Relationship Between BED and WIG Formats

Size: px
Start display at page:

Download "Relationship Between BED and WIG Formats"

Transcription

1 Relationship Between BED and WIG Formats Pete E. Pascuzzi July 2, 2015 This example will illustrate the similarities and differences between the various ways to represent ranged data in R. In bioinformatics, ranged data is exemplified by any feature that can map to a position in a specific genome, e.g. annotated genes, DNA methylation sites, or mapped RNA-seq data. Ranged data shoud have start and end coordinates in a specific genome and a chromosome number. Ideally a specific build for that genome should be indicated as well, perhaps in leading lines in a file or a data field reserved for metadata. Below, I am going create a simple data frame that has some ranged data similar to short reads from an NGS experiment. I am going to make several data sets that are derived from the original data frame. Why shoud you do this? Because, to take advantage of some functions in Bioconductor, the data will often have to be stored as a particular class. For example coverage will only work on data stored as an IRange, including classes like IRanges or Views. Similarly, slice will only function a Rle object. Finally, there are several standard file formats that are used to display data on genome browsers, including BED and WIG. I will illustrate how you can create files in this format as well. > ## Create data frame with short reads in 2 steps > shortread.df <- data.frame(seq="chr4", start=c(6, 11, 21, 26, 41, 51, 56, 61, + 66, 76, 151, 156)) > ## make them all the same length > shortread.df$end <- shortread.df$start + 49 > print(shortread.df) seq start end 1 chr chr chr chr chr chr chr chr chr chr chr chr > ## can we calculate the coverage from the data frame? No! > ## shortread.cov <- coverage(shortread.df$start, shortread.df$end) > ## create IRanges object from short read and give a name that > ## indicates chr and read number. 1

2 > shortread.ir <- IRanges(start=shortread.df$start, end= + shortread.df$end, names=paste("chr4", + 1:nrow(shortread.df), sep="_")) > print(shortread.ir) IRanges of length 12 [1] chr4_1 [2] chr4_2 [3] chr4_3 [4] chr4_4 [5] chr4_ [8] chr4_8 [9] chr4_9 [10] chr4_10 [11] chr4_11 [12] chr4_12 > ## Coverage will work now > shortread.cov <- coverage(shortread.ir) > print(shortread.cov) integer-rle of length 205 with 18 runs Lengths: Values : > ## we can slice-out regions in our data where the coverage > ## is above, below or between a specified range. The result is an > ## IRanges object. > my.peaks <- slice(shortread.cov, lower=2, rangesonly=t) > names(my.peaks) <- paste("chr4_peak",1:length(my.peaks),sep="_") > print(my.peaks) IRanges of length 2 [1] chr4_peak_1 [2] chr4_peak_2 > ## What if we wanted to count the number of reads mapping to a > ## specific gene? > my.gene <- IRanges(start=30, end=50, names="my.gene") > print(my.gene) IRanges of length 1 [1] my.gene > my.gene.count <- countoverlaps(my.gene, shortread.ir) > print(my.gene.count) 2

3 my.gene 5 > ## You could also calculate the coverage across the gene, > ## but coverage is NOT the way you should handle RNA-seq data > ## for differential expression! > my.gene.cov <- mean(shortread.cov[my.gene]) > print(my.gene.cov) [1] > ## Can we do this on a vector of gene start and end positions? > another.gene <- IRanges(start=100, end=200, names="another_gene") > my.genes <- c(my.gene, another.gene) > print(my.genes) IRanges of length 2 [1] my.gene [2] another_gene > my.genes.cov <- mean(shortread.cov[my.genes[1:2]]) > print(my.genes.cov) [1] > ## No, we only get a single value, not two values. The value is > ## different than the coverage of the first gene, so this must > ## be the average coverage for both genes combined. > ## To do multiple genes, we need to use lapply. We can split > ## the IRanges object based on its names > genes.ir.list <- split(my.genes, f=names(my.genes)) > my.genes.cov <- unlist(lapply(my.genes,function(x)(mean(shortread.cov[x])))) > print(my.genes.cov) my.gene another_gene > ## Now, format data for BED file so that the reads can be > ## displayed on a genome browser. Remember the zero-based > ## indexing and remember to convert back if you want to use data > ## derived from a BED file in R! > shortreads.bed <- data.frame(chrom="chr4", chromstart= + shortread.df$start - 1, chromend= + shortread.df$end) > bed.header <- "track type=bed name=short_reads description=simulated" > write(bed.header, file="shortreads.bed", ncolumns=1) > write.table(shortreads.bed, file="shortreads.bed", append=t, sep="\t", + quote=f, row.names=f, col.names=f) > peaks.bed <- data.frame(chrom="chr4", chromstart= 3

4 + start(my.peaks) - 1, chromend= + end(my.peaks)) > bed.header <- "track type=bed name=short_reads description=simulated" > write(bed.header, file="peaks.bed", ncolumns=1) > write.table(peaks.bed, file="peaks.bed", append=t, sep="\t", + quote=f, row.names=f, col.names=f) > ## We can also produce a WIG file easily from the Rle object > ## produce by coverage. Probably some way to do this from the > ## data frame but this way is easy. We can calculate the positions > ## where our values change from the runlengths, but we need to add > ## the first position to the runlength vectors to get accurate > ## positions on the chromosome. Also need to add a runvalue of zero > ## to the end of the runvalues vector to let the WIG track fall > ## back to zero. > shortreads.wig <- data.frame(position=cumsum(c(1, runlength( + shortread.cov))), values=c(runvalue( + shortread.cov), 0)) > wig.header <- "track type=wiggle_0 name=shortreads description=simulated" > write(wig.header, file="shortreads.wig", ncolumns=1) > my.declare <- "variablestep chrom=chr4" > write(my.declare, file="shortreads.wig", ncolumns=1, append=t) > write.table(shortreads.wig, file="shortreads.wig", append=t, sep="\t", + quote=f,row.names=f,col.names=f) > ## Now we can plot some of this data to see how they compare > #pdf(file="example.pdf",w=6,h=6) > par(lend="butt") > plot(c(1,250),y=c(0,10),type="n", main="", xlab="position", + ylab="coverage") > segments(start(shortread.ir), c(1:7,1:3,1:2), end(shortread.ir), + c(1:7,1:3,1:2), lwd=4) > segments(peaks.bed$chromstart + 1, 9, peaks.bed$chromend, 9, lwd=4, col="blue") > points(shortreads.wig, type="s", lwd=2, col="red") > abline(v=seq(from=0, to=250, by=10), lty=2) > legend("right", legend=c("read", "wig", "peak"), horiz=f, lwd=2, col=c("black", "red", "blue"), bty="o > #dev.off() 4

5 coverage read wig peak position 5

From genomic regions to biology

From genomic regions to biology Before we start: 1. Log into tak (step 0 on the exercises) 2. Go to your lab space and create a folder for the class (see separate hand out) 3. Connect to your lab space through the wihtdata network and

More information

Practical 4: ChIP-seq Peak calling

Practical 4: ChIP-seq Peak calling Practical 4: ChIP-seq Peak calling Shamith Samarajiiwa, Dora Bihary September 2017 Contents 1 Calling ChIP-seq peaks using MACS2 1 1.1 Assess the quality of the aligned datasets..................................

More information

ChIP-seq (NGS) Data Formats

ChIP-seq (NGS) Data Formats ChIP-seq (NGS) Data Formats Biological samples Sequence reads SRA/SRF, FASTQ Quality control SAM/BAM/Pileup?? Mapping Assembly... DE Analysis Variant Detection Peak Calling...? Counts, RPKM VCF BED/narrowPeak/

More information

Bioinformatics in next generation sequencing projects

Bioinformatics in next generation sequencing projects Bioinformatics in next generation sequencing projects Rickard Sandberg Assistant Professor Department of Cell and Molecular Biology Karolinska Institutet March 2011 Once sequenced the problem becomes computational

More information

Chip-seq data analysis: from quality check to motif discovery and more Lausanne, 4-8 April 2016

Chip-seq data analysis: from quality check to motif discovery and more Lausanne, 4-8 April 2016 Chip-seq data analysis: from quality check to motif discovery and more Lausanne, 4-8 April 2016 ChIP-partitioning tool: shape based analysis of transcription factor binding tags Sunil Kumar, Romain Groux

More information

A short Introduction to UCSC Genome Browser

A short Introduction to UCSC Genome Browser A short Introduction to UCSC Genome Browser Elodie Girard, Nicolas Servant Institut Curie/INSERM U900 Bioinformatics, Biostatistics, Epidemiology and computational Systems Biology of Cancer 1 Why using

More information

IRanges and GenomicRanges An introduction

IRanges and GenomicRanges An introduction IRanges and GenomicRanges An introduction Kasper Daniel Hansen CSAMA, Brixen 2011 1 / 28 Why you should care IRanges and GRanges are data structures I use often to solve a variety of

More information

Getting Started. April Strand Life Sciences, Inc All rights reserved.

Getting Started. April Strand Life Sciences, Inc All rights reserved. Getting Started April 2015 Strand Life Sciences, Inc. 2015. All rights reserved. Contents Aim... 3 Demo Project and User Interface... 3 Downloading Annotations... 4 Project and Experiment Creation... 6

More information

Easy visualization of the read coverage using the CoverageView package

Easy visualization of the read coverage using the CoverageView package Easy visualization of the read coverage using the CoverageView package Ernesto Lowy European Bioinformatics Institute EMBL June 13, 2018 > options(width=40) > library(coverageview) 1 Introduction This

More information

ChIP-seq hands-on practical using Galaxy

ChIP-seq hands-on practical using Galaxy ChIP-seq hands-on practical using Galaxy In this exercise we will cover some of the basic NGS analysis steps for ChIP-seq using the Galaxy framework: Quality control Mapping of reads using Bowtie2 Peak-calling

More information

Integrative Genomics Viewer. Prat Thiru

Integrative Genomics Viewer. Prat Thiru Integrative Genomics Viewer Prat Thiru 1 Overview User Interface Basics Browsing the Data Data Formats IGV Tools Demo Outline Based on ISMB 2010 Tutorial by Robinson and Thorvaldsdottir 2 Why IGV? IGV

More information

Advanced UCSC Browser Functions

Advanced UCSC Browser Functions Advanced UCSC Browser Functions Dr. Thomas Randall tarandal@email.unc.edu bioinformatics.unc.edu UCSC Browser: genome.ucsc.edu Overview Custom Tracks adding your own datasets Utilities custom tools for

More information

Ranges (and Data Integration)

Ranges (and Data Integration) Ranges (and Data Integration) Martin Morgan 1 Fred Hutchinson Cancer Research Center Seattle, WA 20 November 2013 1 mtmorgan@fhcrc.org Introduction Importance of range concepts: conceptually... Genomic

More information

Analyzing ChIP- Seq Data in Galaxy

Analyzing ChIP- Seq Data in Galaxy Analyzing ChIP- Seq Data in Galaxy Lauren Mills RISS ABSTRACT Step- by- step guide to basic ChIP- Seq analysis using the Galaxy platform. Table of Contents Introduction... 3 Links to helpful information...

More information

!"#$%&$'()#$*)+,-./).01"0#,23+3,303456"6,&((46,7$+-./&((468,

!#$%&$'()#$*)+,-./).010#,23+3,3034566,&((46,7$+-./&((468, !"#$%&$'()#$*)+,-./).01"0#,23+3,303456"6,&((46,7$+-./&((468, 9"(1(02)1+(',:.;.4(*.',?9@A,!."2.4B.'#A,C(;.

More information

W ASHU E PI G ENOME B ROWSER

W ASHU E PI G ENOME B ROWSER W ASHU E PI G ENOME B ROWSER Keystone Symposium on DNA and RNA Methylation January 23 rd, 2018 Fairmont Hotel Vancouver, Vancouver, British Columbia, Canada Presenter: Renee Sears and Josh Jang Tutorial

More information

Introduction to Matlab. Sasha Lukyanov, 2018 Xenopus Bioinformatics Workshop, MBL, Woods Hole

Introduction to Matlab. Sasha Lukyanov, 2018 Xenopus Bioinformatics Workshop, MBL, Woods Hole Introduction to Matlab Sasha Lukyanov, 2018 Xenopus Bioinformatics Workshop, MBL, Woods Hole MATLAB Environment This image cannot currently be displayed. What do we use? Help? If you know the name of the

More information

Using the GenomicFeatures package

Using the GenomicFeatures package Using the GenomicFeatures package Marc Carlson Fred Hutchinson Cancer Research Center December 10th 2010 Bioconductor Annotation Packages: a bigger picture PLATFORM PKGS GENE ID HOMOLOGY PKGS GENE ID ORG

More information

Genome representa;on concepts. Week 12, Lecture 24. Coordinate systems. Genomic coordinates brief overview 11/13/14

Genome representa;on concepts. Week 12, Lecture 24. Coordinate systems. Genomic coordinates brief overview 11/13/14 2014 - BMMB 852D: Applied Bioinforma;cs Week 12, Lecture 24 István Albert Biochemistry and Molecular Biology and Bioinforma;cs Consul;ng Center Penn State Genome representa;on concepts At the simplest

More information

Useful software utilities for computational genomics. Shamith Samarajiwa CRUK Autumn School in Bioinformatics September 2017

Useful software utilities for computational genomics. Shamith Samarajiwa CRUK Autumn School in Bioinformatics September 2017 Useful software utilities for computational genomics Shamith Samarajiwa CRUK Autumn School in Bioinformatics September 2017 Overview Search and download genomic datasets: GEOquery, GEOsearch and GEOmetadb,

More information

- 1 - Web page:

- 1 - Web page: J-Circos Manual 2014-11-10 J-Circos: A Java Graphic User Interface for Circos Plot Jiyuan An 1, John Lai 1, Atul Sajjanhar 2, Jyotsna Batra 1,Chenwei Wang 1 and Colleen C Nelson 1 1 Australian Prostate

More information

Working with ChIP-Seq Data in R/Bioconductor

Working with ChIP-Seq Data in R/Bioconductor Working with ChIP-Seq Data in R/Bioconductor Suraj Menon, Tom Carroll, Shamith Samarajiwa September 3, 2014 Contents 1 Introduction 1 2 Working with aligned data 1 2.1 Reading in data......................................

More information

Package polyphemus. February 15, 2013

Package polyphemus. February 15, 2013 Package polyphemus February 15, 2013 Type Package Title Genome wide analysis of RNA Polymerase II-based ChIP Seq data. Version 0.3.4 Date 2010-08-11 Author Martial Sankar, supervised by Marco Mendoza and

More information

ChIP-seq hands-on practical using Galaxy

ChIP-seq hands-on practical using Galaxy ChIP-seq hands-on practical using Galaxy In this exercise we will cover some of the basic NGS analysis steps for ChIP-seq using the Galaxy framework: Quality control Mapping of reads using Bowtie2 Peak-calling

More information

Protocol: peak-calling for ChIP-seq data / segmentation analysis for histone modification data

Protocol: peak-calling for ChIP-seq data / segmentation analysis for histone modification data Protocol: peak-calling for ChIP-seq data / segmentation analysis for histone modification data Table of Contents Protocol: peak-calling for ChIP-seq data / segmentation analysis for histone modification

More information

Handling genomic data using Bioconductor II: GenomicRanges and GenomicFeatures

Handling genomic data using Bioconductor II: GenomicRanges and GenomicFeatures Handling genomic data using Bioconductor II: GenomicRanges and GenomicFeatures Motivating examples Genomic Features (e.g., genes, exons, CpG islands) on the genome are often represented as intervals, e.g.,

More information

Simple karyotypes visualization using chromdraw Jan Janecka Research group Plant Cytogenomics CEITEC, Masaryk University of Brno

Simple karyotypes visualization using chromdraw Jan Janecka Research group Plant Cytogenomics CEITEC, Masaryk University of Brno Simple karyotypes visualization using chromdraw Jan Janecka Research group Plant Cytogenomics CEITEC, Masaryk University of Brno This document shows the use of the chromdraw R package for linear and circular

More information

SPAR outputs and report page

SPAR outputs and report page SPAR outputs and report page Landing results page (full view) Landing results / outputs page (top) Input files are listed Job id is shown Download all tables, figures, tracks as zip Percentage of reads

More information

Tutorial. RNA-Seq Analysis of Breast Cancer Data. Sample to Insight. November 21, 2017

Tutorial. RNA-Seq Analysis of Breast Cancer Data. Sample to Insight. November 21, 2017 RNA-Seq Analysis of Breast Cancer Data November 21, 2017 Sample to Insight QIAGEN Aarhus Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 www.qiagenbioinformatics.com AdvancedGenomicsSupport@qiagen.com

More information

A quick introduction to GRanges and GRangesList objects

A quick introduction to GRanges and GRangesList objects A quick introduction to GRanges and GRangesList objects Hervé Pagès hpages@fredhutch.org Michael Lawrence lawrence.michael@gene.com July 2015 GRanges objects The GRanges() constructor GRanges accessors

More information

featuredb storing and querying genomic annotation

featuredb storing and querying genomic annotation featuredb storing and querying genomic annotation Work in progress Arne Müller Preclinical Safety Informatics, Novartis, December 14th 2012 Acknowledgements: Florian Hahne + Bioconductor Community featuredb

More information

ChIP-seq practical: peak detection and peak annotation. Mali Salmon-Divon Remco Loos Myrto Kostadima

ChIP-seq practical: peak detection and peak annotation. Mali Salmon-Divon Remco Loos Myrto Kostadima ChIP-seq practical: peak detection and peak annotation Mali Salmon-Divon Remco Loos Myrto Kostadima March 2012 Introduction The goal of this hands-on session is to perform some basic tasks in the analysis

More information

RNA-Seq in Galaxy: Tuxedo protocol. Igor Makunin, UQ RCC, QCIF

RNA-Seq in Galaxy: Tuxedo protocol. Igor Makunin, UQ RCC, QCIF RNA-Seq in Galaxy: Tuxedo protocol Igor Makunin, UQ RCC, QCIF Acknowledgments Genomics Virtual Lab: gvl.org.au Galaxy for tutorials: galaxy-tut.genome.edu.au Galaxy Australia: galaxy-aust.genome.edu.au

More information

segmentseq: methods for detecting methylation loci and differential methylation

segmentseq: methods for detecting methylation loci and differential methylation segmentseq: methods for detecting methylation loci and differential methylation Thomas J. Hardcastle October 13, 2015 1 Introduction This vignette introduces analysis methods for data from high-throughput

More information

Part 1: How to use IGV to visualize variants

Part 1: How to use IGV to visualize variants Using IGV to identify true somatic variants from the false variants http://www.broadinstitute.org/igv A FAQ, sample files and a user guide are available on IGV website If you use IGV in your publication:

More information

Genetics 211 Genomics Winter 2014 Problem Set 4

Genetics 211 Genomics Winter 2014 Problem Set 4 Genomics - Part 1 due Friday, 2/21/2014 by 9:00am Part 2 due Friday, 3/7/2014 by 9:00am For this problem set, we re going to use real data from a high-throughput sequencing project to look for differential

More information

Counting with summarizeoverlaps

Counting with summarizeoverlaps Counting with summarizeoverlaps Valerie Obenchain Edited: August 2012; Compiled: August 23, 2013 Contents 1 Introduction 1 2 A First Example 1 3 Counting Modes 2 4 Counting Features 3 5 pasilla Data 6

More information

Introduction to Read Alignment. UCD Genome Center Bioinformatics Core Tuesday 15 September 2015

Introduction to Read Alignment. UCD Genome Center Bioinformatics Core Tuesday 15 September 2015 Introduction to Read Alignment UCD Genome Center Bioinformatics Core Tuesday 15 September 2015 From reads to molecules Why align? Individual A Individual B ATGATAGCATCGTCGGGTGTCTGCTCAATAATAGTGCCGTATCATGCTGGTGTTATAATCGCCGCATGACATGATCAATGG

More information

segmentseq: methods for detecting methylation loci and differential methylation

segmentseq: methods for detecting methylation loci and differential methylation segmentseq: methods for detecting methylation loci and differential methylation Thomas J. Hardcastle October 30, 2018 1 Introduction This vignette introduces analysis methods for data from high-throughput

More information

Package cleanupdtseq

Package cleanupdtseq Package cleanupdtseq August 2, 2013 Type Package Title This package classifies putative polyadenylation sites as true or false/internally oligodt primed. Version 0.99.3 Date 2013-07-22 Author Sarah Sheppard,

More information

m6aviewer Version Documentation

m6aviewer Version Documentation m6aviewer Version 1.6.0 Documentation Contents 1. About 2. Requirements 3. Launching m6aviewer 4. Running Time Estimates 5. Basic Peak Calling 6. Running Modes 7. Multiple Samples/Sample Replicates 8.

More information

Introduction to Galaxy

Introduction to Galaxy Introduction to Galaxy Dr Jason Wong Prince of Wales Clinical School Introductory bioinformatics for human genomics workshop, UNSW Day 1 Thurs 28 th January 2016 Overview What is Galaxy? Description of

More information

Package dmrseq. September 14, 2018

Package dmrseq. September 14, 2018 Type Package Package dmrseq September 14, 2018 Title Detection and inference of differentially methylated regions from Whole Genome Bisulfite Sequencing Version 1.1.15 Author Keegan Korthauer ,

More information

Differential Expression Analysis at PATRIC

Differential Expression Analysis at PATRIC Differential Expression Analysis at PATRIC The following step- by- step workflow is intended to help users learn how to upload their differential gene expression data to their private workspace using Expression

More information

KGBassembler Manual. A Karyotype-based Genome Assembler for Brassicaceae Species. Version 1.2. August 16 th, 2012

KGBassembler Manual. A Karyotype-based Genome Assembler for Brassicaceae Species. Version 1.2. August 16 th, 2012 KGBassembler Manual A Karyotype-based Genome Assembler for Brassicaceae Species Version 1.2 August 16 th, 2012 Authors: Chuang Ma, Hao Chen, Mingming Xin, Ruolin Yang and Xiangfeng Wang Contact: Dr. Xiangfeng

More information

Simple karyotypes visualization using chromdraw Jan Janečka Research group Plant Cytogenomics CEITEC, Masaryk University of Brno

Simple karyotypes visualization using chromdraw Jan Janečka Research group Plant Cytogenomics CEITEC, Masaryk University of Brno Simple karyotypes visualization using chromdraw Jan Janečka Research group Plant Cytogenomics CEITEC, Masaryk University of Brno This document shows the use of the chromdraw R package for linear and circular

More information

Outline Introduction Sequences Ranges Views Interval Datasets. IRanges. Bioconductor Infrastructure for Sequence Analysis.

Outline Introduction Sequences Ranges Views Interval Datasets. IRanges. Bioconductor Infrastructure for Sequence Analysis. IRanges Bioconductor Infrastructure for Sequence Analysis November 24, 2009 1 Introduction 2 Sequences Background RLEs 3 Ranges Basic Manipulation Simple Transformations Ranges as Sets Overlap 4 Views

More information

Representing sequencing data in Bioconductor

Representing sequencing data in Bioconductor Representing sequencing data in Bioconductor Mark Dunning mark.dunning@cruk.cam.ac.uk Last modified: July 28, 2015 Contents 1 Accessing Genome Sequence 1 1.1 Alphabet Frequencies...................................

More information

epigenomegateway.wustl.edu

epigenomegateway.wustl.edu Everything can be found at epigenomegateway.wustl.edu REFERENCES 1. Zhou X, et al., Nature Methods 8, 989-990 (2011) 2. Zhou X & Wang T, Current Protocols in Bioinformatics Unit 10.10 (2012) 3. Zhou X,

More information

Analysis of ChIP-seq data

Analysis of ChIP-seq data Before we start: 1. Log into tak (step 0 on the exercises) 2. Go to your lab space and create a folder for the class (see separate hand out) 3. Connect to your lab space through the wihtdata network and

More information

The list of data and results files that have been used for the analysis can be found at:

The list of data and results files that have been used for the analysis can be found at: BASIC CHIP-SEQ AND SSA TUTORIAL In this tutorial we are going to illustrate the capabilities of the ChIP-Seq server using data from an early landmark paper on STAT1 binding sites in γ-interferon stimulated

More information

fastseg An R Package for fast segmentation Günter Klambauer and Andreas Mitterecker Institute of Bioinformatics, Johannes Kepler University Linz

fastseg An R Package for fast segmentation Günter Klambauer and Andreas Mitterecker Institute of Bioinformatics, Johannes Kepler University Linz Software Manual Institute of Bioinformatics, Johannes Kepler University Linz fastseg An R Package for fast segmentation Günter Klambauer and Andreas Mitterecker Institute of Bioinformatics, Johannes Kepler

More information

Browser Exercises - I. Alignments and Comparative genomics

Browser Exercises - I. Alignments and Comparative genomics Browser Exercises - I Alignments and Comparative genomics 1. Navigating to the Genome Browser (GBrowse) Note: For this exercise use http://www.tritrypdb.org a. Navigate to the Genome Browser (GBrowse)

More information

Agilent Genomic Workbench Lite Edition 6.5

Agilent Genomic Workbench Lite Edition 6.5 Agilent Genomic Workbench Lite Edition 6.5 SureSelect Quality Analyzer User Guide For Research Use Only. Not for use in diagnostic procedures. Agilent Technologies Notices Agilent Technologies, Inc. 2010

More information

Prepare input data for CINdex

Prepare input data for CINdex 1 Introduction Prepare input data for CINdex Genomic instability is known to be a fundamental trait in the development of tumors; and most human tumors exhibit this instability in structural and numerical

More information

Click on "+" button Select your VCF data files (see #Input Formats->1 above) Remove file from files list:

Click on + button Select your VCF data files (see #Input Formats->1 above) Remove file from files list: CircosVCF: CircosVCF is a web based visualization tool of genome-wide variant data described in VCF files using circos plots. The provided visualization capabilities, gives a broad overview of the genomic

More information

User's guide to ChIP-Seq applications: command-line usage and option summary

User's guide to ChIP-Seq applications: command-line usage and option summary User's guide to ChIP-Seq applications: command-line usage and option summary 1. Basics about the ChIP-Seq Tools The ChIP-Seq software provides a set of tools performing common genome-wide ChIPseq analysis

More information

Some Basic ChIP-Seq Data Analysis

Some Basic ChIP-Seq Data Analysis Some Basic ChIP-Seq Data Analysis July 28, 2009 Our goal is to describe the use of Bioconductor software to perform some basic tasks in the analysis of ChIP-Seq data. We will use several functions in the

More information

Our typical RNA quantification pipeline

Our typical RNA quantification pipeline RNA-Seq primer Our typical RNA quantification pipeline Upload your sequence data (fastq) Align to the ribosome (Bow>e) Align remaining reads to genome (TopHat) or transcriptome (RSEM) Make report of quality

More information

Exercise 2: Browser-Based Annotation and RNA-Seq Data

Exercise 2: Browser-Based Annotation and RNA-Seq Data Exercise 2: Browser-Based Annotation and RNA-Seq Data Jeremy Buhler July 24, 2018 This exercise continues your introduction to practical issues in comparative annotation. You ll be annotating genomic sequence

More information

Finding Structural Variants in Short Read, Paired-end Sequence Data with R and Bioconductor

Finding Structural Variants in Short Read, Paired-end Sequence Data with R and Bioconductor Finding Structural Variants in Short Read, Paired-end Sequence Data with R and Bioconductor Sean Davis National Cancer Institute, National Institutes of Health Bethesda, MD, USA sdavis2@mail.nih.gov November

More information

Genomic Analysis with Genome Browsers.

Genomic Analysis with Genome Browsers. Genomic Analysis with Genome Browsers http://barc.wi.mit.edu/hot_topics/ 1 Outline Genome browsers overview UCSC Genome Browser Navigating: View your list of regions in the browser Available tracks (eg.

More information

Tutorial: RNA-Seq Analysis Part II (Tracks): Non-Specific Matches, Mapping Modes and Expression measures

Tutorial: RNA-Seq Analysis Part II (Tracks): Non-Specific Matches, Mapping Modes and Expression measures : RNA-Seq Analysis Part II (Tracks): Non-Specific Matches, Mapping Modes and February 24, 2014 Sample to Insight : RNA-Seq Analysis Part II (Tracks): Non-Specific Matches, Mapping Modes and : RNA-Seq Analysis

More information

Package DMCHMM. January 19, 2019

Package DMCHMM. January 19, 2019 Package DMCHMM January 19, 2019 Type Package Title Differentially Methylated CpG using Hidden Markov Model Version 1.4.0 Author Farhad Shokoohi Maintainer A pipeline for identifying differentially methylated

More information

NGS Data Visualization and Exploration Using IGV

NGS Data Visualization and Exploration Using IGV 1 What is Galaxy Galaxy for Bioinformaticians Galaxy for Experimental Biologists Using Galaxy for NGS Analysis NGS Data Visualization and Exploration Using IGV 2 What is Galaxy Galaxy for Bioinformaticians

More information

CLC Server. End User USER MANUAL

CLC Server. End User USER MANUAL CLC Server End User USER MANUAL Manual for CLC Server 10.0.1 Windows, macos and Linux March 8, 2018 This software is for research purposes only. QIAGEN Aarhus Silkeborgvej 2 Prismet DK-8000 Aarhus C Denmark

More information

The UCSC Gene Sorter, Table Browser & Custom Tracks

The UCSC Gene Sorter, Table Browser & Custom Tracks The UCSC Gene Sorter, Table Browser & Custom Tracks Advanced searching and discovery using the UCSC Table Browser and Custom Tracks Osvaldo Graña Bioinformatics Unit, CNIO 1 Table Browser and Custom Tracks

More information

Welcome to GenomeView 101!

Welcome to GenomeView 101! Welcome to GenomeView 101! 1. Start your computer 2. Download and extract the example data http://www.broadinstitute.org/~tabeel/broade.zip Suggestion: - Linux, Mac: make new folder in your home directory

More information

de.nbi and its Galaxy interface for RNA-Seq

de.nbi and its Galaxy interface for RNA-Seq de.nbi and its Galaxy interface for RNA-Seq Jörg Fallmann Thanks to Björn Grüning (RBC-Freiburg) and Sarah Diehl (MPI-Freiburg) Institute for Bioinformatics University of Leipzig http://www.bioinf.uni-leipzig.de/

More information

Package TxRegInfra. March 17, 2019

Package TxRegInfra. March 17, 2019 Package TxRegInfra March 17, 2019 Title Metadata management for multiomic specification of transcriptional regulatory networks This package provides interfaces to genomic metadata employed in regulatory

More information

Package DASiR. R topics documented: October 4, Type Package. Title Distributed Annotation System in R. Version

Package DASiR. R topics documented: October 4, Type Package. Title Distributed Annotation System in R. Version Package DASiR October 4, 2013 Type Package Title Distributed Annotation System in R Version 1.0.1 Date 2013-06-14 Author Oscar Flores, Anna Mantsoki Maintainer Oscar Flores , Anna

More information

Background and Strategy. Smitha, Adrian, Devin, Jeff, Ali, Sanjeev, Karthikeyan

Background and Strategy. Smitha, Adrian, Devin, Jeff, Ali, Sanjeev, Karthikeyan Background and Strategy Smitha, Adrian, Devin, Jeff, Ali, Sanjeev, Karthikeyan What is a genome browser? A web/desktop based graphical tool for rapid and reliable display of any requested portion of the

More information

Workshop 6: DNA Methylation Analysis using Bisulfite Sequencing. Fides D Lay UCLA QCB Fellow

Workshop 6: DNA Methylation Analysis using Bisulfite Sequencing. Fides D Lay UCLA QCB Fellow Workshop 6: DNA Methylation Analysis using Bisulfite Sequencing Fides D Lay UCLA QCB Fellow lay.fides@gmail.com Workshop 6 Outline Day 1: Introduction to DNA methylation & WGBS Quick review of linux, Hoffman2

More information

Goldmine: Integrating information to place sets of genomic ranges into biological contexts Jeff Bhasin

Goldmine: Integrating information to place sets of genomic ranges into biological contexts Jeff Bhasin Goldmine: Integrating information to place sets of genomic ranges into biological contexts Jeff Bhasin 2016-04-22 Contents Purpose 1 Prerequisites 1 Installation 2 Example 1: Annotation of Any Set of Genomic

More information

RNA-Seq Analysis With the Tuxedo Suite

RNA-Seq Analysis With the Tuxedo Suite June 2016 RNA-Seq Analysis With the Tuxedo Suite Dena Leshkowitz Introduction In this exercise we will learn how to analyse RNA-Seq data using the Tuxedo Suite tools: Tophat, Cuffmerge, Cufflinks and Cuffdiff.

More information

BadRegionFinder an R/Bioconductor package for identifying regions with bad coverage

BadRegionFinder an R/Bioconductor package for identifying regions with bad coverage BadRegionFinder an R/Bioconductor package for identifying regions with bad coverage Sarah Sandmann April 30, 2018 Contents 1 Introduction 1 1.1 Loading the package.................................... 2

More information

ChIP-Seq Tutorial on Galaxy

ChIP-Seq Tutorial on Galaxy 1 Introduction ChIP-Seq Tutorial on Galaxy 2 December 2010 (modified April 6, 2017) Rory Stark The aim of this practical is to give you some experience handling ChIP-Seq data. We will be working with data

More information

UCSC Genome Browser Pittsburgh Workshop -- Practical Exercises

UCSC Genome Browser Pittsburgh Workshop -- Practical Exercises UCSC Genome Browser Pittsburgh Workshop -- Practical Exercises We will be using human assembly hg19. These problems will take you through a variety of resources at the UCSC Genome Browser. You will learn

More information

The rtracklayer package

The rtracklayer package The rtracklayer package Michael Lawrence January 22, 2018 Contents 1 Introduction 2 2 Gene expression and microrna target sites 2 2.1 Creating a target site track..................... 2 2.1.1 Constructing

More information

BGGN-213: FOUNDATIONS OF BIOINFORMATICS (Lecture 14)

BGGN-213: FOUNDATIONS OF BIOINFORMATICS (Lecture 14) BGGN-213: FOUNDATIONS OF BIOINFORMATICS (Lecture 14) Genome Informatics (Part 1) https://bioboot.github.io/bggn213_f17/lectures/#14 Dr. Barry Grant Nov 2017 Overview: The purpose of this lab session is

More information

xmapbridge: Graphically Displaying Numeric Data in the X:Map Genome Browser

xmapbridge: Graphically Displaying Numeric Data in the X:Map Genome Browser xmapbridge: Graphically Displaying Numeric Data in the X:Map Genome Browser Tim Yates, Crispin J Miller April 30, 2018 Contents 1 Introduction 1 2 Quickstart 2 3 Plotting Graphs, the simple way 4 4 Multiple

More information

Package rgreat. June 19, 2018

Package rgreat. June 19, 2018 Type Package Title Client for GREAT Analysis Version 1.12.0 Date 2018-2-20 Author Zuguang Gu Maintainer Zuguang Gu Package rgreat June 19, 2018 Depends R (>= 3.1.2), GenomicRanges, IRanges,

More information

metilene - a tool for fast and sensitive detection of differential DNA methylation

metilene - a tool for fast and sensitive detection of differential DNA methylation metilene - a tool for fast and sensitive detection of differential DNA methylation Frank Jühling, Helene Kretzmer, Stephan H. Bernhart, Christian Otto, Peter F. Stadler, Steve Hoffmann Version 0.23 1 Introduction

More information

Visualisation, transformations and arithmetic operations for grouped genomic intervals

Visualisation, transformations and arithmetic operations for grouped genomic intervals ## Warning: replacing previous import ggplot2::position by BiocGenerics::Position when loading soggi Visualisation, transformations and arithmetic operations for grouped genomic intervals Thomas Carroll

More information

Understanding and Pre-processing Raw Illumina Data

Understanding and Pre-processing Raw Illumina Data Understanding and Pre-processing Raw Illumina Data Matt Johnson October 4, 2013 1 Understanding FASTQ files After an Illumina sequencing run, the data is stored in very large text files in a standard format

More information

Click Trust to launch TableView.

Click Trust to launch TableView. Visualizing Expression data using the Co-expression Tool Web service and TableView Introduction. TableView was written by James (Jim) E. Johnson and colleagues at the University of Minnesota Center for

More information

Package Repliscope. February 6, 2019

Package Repliscope. February 6, 2019 Type Package Language en-gb Package Repliscope February 6, 2019 Title Replication Timing Profiling using DNA Copy Number Version 1.0.0 Author Dzmitry G Batrakou Maintainer Dzmitry G Batrakou

More information

Importing your Exeter NGS data into Galaxy:

Importing your Exeter NGS data into Galaxy: Importing your Exeter NGS data into Galaxy: The aim of this tutorial is to show you how to import your raw Illumina FASTQ files and/or assemblies and remapping files into Galaxy. As of 1 st July 2011 Illumina

More information

regioner: Association analysis of genomic regions based on permutation tests

regioner: Association analysis of genomic regions based on permutation tests regioner: Association analysis of genomic regions based on permutation tests Bernat Gel, Anna Díez-Villanueva and Roberto Malinverni Edited: September 9, 215; Compiled: May 15, 216 Contents 1 Introduction

More information

Package roar. August 31, 2018

Package roar. August 31, 2018 Type Package Package roar August 31, 2018 Title Identify differential APA usage from RNA-seq alignments Version 1.16.0 Date 2016-03-21 Author Elena Grassi Maintainer Elena Grassi Identify

More information

Range-based containers in Bioconductor

Range-based containers in Bioconductor Range-based containers in Bioconductor Hervé Pagès hpages@fhcrc.org Fred Hutchinson Cancer Research Center Seattle, WA, USA 21 January 2014 Introduction IRanges objects GRanges objects Splitting a GRanges

More information

Sequence Analysis Pipeline

Sequence Analysis Pipeline Sequence Analysis Pipeline Transcript fragments 1. PREPROCESSING 2. ASSEMBLY (today) Removal of contaminants, vector, adaptors, etc Put overlapping sequence together and calculate bigger sequences 3. Analysis/Annotation

More information

Biomedical Genomics Workbench APPLICATION BASED MANUAL

Biomedical Genomics Workbench APPLICATION BASED MANUAL Biomedical Genomics Workbench APPLICATION BASED MANUAL Manual for Biomedical Genomics Workbench 4.0 Windows, Mac OS X and Linux January 23, 2017 This software is for research purposes only. QIAGEN Aarhus

More information

Rsubread package: high-performance read alignment, quantification and mutation discovery

Rsubread package: high-performance read alignment, quantification and mutation discovery Rsubread package: high-performance read alignment, quantification and mutation discovery Wei Shi 14 September 2015 1 Introduction This vignette provides a brief description to the Rsubread package. For

More information

PODKAT. An R Package for Association Testing Involving Rare and Private Variants. Ulrich Bodenhofer

PODKAT. An R Package for Association Testing Involving Rare and Private Variants. Ulrich Bodenhofer Software Manual Institute of Bioinformatics, Johannes Kepler University Linz PODKAT An R Package for Association Testing Involving Rare and Private Variants Ulrich Bodenhofer Institute of Bioinformatics,

More information

Documentation of S MART

Documentation of S MART Documentation of S MART Matthias Zytnicki March 14, 2012 Contents 1 Introduction 3 2 Installation and requirements 3 2.1 For Windows............................. 3 2.2 For Mac................................

More information

panda Documentation Release 1.0 Daniel Vera

panda Documentation Release 1.0 Daniel Vera panda Documentation Release 1.0 Daniel Vera February 12, 2014 Contents 1 mat.make 3 1.1 Usage and option summary....................................... 3 1.2 Arguments................................................

More information

ITMO Ecole de Bioinformatique Hands-on session: smallrna-seq N. Servant 21 rd November 2013

ITMO Ecole de Bioinformatique Hands-on session: smallrna-seq N. Servant 21 rd November 2013 ITMO Ecole de Bioinformatique Hands-on session: smallrna-seq N. Servant 21 rd November 2013 1. Data and objectives We will use the data from GEO (GSE35368, Toedling, Servant et al. 2011). Two samples were

More information

RNA-Seq. Joshua Ainsley, PhD Postdoctoral Researcher Lab of Leon Reijmers Neuroscience Department Tufts University

RNA-Seq. Joshua Ainsley, PhD Postdoctoral Researcher Lab of Leon Reijmers Neuroscience Department Tufts University RNA-Seq Joshua Ainsley, PhD Postdoctoral Researcher Lab of Leon Reijmers Neuroscience Department Tufts University joshua.ainsley@tufts.edu Day four Quantifying expression Intro to R Differential expression

More information

ROTS: Reproducibility Optimized Test Statistic

ROTS: Reproducibility Optimized Test Statistic ROTS: Reproducibility Optimized Test Statistic Fatemeh Seyednasrollah, Tomi Suomi, Laura L. Elo fatsey (at) utu.fi March 3, 2016 Contents 1 Introduction 2 2 Algorithm overview 3 3 Input data 3 4 Preprocessing

More information