtained at a), knowing that fragment CCCCA had one substitution error the correct one was the second fragment in a). (a) T T C C _ T C C A T T _ C C C A A T T C C C A (b) Replacing the second fragment with CCCCA. _ T T C C _ T C C A T T C C C C A C C C C A T T C C SBH-style shotgun approach: First making substrings of length 3. {AT, TT, T, CCC, CC, CC, CA, TC, CC}. Build a graph with nodes all substrings of length 2. Corresponding graph is as follows: AT T T C T T C Eulerian path is : AT T T T C CC CC C C CA ATTCCCCA C C CA CC C
6 Comparison Result obtain in (a) ATTCCCA Same as (a) with replacing the second fragment CCCCATTCC with CCCCA SBH-style shotgun approach ATTCCCCA Solution obtain with SBH-style is very close to the one obtain in (a). SBH approach is less sensitive to the errors than shotgun approach.
Sequencing. Computational Biology IST Ana Teresa Freitas 2011/2012. (BACs) Whole-genome shotgun sequencing Celera Genomics
Computational Biology IST Ana Teresa Freitas 2011/2012 Sequencing Clone-by-clone shotgun sequencing Human Genome Project Whole-genome shotgun sequencing Celera Genomics (BACs) 1 Must take the fragments
More informationGenome Reconstruction: A Puzzle with a Billion Pieces Phillip E. C. Compeau and Pavel A. Pevzner
Genome Reconstruction: A Puzzle with a Billion Pieces Phillip E. C. Compeau and Pavel A. Pevzner Outline I. Problem II. Two Historical Detours III.Example IV.The Mathematics of DNA Sequencing V.Complications
More informationGraph Algorithms in Bioinformatics
Graph Algorithms in Bioinformatics Computational Biology IST Ana Teresa Freitas 2015/2016 Sequencing Clone-by-clone shotgun sequencing Human Genome Project Whole-genome shotgun sequencing Celera Genomics
More informationDNA Fragment Assembly
Algorithms in Bioinformatics Sami Khuri Department of Computer Science San José State University San José, California, USA khuri@cs.sjsu.edu www.cs.sjsu.edu/faculty/khuri DNA Fragment Assembly Overlap
More information10/15/2009 Comp 590/Comp Fall
Lecture 13: Graph Algorithms Study Chapter 8.1 8.8 10/15/2009 Comp 590/Comp 790-90 Fall 2009 1 The Bridge Obsession Problem Find a tour crossing every bridge just once Leonhard Euler, 1735 Bridges of Königsberg
More informationDNA Sequencing The Shortest Superstring & Traveling Salesman Problems Sequencing by Hybridization
Eulerian & Hamiltonian Cycle Problems DNA Sequencing The Shortest Superstring & Traveling Salesman Problems Sequencing by Hybridization The Bridge Obsession Problem Find a tour crossing every bridge just
More informationSequence Assembly. BMI/CS 576 Mark Craven Some sequencing successes
Sequence Assembly BMI/CS 576 www.biostat.wisc.edu/bmi576/ Mark Craven craven@biostat.wisc.edu Some sequencing successes Yersinia pestis Cannabis sativa The sequencing problem We want to determine the identity
More informationAlgorithms for Bioinformatics
Adapted from slides by Alexandru Tomescu, Leena Salmela and Veli Mäkinen, which are partly from http://bix.ucsd.edu/bioalgorithms/slides.php 58670 Algorithms for Bioinformatics Lecture 5: Graph Algorithms
More information10/8/13 Comp 555 Fall
10/8/13 Comp 555 Fall 2013 1 Find a tour crossing every bridge just once Leonhard Euler, 1735 Bridges of Königsberg 10/8/13 Comp 555 Fall 2013 2 Find a cycle that visits every edge exactly once Linear
More informationCSCI2950-C Lecture 4 DNA Sequencing and Fragment Assembly
CSCI2950-C Lecture 4 DNA Sequencing and Fragment Assembly Ben Raphael Sept. 22, 2009 http://cs.brown.edu/courses/csci2950-c/ l-mer composition Def: Given string s, the Spectrum ( s, l ) is unordered multiset
More informationBioinformatics-themed projects in Discrete Mathematics
Bioinformatics-themed projects in Discrete Mathematics Art Duval University of Texas at El Paso Joint Mathematics Meeting MAA Contributed Paper Session on Discrete Mathematics in the Undergraduate Curriculum
More informationRead Mapping. de Novo Assembly. Genomics: Lecture #2 WS 2014/2015
Mapping de Novo Assembly Institut für Medizinische Genetik und Humangenetik Charité Universitätsmedizin Berlin Genomics: Lecture #2 WS 2014/2015 Today Genome assembly: the basics Hamiltonian and Eulerian
More informationDNA Fragment Assembly
SIGCSE 009 Algorithms in Bioinformatics Sami Khuri Department of Computer Science San José State University San José, California, USA khuri@cs.sjsu.edu www.cs.sjsu.edu/faculty/khuri DNA Fragment Assembly
More informationby the Genevestigator program (www.genevestigator.com). Darker blue color indicates higher gene expression.
Figure S1. Tissue-specific expression profile of the genes that were screened through the RHEPatmatch and root-specific microarray filters. The gene expression profile (heat map) was drawn by the Genevestigator
More informationSequence Assembly Required!
Sequence Assembly Required! 1 October 3, ISMB 20172007 1 Sequence Assembly Genome Sequenced Fragments (reads) Assembled Contigs Finished Genome 2 Greedy solution is bounded 3 Typical assembly strategy
More informationBMI/CS 576 Fall 2015 Midterm Exam
BMI/CS 576 Fall 2015 Midterm Exam Prof. Colin Dewey Tuesday, October 27th, 2015 11:00am-12:15pm Name: KEY Write your answers on these pages and show your work. You may use the back sides of pages as necessary.
More informationde novo assembly Simon Rasmussen 36626: Next Generation Sequencing analysis DTU Bioinformatics Next Generation Sequencing Analysis
de novo assembly Simon Rasmussen 36626: Next Generation Sequencing analysis DTU Bioinformatics 27626 - Next Generation Sequencing Analysis Generalized NGS analysis Data size Application Assembly: Compare
More informationGraph Algorithms in Bioinformatics
Graph Algorithms in Bioinformatics Bioinformatics: Issues and Algorithms CSE 308-408 Fall 2007 Lecture 13 Lopresti Fall 2007 Lecture 13-1 - Outline Introduction to graph theory Eulerian & Hamiltonian Cycle
More informationAlgorithms for Bioinformatics
Adapted from slides by Alexandru Tomescu, Leena Salmela and Veli Mäkinen, which are partly from http://bix.ucsd.edu/bioalgorithms/slides.php 582670 Algorithms for Bioinformatics Lecture 3: Graph Algorithms
More informationDetecting Superbubbles in Assembly Graphs. Taku Onodera (U. Tokyo)! Kunihiko Sadakane (NII)! Tetsuo Shibuya (U. Tokyo)!
Detecting Superbubbles in Assembly Graphs Taku Onodera (U. Tokyo)! Kunihiko Sadakane (NII)! Tetsuo Shibuya (U. Tokyo)! de Bruijn Graph-based Assembly Reads (substrings of original DNA sequence) de Bruijn
More informationPyramidal and Chiral Groupings of Gold Nanocrystals Assembled Using DNA Scaffolds
Pyramidal and Chiral Groupings of Gold Nanocrystals Assembled Using DNA Scaffolds February 27, 2009 Alexander Mastroianni, Shelley Claridge, A. Paul Alivisatos Department of Chemistry, University of California,
More informationBioinformatics: Fragment Assembly. Walter Kosters, Universiteit Leiden. IPA Algorithms&Complexity,
Bioinformatics: Fragment Assembly Walter Kosters, Universiteit Leiden IPA Algorithms&Complexity, 29.6.2007 www.liacs.nl/home/kosters/ 1 Fragment assembly Problem We study the following problem from bioinformatics:
More informationAccelerating Genome Assembly with Power8
Accelerating enome Assembly with Power8 Seung-Jong Park, Ph.D. School of EECS, CCT, Louisiana State University Revolutionizing the Datacenter Join the Conversation #OpenPOWERSummit Agenda The enome Assembly
More informationIntroduction to Genome Assembly. Tandy Warnow
Introduction to Genome Assembly Tandy Warnow 2 Shotgun DNA Sequencing DNA target sample SHEAR & SIZE End Reads / Mate Pairs 550bp 10,000bp Not all sequencing technologies produce mate-pairs. Different
More informationGenome Reconstruction: A Puzzle with a Billion Pieces. Phillip Compeau Carnegie Mellon University Computational Biology Department
http://cbd.cmu.edu Genome Reconstruction: A Puzzle with a Billion Pieces Phillip Compeau Carnegie Mellon University Computational Biology Department Eternity II: The Highest-Stakes Puzzle in History Courtesy:
More informationAn Efficient Algorithm for Computing Non-overlapping Inversion and Transposition Distance
An Efficient Algorithm for Computing Non-overlapping Inversion and Transposition Distance Toan Thang Ta, Cheng-Yao Lin and Chin Lung Lu Department of Computer Science National Tsing Hua University, Hsinchu
More informationOmega: an Overlap-graph de novo Assembler for Metagenomics
Omega: an Overlap-graph de novo Assembler for Metagenomics B a h l e l H a i d e r, Ta e - H y u k A h n, B r i a n B u s h n e l l, J u a n j u a n C h a i, A l e x C o p e l a n d, C h o n g l e Pa n
More informationSUPPLEMENTARY INFORMATION. Systematic evaluation of CRISPR-Cas systems reveals design principles for genome editing in human cells
SUPPLEMENTARY INFORMATION Systematic evaluation of CRISPR-Cas systems reveals design principles for genome editing in human cells Yuanming Wang 1,2,7, Kaiwen Ivy Liu 2,7, Norfala-Aliah Binte Sutrisnoh
More information(for more info see:
Genome assembly (for more info see: http://www.cbcb.umd.edu/research/assembly_primer.shtml) Introduction Sequencing technologies can only "read" short fragments from a genome. Reconstructing the entire
More informationTCGR: A Novel DNA/RNA Visualization Technique
TCGR: A Novel DNA/RNA Visualization Technique Donya Quick and Margaret H. Dunham Department of Computer Science and Engineering Southern Methodist University Dallas, Texas 75275 dquick@mail.smu.edu, mhd@engr.smu.edu
More informationI519 Introduction to Bioinformatics, Genome assembly. Yuzhen Ye School of Informatics & Computing, IUB
I519 Introduction to Bioinformatics, 2014 Genome assembly Yuzhen Ye (yye@indiana.edu) School of Informatics & Computing, IUB Contents Genome assembly problem Approaches Comparative assembly The string
More informationAppendix A. Example code output. Chapter 1. Chapter 3
Appendix A Example code output This is a compilation of output from selected examples. Some of these examples requires exernal input from e.g. STDIN, for such examples the interaction with the program
More informationReducing Genome Assembly Complexity with Optical Maps
Reducing Genome Assembly Complexity with Optical Maps AMSC 663 Mid-Year Progress Report 12/13/2011 Lee Mendelowitz Lmendelo@math.umd.edu Advisor: Mihai Pop mpop@umiacs.umd.edu Computer Science Department
More informationRESEARCH TOPIC IN BIOINFORMANTIC
RESEARCH TOPIC IN BIOINFORMANTIC GENOME ASSEMBLY Instructor: Dr. Yufeng Wu Noted by: February 25, 2012 Genome Assembly is a kind of string sequencing problems. As we all know, the human genome is very
More informationPurpose of sequence assembly
Sequence Assembly Purpose of sequence assembly Reconstruct long DNA/RNA sequences from short sequence reads Genome sequencing RNA sequencing for gene discovery Amplicon sequencing But not for transcript
More informationCS 173, Lecture B Introduction to Genome Assembly (using Eulerian Graphs) Tandy Warnow
CS 173, Lecture B Introduction to Genome Assembly (using Eulerian Graphs) Tandy Warnow 2 Shotgun DNA Sequencing DNA target sample SHEAR & SIZE End Reads / Mate Pairs 550bp 10,000bp Not all sequencing technologies
More informationProblem statement. CS267 Assignment 3: Parallelize Graph Algorithms for de Novo Genome Assembly. Spring Example.
CS267 Assignment 3: Problem statement 2 Parallelize Graph Algorithms for de Novo Genome Assembly k-mers are sequences of length k (alphabet is A/C/G/T). An extension is a simple symbol (A/C/G/T/F). The
More informationwarm-up exercise Representing Data Digitally goals for today proteins example from nature
Representing Data Digitally Anne Condon September 6, 007 warm-up exercise pick two examples of in your everyday life* in what media are the is represented? is the converted from one representation to another,
More informationGenome Sequencing Algorithms
Genome Sequencing Algorithms Phillip Compaeu and Pavel Pevzner Bioinformatics Algorithms: an Active Learning Approach Leonhard Euler (1707 1783) William Hamilton (1805 1865) Nicolaas Govert de Bruijn (1918
More information7.36/7.91 recitation. DG Lectures 5 & 6 2/26/14
7.36/7.91 recitation DG Lectures 5 & 6 2/26/14 1 Announcements project specific aims due in a little more than a week (March 7) Pset #2 due March 13, start early! Today: library complexity BWT and read
More informationGeneR. JORGE ARTURO ZEPEDA MARTINEZ LOPEZ HERNANDEZ JOSE FABRICIO. October 6, 2009
GeneR JORGE ARTURO ZEPEDA MARTINEZ LOPEZ HERNANDEZ JOSE FABRICIO. jzepeda@lcg.unam.mx jlopez@lcg.unam.mx October 6, 2009 Abstract GeneR packages allow direct use of nucleotide sequences within R software.
More informationCSCI 1820 Notes. Scribes: tl40. February 26 - March 02, Estimating size of graphs used to build the assembly.
CSCI 1820 Notes Scribes: tl40 February 26 - March 02, 2018 Chapter 2. Genome Assembly Algorithms 2.1. Statistical Theory 2.2. Algorithmic Theory Idury-Waterman Algorithm Estimating size of graphs used
More informationCS681: Advanced Topics in Computational Biology
CS681: Advanced Topics in Computational Biology Can Alkan EA224 calkan@cs.bilkent.edu.tr Week 7 Lectures 2-3 http://www.cs.bilkent.edu.tr/~calkan/teaching/cs681/ Genome Assembly Test genome Random shearing
More informationSOLiD GFF File Format
SOLiD GFF File Format 1 Introduction The GFF file is a text based repository and contains data and analysis results; colorspace calls, quality values (QV) and variant annotations. The inputs to the GFF
More informationMLiB - Mandatory Project 2. Gene finding using HMMs
MLiB - Mandatory Project 2 Gene finding using HMMs Viterbi decoding >NC_002737.1 Streptococcus pyogenes M1 GAS TTGTTGATATTCTGTTTTTTCTTTTTTAGTTTTCCACATGAAAAATAGTTGAAAACAATA GCGGTGTCCCCTTAAAATGGCTTTTCCACAGGTTGTGGAGAACCCAAATTAACAGTGTTA
More informationLOWELL WEEKLY JOURNAL
C C ; Z) C C C ) & C C \ C < 8) 6 7 $ ; < < 6 & q ; $ 6 8 \ q C q 5 6 8 C C 5 5 \ 8 5 3 CC C q ; Q ; & q < C C C < 53 \ C C C C C C C C C C C C 8 C 8 C zz 8 ; C C _ < C 8 Q C C C 6 X 9 C Q C C C C C C
More informationde novo assembly Rayan Chikhi Pennsylvania State University Workshop On Genomics - Cesky Krumlov - January /73
1/73 de novo assembly Rayan Chikhi Pennsylvania State University Workshop On Genomics - Cesky Krumlov - January 2014 2/73 YOUR INSTRUCTOR IS.. - Postdoc at Penn State, USA - PhD at INRIA / ENS Cachan,
More information2 41L Tag- AA GAA AAA ATA AAA GCA TTA RYA GAA ATT TGT RMW GAR C K65 Tag- A AAT CCA TAC AAT ACT CCA GTA TTT GCY ATA AAG AA
176 SUPPLEMENTAL TABLES 177 Table S1. ASPE Primers for HIV-1 group M subtype B Primer no Type a Sequence (5'-3') Tag ID b Position c 1 M41 Tag- AA GAA AAA ATA AAA GCA TTA RYA GAA ATT TGT RMW GAR A d 45
More information1. R. Durbin, S. Eddy, A. Krogh und G. Mitchison: Biological sequence analysis, Cambridge, 1998
7 Multiple Sequence Alignment The exposition was prepared by Clemens Gröpl, based on earlier versions by Daniel Huson, Knut Reinert, and Gunnar Klau. It is based on the following sources, which are all
More informationReducing Genome Assembly Complexity with Optical Maps Mid-year Progress Report
Reducing Genome Assembly Complexity with Optical Maps Mid-year Progress Report Lee Mendelowitz LMendelo@math.umd.edu Advisor: Dr. Mihai Pop Computer Science Department Center for Bioinformatics and Computational
More information02-711/ Computational Genomics and Molecular Biology Fall 2016
Literature assignment 2 Due: Nov. 3 rd, 2016 at 4:00pm Your name: Article: Phillip E C Compeau, Pavel A. Pevzner, Glenn Tesler. How to apply de Bruijn graphs to genome assembly. Nature Biotechnology 29,
More informationBLAST & Genome assembly
BLAST & Genome assembly Solon P. Pissis Tomáš Flouri Heidelberg Institute for Theoretical Studies May 15, 2014 1 BLAST What is BLAST? The algorithm 2 Genome assembly De novo assembly Mapping assembly 3
More informationSequencing. Short Read Alignment. Sequencing. Paired-End Sequencing 6/10/2010. Tobias Rausch 7 th June 2010 WGS. ChIP-Seq. Applied Biosystems.
Sequencing Short Alignment Tobias Rausch 7 th June 2010 WGS RNA-Seq Exon Capture ChIP-Seq Sequencing Paired-End Sequencing Target genome Fragments Roche GS FLX Titanium Illumina Applied Biosystems SOLiD
More informationHP22.1 Roth Random Primer Kit A für die RAPD-PCR
HP22.1 Roth Random Kit A für die RAPD-PCR Kit besteht aus 20 Einzelprimern, jeweils aufgeteilt auf 2 Reaktionsgefäße zu je 1,0 OD Achtung: Angaben beziehen sich jeweils auf ein Reaktionsgefäß! Sequenz
More informationEulerian Tours and Fleury s Algorithm
Eulerian Tours and Fleury s Algorithm CSE21 Winter 2017, Day 12 (B00), Day 8 (A00) February 8, 2017 http://vlsicad.ucsd.edu/courses/cse21-w17 Vocabulary Path (or walk): describes a route from one vertex
More informationSAPLING: Suffix Array Piecewise Linear INdex for Genomics Michael Kirsche
SAPLING: Suffix Array Piecewise Linear INdex for Genomics Michael Kirsche mkirsche@jhu.edu StringBio 2018 Outline Substring Search Problem Caching and Learned Data Structures Methods Results Ongoing work
More informationGenome 373: Genome Assembly. Doug Fowler
Genome 373: Genome Assembly Doug Fowler What are some of the things we ve seen we can do with HTS data? We ve seen that HTS can enable a wide variety of analyses ranging from ID ing variants to genome-
More informationComputational Genomics and Molecular Biology, Fall
Computational Genomics and Molecular Biology, Fall 2015 1 Sequence Alignment Dannie Durand Pairwise Sequence Alignment The goal of pairwise sequence alignment is to establish a correspondence between the
More informationAlgorithms for Computational Biology. String Distance Measures
Algorithms for Computational Biology Zsuzsanna Lipták Masters in Molecular and Medical Biotechnology a.a. 2015/16, fall term String Distance Measures Similarity vs. distance Two ways of measuring the same
More informationPractical Bioinformatics for Life Scientists. Week 4, Lecture 8. István Albert Bioinformatics Consulting Center Penn State
Practical Bioinformatics for Life Scientists Week 4, Lecture 8 István Albert Bioinformatics Consulting Center Penn State Reminder Before any serious work re-check the documentation for small but essential
More informationSupporting Information
Copyright WILEY VCH Verlag GmbH & Co. KGaA, 69469 Weinheim, Germany, 2015. Supporting Information for Small, DOI: 10.1002/smll.201501370 A Compact DNA Cube with Side Length 10 nm Max B. Scheible, Luvena
More informationDNA Fragment Assembly Algorithms: Toward a Solution for Long Repeats
San Jose State University SJSU ScholarWorks Master's Projects Master's Theses and Graduate Research 2008 DNA Fragment Assembly Algorithms: Toward a Solution for Long Repeats Ching Li San Jose State University
More informationBLAST & Genome assembly
BLAST & Genome assembly Solon P. Pissis Tomáš Flouri Heidelberg Institute for Theoretical Studies November 17, 2012 1 Introduction Introduction 2 BLAST What is BLAST? The algorithm 3 Genome assembly De
More information1. R. Durbin, S. Eddy, A. Krogh und G. Mitchison: Biological sequence analysis, Cambridge, 1998
7 Multiple Sequence Alignment The exposition was prepared by Clemens GrÃP pl, based on earlier versions by Daniel Huson, Knut Reinert, and Gunnar Klau. It is based on the following sources, which are all
More information6 Anhang. 6.1 Transgene Su(var)3-9-Linien. P{GS.ry + hs(su(var)3-9)egfp} 1 I,II,III,IV 3 2I 3 3 I,II,III 3 4 I,II,III 2 5 I,II,III,IV 3
6.1 Transgene Su(var)3-9-n P{GS.ry + hs(su(var)3-9)egfp} 1 I,II,III,IV 3 2I 3 3 I,II,III 3 4 I,II,II 5 I,II,III,IV 3 6 7 I,II,II 8 I,II,II 10 I,II 3 P{GS.ry + UAS(Su(var)3-9)EGFP} A AII 3 B P{GS.ry + (10.5kbSu(var)3-9EGFP)}
More informationA Genome Assembly Algorithm Designed for Single-Cell Sequencing
SPAdes A Genome Assembly Algorithm Designed for Single-Cell Sequencing Bankevich A, Nurk S, Antipov D, et al. SPAdes: a new genome assembly algorithm and its applications to single-cell sequencing. J Comput
More informationMichał Kierzynka et al. Poznan University of Technology. 17 March 2015, San Jose
Michał Kierzynka et al. Poznan University of Technology 17 March 2015, San Jose The research has been supported by grant No. 2012/05/B/ST6/03026 from the National Science Centre, Poland. DNA de novo assembly
More informationDNA Sequence Assembly and Multiple Sequence Alignment by an Eulerian Path Approach
DNA Sequence Assembly and Multiple Sequence Alignment by an Eulerian Path Approach Yu Zhang Department of Mathematics University of Southern California Los Angeles, CA 90089-1113 Phone: 213-821-2231 yuzhang@usc.edu
More informationBiostrings. Martin Morgan Bioconductor / Fred Hutchinson Cancer Research Center Seattle, WA, USA June 2009
Biostrings Martin Morgan Bioconductor / Fred Hutchinson Cancer Research Center Seattle, WA, USA 15-19 June 2009 Biostrings Representation DNA, RNA, amino acid, and general biological strings Manipulation
More informationDNA Sequencing. Overview
BINF 3350, Genomics and Bioinformatics DNA Sequencing Young-Rae Cho Associate Professor Department of Computer Science Baylor University Overview Backgrounds Eulerian Cycles Problem Hamiltonian Cycles
More informationSupplementary Table 1. Data collection and refinement statistics
Supplementary Table 1. Data collection and refinement statistics APY-EphA4 APY-βAla8.am-EphA4 Crystal Space group P2 1 P2 1 Cell dimensions a, b, c (Å) 36.27, 127.7, 84.57 37.22, 127.2, 84.6 α, β, γ (
More informationDarwin: A Genomic Co-processor gives up to 15,000X speedup on long read assembly (To appear in ASPLOS 2018)
Darwin: A Genomic Co-processor gives up to 15,000X speedup on long read assembly (To appear in ASPLOS 2018) Yatish Turakhia EE PhD candidate Stanford University Prof. Bill Dally (Electrical Engineering
More informationEulerian tours. Russell Impagliazzo and Miles Jones Thanks to Janine Tiefenbruck. April 20, 2016
Eulerian tours Russell Impagliazzo and Miles Jones Thanks to Janine Tiefenbruck http://cseweb.ucsd.edu/classes/sp16/cse21-bd/ April 20, 2016 Seven Bridges of Konigsberg Is there a path that crosses each
More informationIntroduction to Python - Python I
Introduction to Python - Python I 1 Assignmet - Python 1 1 Assignmet - Python Load the module for Python 3 with the command module load python3/3.6.0. Open the Python-interpreter with the command python3.
More informationWeighted Finite-State Transducers in Computational Biology
Weighted Finite-State Transducers in Computational Biology Mehryar Mohri Courant Institute of Mathematical Sciences mohri@cims.nyu.edu Joint work with Corinna Cortes (Google Research). 1 This Tutorial
More informationBuilding approximate overlap graphs for DNA assembly using random-permutations-based search.
An algorithm is presented for fast construction of graphs of reads, where an edge between two reads indicates an approximate overlap between the reads. Since the algorithm finds approximate overlaps directly,
More informationPattern Matching. An Introduction to File Globs and Regular Expressions
Pattern Matching An Introduction to File Globs and Regular Expressions Copyright 2006 2009 Stewart Weiss The danger that lies ahead Much to your disadvantage, there are two different forms of patterns
More informationGlobal Alignment. Algorithms in BioInformatics Mandatory Project 1 Magnus Erik Hvass Pedersen (971055) Daimi, University of Aarhus September 2004
1 Introduction Global Alignment Algorithms in BioInformatics Mandatory Project 1 Magnus Erik Hvass Pedersen (971055) Daimi, University of Aarhus September 2004 The purpose of this report is to verify attendance
More informationPattern Matching. An Introduction to File Globs and Regular Expressions. Adapted from Practical Unix and Programming Hunter College
Pattern Matching An Introduction to File Globs and Regular Expressions Adapted from Practical Unix and Programming Hunter College Copyright 2006 2009 Stewart Weiss The danger that lies ahead Much to your
More informationReducing Genome Assembly Complexity with Optical Maps Final Report
Reducing Genome Assembly Complexity with Optical Maps Final Report Lee Mendelowitz LMendelo@math.umd.edu Advisor: Dr. Mihai Pop Computer Science Department Center for Bioinformatics and Computational Biology
More informationGenome Sequencing & Assembly. Slides by Carl Kingsford
Genome Sequencing & Assembly Slides by Carl Kingsford Genome Sequencing ACCGTCCAATTGG...! TGGCAGGTTAACC... E.g. human: 3 billion bases split into 23 chromosomes Main tool of traditional sequencing: DNA
More informationComputational models for bionformatics
Computational models for bionformatics De-novo assembly and alignment-free measures Michele Schimd Department of Information Engineering July 8th, 2015 Michele Schimd (DEI) PostDoc @ DEI July 8th, 2015
More informationReducing Genome Assembly Complexity with Optical Maps
Reducing Genome Assembly Complexity with Optical Maps Lee Mendelowitz LMendelo@math.umd.edu Advisor: Dr. Mihai Pop Computer Science Department Center for Bioinformatics and Computational Biology mpop@umiacs.umd.edu
More informationMore on Strings & Arrays
More on Strings & Arrays 02-201 Indexing Strings Strings work like arrays in some ways: Strings have fixed length. You can find the length of string s with len(s). You can access elements of string s with
More informationCLC Server. End User USER MANUAL
CLC Server End User USER MANUAL Manual for CLC Server 10.0.1 Windows, macos and Linux March 8, 2018 This software is for research purposes only. QIAGEN Aarhus Silkeborgvej 2 Prismet DK-8000 Aarhus C Denmark
More informationarxiv:cs/ v1 [cs.cc] 20 Jul 2005
arxiv:cs/0507052v1 [cs.cc] 20 Jul 2005 Finite automata for testing uniqueness of Eulerian trails Qiang Li T-Life Research Center, Fudan University, Shanghai, China Hui-Min Xie Department of Mathematics,
More informationScalable Solutions for DNA Sequence Analysis
Scalable Solutions for DNA Sequence Analysis Michael Schatz Dec 4, 2009 JHU/UMD Joint Sequencing Meeting The Evolution of DNA Sequencing Year Genome Technology Cost 2001 Venter et al. Sanger (ABI) $300,000,000
More informationDarwin: A Hardware-acceleration Framework for Genomic Sequence Alignment
Darwin: A Hardware-acceleration Framework for Genomic Sequence Alignment Yatish Turakhia EE PhD candidate Stanford University Prof. Bill Dally (Electrical Engineering and Computer Science) Prof. Gill Bejerano
More informationAssembly in the Clouds
Assembly in the Clouds Michael Schatz October 13, 2010 Beyond the Genome Shredded Book Reconstruction Dickens accidentally shreds the first printing of A Tale of Two Cities Text printed on 5 long spools
More informationGPU based Eulerian Assembly of Genomes
GPU based Eulerian Assembly of Genomes A thesis submitted in partial fulfillment of the requirements for the degree of Master of Science at George Mason University By Syed Faraz Mahmood Bachelor of Science
More informationLong Read RNA-seq Mapper
UNIVERSITY OF ZAGREB FACULTY OF ELECTRICAL ENGENEERING AND COMPUTING MASTER THESIS no. 1005 Long Read RNA-seq Mapper Josip Marić Zagreb, February 2015. Table of Contents 1. Introduction... 1 2. RNA Sequencing...
More informationIntroduction and tutorial for SOAPdenovo. Xiaodong Fang Department of Science and BGI May, 2012
Introduction and tutorial for SOAPdenovo Xiaodong Fang fangxd@genomics.org.cn Department of Science and Technology @ BGI May, 2012 Why de novo assembly? Genome is the genetic basis for different phenotypes
More informationComputational Molecular Biology
Computational Molecular Biology Erwin M. Bakker Lecture 2 Materials used from R. Shamir [2] and H.J. Hoogeboom [4]. 1 Molecular Biology Sequences DNA A, T, C, G RNA A, U, C, G Protein A, R, D, N, C E,
More informationR. Reports Menu: 7. Mailing Labels
R. Reports Menu: 7. Mailing Labels Table of Contents Mailing Labels... 3 Individual... 4 All Parcels and Balance Due... 6 Click on R. Reports Menu from the Main Menu and the following window will appear:
More informationTitle:- Instructions to run GS Assembler and Mapper Course # BIOL 8803 Special Topic on Computational Genomics Assembly Group
Title:- Instructions to run GS Assembler and Mapper Course # BIOL 8803 Special Topic on Computational Genomics Assembly Group Contents 1. Genome Assembly... 3 1.0. Data and Projects... 3 1.1. GS De Novo
More informationProgramming Applications. What is Computer Programming?
Programming Applications What is Computer Programming? An algorithm is a series of steps for solving a problem A programming language is a way to express our algorithm to a computer Programming is the
More informationDescription of a genome assembler: CABOG
Theo Zimmermann Description of a genome assembler: CABOG CABOG (Celera Assembler with the Best Overlap Graph) is an assembler built upon the Celera Assembler, which, at first, was designed for Sanger sequencing,
More informationWSSP-10 Chapter 7 BLASTN: DNA vs DNA searches
WSSP-10 Chapter 7 BLASTN: DNA vs DNA searches 4-3 DSAP: BLASTn Page p. 7-1 NCBI BLAST Home Page p. 7-1 NCBI BLASTN search page p. 7-2 Copy sequence from DSAP or wave form program p. 7-2 Choose a database
More informationPre-processing and quality control of sequence data. Barbera van Schaik KEBB - Bioinformatics Laboratory
Pre-processing and quality control of sequence data Barbera van Schaik KEBB - Bioinformatics Laboratory b.d.vanschaik@amc.uva.nl Topic: quality control and prepare data for the interesting stuf Keep Throw
More informationA THEORETICAL ANALYSIS OF SCALABILITY OF THE PARALLEL GENOME ASSEMBLY ALGORITHMS
A THEORETICAL ANALYSIS OF SCALABILITY OF THE PARALLEL GENOME ASSEMBLY ALGORITHMS Munib Ahmed, Ishfaq Ahmad Department of Computer Science and Engineering, University of Texas At Arlington, Arlington, Texas
More information