Relationship Between BED and WIG Formats
|
|
- Barbara Lane
- 5 years ago
- Views:
Transcription
1 Relationship Between BED and WIG Formats Pete E. Pascuzzi July 2, 2015 This example will illustrate the similarities and differences between the various ways to represent ranged data in R. In bioinformatics, ranged data is exemplified by any feature that can map to a position in a specific genome, e.g. annotated genes, DNA methylation sites, or mapped RNA-seq data. Ranged data shoud have start and end coordinates in a specific genome and a chromosome number. Ideally a specific build for that genome should be indicated as well, perhaps in leading lines in a file or a data field reserved for metadata. Below, I am going create a simple data frame that has some ranged data similar to short reads from an NGS experiment. I am going to make several data sets that are derived from the original data frame. Why shoud you do this? Because, to take advantage of some functions in Bioconductor, the data will often have to be stored as a particular class. For example coverage will only work on data stored as an IRange, including classes like IRanges or Views. Similarly, slice will only function a Rle object. Finally, there are several standard file formats that are used to display data on genome browsers, including BED and WIG. I will illustrate how you can create files in this format as well. > ## Create data frame with short reads in 2 steps > shortread.df <- data.frame(seq="chr4", start=c(6, 11, 21, 26, 41, 51, 56, 61, + 66, 76, 151, 156)) > ## make them all the same length > shortread.df$end <- shortread.df$start + 49 > print(shortread.df) seq start end 1 chr chr chr chr chr chr chr chr chr chr chr chr > ## can we calculate the coverage from the data frame? No! > ## shortread.cov <- coverage(shortread.df$start, shortread.df$end) > ## create IRanges object from short read and give a name that > ## indicates chr and read number. 1
2 > shortread.ir <- IRanges(start=shortread.df$start, end= + shortread.df$end, names=paste("chr4", + 1:nrow(shortread.df), sep="_")) > print(shortread.ir) IRanges of length 12 [1] chr4_1 [2] chr4_2 [3] chr4_3 [4] chr4_4 [5] chr4_ [8] chr4_8 [9] chr4_9 [10] chr4_10 [11] chr4_11 [12] chr4_12 > ## Coverage will work now > shortread.cov <- coverage(shortread.ir) > print(shortread.cov) integer-rle of length 205 with 18 runs Lengths: Values : > ## we can slice-out regions in our data where the coverage > ## is above, below or between a specified range. The result is an > ## IRanges object. > my.peaks <- slice(shortread.cov, lower=2, rangesonly=t) > names(my.peaks) <- paste("chr4_peak",1:length(my.peaks),sep="_") > print(my.peaks) IRanges of length 2 [1] chr4_peak_1 [2] chr4_peak_2 > ## What if we wanted to count the number of reads mapping to a > ## specific gene? > my.gene <- IRanges(start=30, end=50, names="my.gene") > print(my.gene) IRanges of length 1 [1] my.gene > my.gene.count <- countoverlaps(my.gene, shortread.ir) > print(my.gene.count) 2
3 my.gene 5 > ## You could also calculate the coverage across the gene, > ## but coverage is NOT the way you should handle RNA-seq data > ## for differential expression! > my.gene.cov <- mean(shortread.cov[my.gene]) > print(my.gene.cov) [1] > ## Can we do this on a vector of gene start and end positions? > another.gene <- IRanges(start=100, end=200, names="another_gene") > my.genes <- c(my.gene, another.gene) > print(my.genes) IRanges of length 2 [1] my.gene [2] another_gene > my.genes.cov <- mean(shortread.cov[my.genes[1:2]]) > print(my.genes.cov) [1] > ## No, we only get a single value, not two values. The value is > ## different than the coverage of the first gene, so this must > ## be the average coverage for both genes combined. > ## To do multiple genes, we need to use lapply. We can split > ## the IRanges object based on its names > genes.ir.list <- split(my.genes, f=names(my.genes)) > my.genes.cov <- unlist(lapply(my.genes,function(x)(mean(shortread.cov[x])))) > print(my.genes.cov) my.gene another_gene > ## Now, format data for BED file so that the reads can be > ## displayed on a genome browser. Remember the zero-based > ## indexing and remember to convert back if you want to use data > ## derived from a BED file in R! > shortreads.bed <- data.frame(chrom="chr4", chromstart= + shortread.df$start - 1, chromend= + shortread.df$end) > bed.header <- "track type=bed name=short_reads description=simulated" > write(bed.header, file="shortreads.bed", ncolumns=1) > write.table(shortreads.bed, file="shortreads.bed", append=t, sep="\t", + quote=f, row.names=f, col.names=f) > peaks.bed <- data.frame(chrom="chr4", chromstart= 3
4 + start(my.peaks) - 1, chromend= + end(my.peaks)) > bed.header <- "track type=bed name=short_reads description=simulated" > write(bed.header, file="peaks.bed", ncolumns=1) > write.table(peaks.bed, file="peaks.bed", append=t, sep="\t", + quote=f, row.names=f, col.names=f) > ## We can also produce a WIG file easily from the Rle object > ## produce by coverage. Probably some way to do this from the > ## data frame but this way is easy. We can calculate the positions > ## where our values change from the runlengths, but we need to add > ## the first position to the runlength vectors to get accurate > ## positions on the chromosome. Also need to add a runvalue of zero > ## to the end of the runvalues vector to let the WIG track fall > ## back to zero. > shortreads.wig <- data.frame(position=cumsum(c(1, runlength( + shortread.cov))), values=c(runvalue( + shortread.cov), 0)) > wig.header <- "track type=wiggle_0 name=shortreads description=simulated" > write(wig.header, file="shortreads.wig", ncolumns=1) > my.declare <- "variablestep chrom=chr4" > write(my.declare, file="shortreads.wig", ncolumns=1, append=t) > write.table(shortreads.wig, file="shortreads.wig", append=t, sep="\t", + quote=f,row.names=f,col.names=f) > ## Now we can plot some of this data to see how they compare > #pdf(file="example.pdf",w=6,h=6) > par(lend="butt") > plot(c(1,250),y=c(0,10),type="n", main="", xlab="position", + ylab="coverage") > segments(start(shortread.ir), c(1:7,1:3,1:2), end(shortread.ir), + c(1:7,1:3,1:2), lwd=4) > segments(peaks.bed$chromstart + 1, 9, peaks.bed$chromend, 9, lwd=4, col="blue") > points(shortreads.wig, type="s", lwd=2, col="red") > abline(v=seq(from=0, to=250, by=10), lty=2) > legend("right", legend=c("read", "wig", "peak"), horiz=f, lwd=2, col=c("black", "red", "blue"), bty="o > #dev.off() 4
5 coverage read wig peak position 5
From genomic regions to biology
Before we start: 1. Log into tak (step 0 on the exercises) 2. Go to your lab space and create a folder for the class (see separate hand out) 3. Connect to your lab space through the wihtdata network and
More informationPractical 4: ChIP-seq Peak calling
Practical 4: ChIP-seq Peak calling Shamith Samarajiiwa, Dora Bihary September 2017 Contents 1 Calling ChIP-seq peaks using MACS2 1 1.1 Assess the quality of the aligned datasets..................................
More informationChIP-seq (NGS) Data Formats
ChIP-seq (NGS) Data Formats Biological samples Sequence reads SRA/SRF, FASTQ Quality control SAM/BAM/Pileup?? Mapping Assembly... DE Analysis Variant Detection Peak Calling...? Counts, RPKM VCF BED/narrowPeak/
More informationBioinformatics in next generation sequencing projects
Bioinformatics in next generation sequencing projects Rickard Sandberg Assistant Professor Department of Cell and Molecular Biology Karolinska Institutet March 2011 Once sequenced the problem becomes computational
More informationChip-seq data analysis: from quality check to motif discovery and more Lausanne, 4-8 April 2016
Chip-seq data analysis: from quality check to motif discovery and more Lausanne, 4-8 April 2016 ChIP-partitioning tool: shape based analysis of transcription factor binding tags Sunil Kumar, Romain Groux
More informationA short Introduction to UCSC Genome Browser
A short Introduction to UCSC Genome Browser Elodie Girard, Nicolas Servant Institut Curie/INSERM U900 Bioinformatics, Biostatistics, Epidemiology and computational Systems Biology of Cancer 1 Why using
More informationIRanges and GenomicRanges An introduction
IRanges and GenomicRanges An introduction Kasper Daniel Hansen CSAMA, Brixen 2011 1 / 28 Why you should care IRanges and GRanges are data structures I use often to solve a variety of
More informationGetting Started. April Strand Life Sciences, Inc All rights reserved.
Getting Started April 2015 Strand Life Sciences, Inc. 2015. All rights reserved. Contents Aim... 3 Demo Project and User Interface... 3 Downloading Annotations... 4 Project and Experiment Creation... 6
More informationEasy visualization of the read coverage using the CoverageView package
Easy visualization of the read coverage using the CoverageView package Ernesto Lowy European Bioinformatics Institute EMBL June 13, 2018 > options(width=40) > library(coverageview) 1 Introduction This
More informationChIP-seq hands-on practical using Galaxy
ChIP-seq hands-on practical using Galaxy In this exercise we will cover some of the basic NGS analysis steps for ChIP-seq using the Galaxy framework: Quality control Mapping of reads using Bowtie2 Peak-calling
More informationIntegrative Genomics Viewer. Prat Thiru
Integrative Genomics Viewer Prat Thiru 1 Overview User Interface Basics Browsing the Data Data Formats IGV Tools Demo Outline Based on ISMB 2010 Tutorial by Robinson and Thorvaldsdottir 2 Why IGV? IGV
More informationAdvanced UCSC Browser Functions
Advanced UCSC Browser Functions Dr. Thomas Randall tarandal@email.unc.edu bioinformatics.unc.edu UCSC Browser: genome.ucsc.edu Overview Custom Tracks adding your own datasets Utilities custom tools for
More informationRanges (and Data Integration)
Ranges (and Data Integration) Martin Morgan 1 Fred Hutchinson Cancer Research Center Seattle, WA 20 November 2013 1 mtmorgan@fhcrc.org Introduction Importance of range concepts: conceptually... Genomic
More informationAnalyzing ChIP- Seq Data in Galaxy
Analyzing ChIP- Seq Data in Galaxy Lauren Mills RISS ABSTRACT Step- by- step guide to basic ChIP- Seq analysis using the Galaxy platform. Table of Contents Introduction... 3 Links to helpful information...
More information!"#$%&$'()#$*)+,-./).01"0#,23+3,303456"6,&((46,7$+-./&((468,
!"#$%&$'()#$*)+,-./).01"0#,23+3,303456"6,&((46,7$+-./&((468, 9"(1(02)1+(',:.;.4(*.',?9@A,!."2.4B.'#A,C(;.
More informationW ASHU E PI G ENOME B ROWSER
W ASHU E PI G ENOME B ROWSER Keystone Symposium on DNA and RNA Methylation January 23 rd, 2018 Fairmont Hotel Vancouver, Vancouver, British Columbia, Canada Presenter: Renee Sears and Josh Jang Tutorial
More informationIntroduction to Matlab. Sasha Lukyanov, 2018 Xenopus Bioinformatics Workshop, MBL, Woods Hole
Introduction to Matlab Sasha Lukyanov, 2018 Xenopus Bioinformatics Workshop, MBL, Woods Hole MATLAB Environment This image cannot currently be displayed. What do we use? Help? If you know the name of the
More informationUsing the GenomicFeatures package
Using the GenomicFeatures package Marc Carlson Fred Hutchinson Cancer Research Center December 10th 2010 Bioconductor Annotation Packages: a bigger picture PLATFORM PKGS GENE ID HOMOLOGY PKGS GENE ID ORG
More informationGenome representa;on concepts. Week 12, Lecture 24. Coordinate systems. Genomic coordinates brief overview 11/13/14
2014 - BMMB 852D: Applied Bioinforma;cs Week 12, Lecture 24 István Albert Biochemistry and Molecular Biology and Bioinforma;cs Consul;ng Center Penn State Genome representa;on concepts At the simplest
More informationUseful software utilities for computational genomics. Shamith Samarajiwa CRUK Autumn School in Bioinformatics September 2017
Useful software utilities for computational genomics Shamith Samarajiwa CRUK Autumn School in Bioinformatics September 2017 Overview Search and download genomic datasets: GEOquery, GEOsearch and GEOmetadb,
More information- 1 - Web page:
J-Circos Manual 2014-11-10 J-Circos: A Java Graphic User Interface for Circos Plot Jiyuan An 1, John Lai 1, Atul Sajjanhar 2, Jyotsna Batra 1,Chenwei Wang 1 and Colleen C Nelson 1 1 Australian Prostate
More informationWorking with ChIP-Seq Data in R/Bioconductor
Working with ChIP-Seq Data in R/Bioconductor Suraj Menon, Tom Carroll, Shamith Samarajiwa September 3, 2014 Contents 1 Introduction 1 2 Working with aligned data 1 2.1 Reading in data......................................
More informationPackage polyphemus. February 15, 2013
Package polyphemus February 15, 2013 Type Package Title Genome wide analysis of RNA Polymerase II-based ChIP Seq data. Version 0.3.4 Date 2010-08-11 Author Martial Sankar, supervised by Marco Mendoza and
More informationChIP-seq hands-on practical using Galaxy
ChIP-seq hands-on practical using Galaxy In this exercise we will cover some of the basic NGS analysis steps for ChIP-seq using the Galaxy framework: Quality control Mapping of reads using Bowtie2 Peak-calling
More informationProtocol: peak-calling for ChIP-seq data / segmentation analysis for histone modification data
Protocol: peak-calling for ChIP-seq data / segmentation analysis for histone modification data Table of Contents Protocol: peak-calling for ChIP-seq data / segmentation analysis for histone modification
More informationHandling genomic data using Bioconductor II: GenomicRanges and GenomicFeatures
Handling genomic data using Bioconductor II: GenomicRanges and GenomicFeatures Motivating examples Genomic Features (e.g., genes, exons, CpG islands) on the genome are often represented as intervals, e.g.,
More informationSimple karyotypes visualization using chromdraw Jan Janecka Research group Plant Cytogenomics CEITEC, Masaryk University of Brno
Simple karyotypes visualization using chromdraw Jan Janecka Research group Plant Cytogenomics CEITEC, Masaryk University of Brno This document shows the use of the chromdraw R package for linear and circular
More informationSPAR outputs and report page
SPAR outputs and report page Landing results page (full view) Landing results / outputs page (top) Input files are listed Job id is shown Download all tables, figures, tracks as zip Percentage of reads
More informationTutorial. RNA-Seq Analysis of Breast Cancer Data. Sample to Insight. November 21, 2017
RNA-Seq Analysis of Breast Cancer Data November 21, 2017 Sample to Insight QIAGEN Aarhus Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 www.qiagenbioinformatics.com AdvancedGenomicsSupport@qiagen.com
More informationA quick introduction to GRanges and GRangesList objects
A quick introduction to GRanges and GRangesList objects Hervé Pagès hpages@fredhutch.org Michael Lawrence lawrence.michael@gene.com July 2015 GRanges objects The GRanges() constructor GRanges accessors
More informationfeaturedb storing and querying genomic annotation
featuredb storing and querying genomic annotation Work in progress Arne Müller Preclinical Safety Informatics, Novartis, December 14th 2012 Acknowledgements: Florian Hahne + Bioconductor Community featuredb
More informationChIP-seq practical: peak detection and peak annotation. Mali Salmon-Divon Remco Loos Myrto Kostadima
ChIP-seq practical: peak detection and peak annotation Mali Salmon-Divon Remco Loos Myrto Kostadima March 2012 Introduction The goal of this hands-on session is to perform some basic tasks in the analysis
More informationRNA-Seq in Galaxy: Tuxedo protocol. Igor Makunin, UQ RCC, QCIF
RNA-Seq in Galaxy: Tuxedo protocol Igor Makunin, UQ RCC, QCIF Acknowledgments Genomics Virtual Lab: gvl.org.au Galaxy for tutorials: galaxy-tut.genome.edu.au Galaxy Australia: galaxy-aust.genome.edu.au
More informationsegmentseq: methods for detecting methylation loci and differential methylation
segmentseq: methods for detecting methylation loci and differential methylation Thomas J. Hardcastle October 13, 2015 1 Introduction This vignette introduces analysis methods for data from high-throughput
More informationPart 1: How to use IGV to visualize variants
Using IGV to identify true somatic variants from the false variants http://www.broadinstitute.org/igv A FAQ, sample files and a user guide are available on IGV website If you use IGV in your publication:
More informationGenetics 211 Genomics Winter 2014 Problem Set 4
Genomics - Part 1 due Friday, 2/21/2014 by 9:00am Part 2 due Friday, 3/7/2014 by 9:00am For this problem set, we re going to use real data from a high-throughput sequencing project to look for differential
More informationCounting with summarizeoverlaps
Counting with summarizeoverlaps Valerie Obenchain Edited: August 2012; Compiled: August 23, 2013 Contents 1 Introduction 1 2 A First Example 1 3 Counting Modes 2 4 Counting Features 3 5 pasilla Data 6
More informationIntroduction to Read Alignment. UCD Genome Center Bioinformatics Core Tuesday 15 September 2015
Introduction to Read Alignment UCD Genome Center Bioinformatics Core Tuesday 15 September 2015 From reads to molecules Why align? Individual A Individual B ATGATAGCATCGTCGGGTGTCTGCTCAATAATAGTGCCGTATCATGCTGGTGTTATAATCGCCGCATGACATGATCAATGG
More informationsegmentseq: methods for detecting methylation loci and differential methylation
segmentseq: methods for detecting methylation loci and differential methylation Thomas J. Hardcastle October 30, 2018 1 Introduction This vignette introduces analysis methods for data from high-throughput
More informationPackage cleanupdtseq
Package cleanupdtseq August 2, 2013 Type Package Title This package classifies putative polyadenylation sites as true or false/internally oligodt primed. Version 0.99.3 Date 2013-07-22 Author Sarah Sheppard,
More informationm6aviewer Version Documentation
m6aviewer Version 1.6.0 Documentation Contents 1. About 2. Requirements 3. Launching m6aviewer 4. Running Time Estimates 5. Basic Peak Calling 6. Running Modes 7. Multiple Samples/Sample Replicates 8.
More informationIntroduction to Galaxy
Introduction to Galaxy Dr Jason Wong Prince of Wales Clinical School Introductory bioinformatics for human genomics workshop, UNSW Day 1 Thurs 28 th January 2016 Overview What is Galaxy? Description of
More informationPackage dmrseq. September 14, 2018
Type Package Package dmrseq September 14, 2018 Title Detection and inference of differentially methylated regions from Whole Genome Bisulfite Sequencing Version 1.1.15 Author Keegan Korthauer ,
More informationDifferential Expression Analysis at PATRIC
Differential Expression Analysis at PATRIC The following step- by- step workflow is intended to help users learn how to upload their differential gene expression data to their private workspace using Expression
More informationKGBassembler Manual. A Karyotype-based Genome Assembler for Brassicaceae Species. Version 1.2. August 16 th, 2012
KGBassembler Manual A Karyotype-based Genome Assembler for Brassicaceae Species Version 1.2 August 16 th, 2012 Authors: Chuang Ma, Hao Chen, Mingming Xin, Ruolin Yang and Xiangfeng Wang Contact: Dr. Xiangfeng
More informationSimple karyotypes visualization using chromdraw Jan Janečka Research group Plant Cytogenomics CEITEC, Masaryk University of Brno
Simple karyotypes visualization using chromdraw Jan Janečka Research group Plant Cytogenomics CEITEC, Masaryk University of Brno This document shows the use of the chromdraw R package for linear and circular
More informationOutline Introduction Sequences Ranges Views Interval Datasets. IRanges. Bioconductor Infrastructure for Sequence Analysis.
IRanges Bioconductor Infrastructure for Sequence Analysis November 24, 2009 1 Introduction 2 Sequences Background RLEs 3 Ranges Basic Manipulation Simple Transformations Ranges as Sets Overlap 4 Views
More informationRepresenting sequencing data in Bioconductor
Representing sequencing data in Bioconductor Mark Dunning mark.dunning@cruk.cam.ac.uk Last modified: July 28, 2015 Contents 1 Accessing Genome Sequence 1 1.1 Alphabet Frequencies...................................
More informationepigenomegateway.wustl.edu
Everything can be found at epigenomegateway.wustl.edu REFERENCES 1. Zhou X, et al., Nature Methods 8, 989-990 (2011) 2. Zhou X & Wang T, Current Protocols in Bioinformatics Unit 10.10 (2012) 3. Zhou X,
More informationAnalysis of ChIP-seq data
Before we start: 1. Log into tak (step 0 on the exercises) 2. Go to your lab space and create a folder for the class (see separate hand out) 3. Connect to your lab space through the wihtdata network and
More informationThe list of data and results files that have been used for the analysis can be found at:
BASIC CHIP-SEQ AND SSA TUTORIAL In this tutorial we are going to illustrate the capabilities of the ChIP-Seq server using data from an early landmark paper on STAT1 binding sites in γ-interferon stimulated
More informationfastseg An R Package for fast segmentation Günter Klambauer and Andreas Mitterecker Institute of Bioinformatics, Johannes Kepler University Linz
Software Manual Institute of Bioinformatics, Johannes Kepler University Linz fastseg An R Package for fast segmentation Günter Klambauer and Andreas Mitterecker Institute of Bioinformatics, Johannes Kepler
More informationBrowser Exercises - I. Alignments and Comparative genomics
Browser Exercises - I Alignments and Comparative genomics 1. Navigating to the Genome Browser (GBrowse) Note: For this exercise use http://www.tritrypdb.org a. Navigate to the Genome Browser (GBrowse)
More informationAgilent Genomic Workbench Lite Edition 6.5
Agilent Genomic Workbench Lite Edition 6.5 SureSelect Quality Analyzer User Guide For Research Use Only. Not for use in diagnostic procedures. Agilent Technologies Notices Agilent Technologies, Inc. 2010
More informationPrepare input data for CINdex
1 Introduction Prepare input data for CINdex Genomic instability is known to be a fundamental trait in the development of tumors; and most human tumors exhibit this instability in structural and numerical
More informationClick on "+" button Select your VCF data files (see #Input Formats->1 above) Remove file from files list:
CircosVCF: CircosVCF is a web based visualization tool of genome-wide variant data described in VCF files using circos plots. The provided visualization capabilities, gives a broad overview of the genomic
More informationUser's guide to ChIP-Seq applications: command-line usage and option summary
User's guide to ChIP-Seq applications: command-line usage and option summary 1. Basics about the ChIP-Seq Tools The ChIP-Seq software provides a set of tools performing common genome-wide ChIPseq analysis
More informationSome Basic ChIP-Seq Data Analysis
Some Basic ChIP-Seq Data Analysis July 28, 2009 Our goal is to describe the use of Bioconductor software to perform some basic tasks in the analysis of ChIP-Seq data. We will use several functions in the
More informationOur typical RNA quantification pipeline
RNA-Seq primer Our typical RNA quantification pipeline Upload your sequence data (fastq) Align to the ribosome (Bow>e) Align remaining reads to genome (TopHat) or transcriptome (RSEM) Make report of quality
More informationExercise 2: Browser-Based Annotation and RNA-Seq Data
Exercise 2: Browser-Based Annotation and RNA-Seq Data Jeremy Buhler July 24, 2018 This exercise continues your introduction to practical issues in comparative annotation. You ll be annotating genomic sequence
More informationFinding Structural Variants in Short Read, Paired-end Sequence Data with R and Bioconductor
Finding Structural Variants in Short Read, Paired-end Sequence Data with R and Bioconductor Sean Davis National Cancer Institute, National Institutes of Health Bethesda, MD, USA sdavis2@mail.nih.gov November
More informationGenomic Analysis with Genome Browsers.
Genomic Analysis with Genome Browsers http://barc.wi.mit.edu/hot_topics/ 1 Outline Genome browsers overview UCSC Genome Browser Navigating: View your list of regions in the browser Available tracks (eg.
More informationTutorial: RNA-Seq Analysis Part II (Tracks): Non-Specific Matches, Mapping Modes and Expression measures
: RNA-Seq Analysis Part II (Tracks): Non-Specific Matches, Mapping Modes and February 24, 2014 Sample to Insight : RNA-Seq Analysis Part II (Tracks): Non-Specific Matches, Mapping Modes and : RNA-Seq Analysis
More informationPackage DMCHMM. January 19, 2019
Package DMCHMM January 19, 2019 Type Package Title Differentially Methylated CpG using Hidden Markov Model Version 1.4.0 Author Farhad Shokoohi Maintainer A pipeline for identifying differentially methylated
More informationNGS Data Visualization and Exploration Using IGV
1 What is Galaxy Galaxy for Bioinformaticians Galaxy for Experimental Biologists Using Galaxy for NGS Analysis NGS Data Visualization and Exploration Using IGV 2 What is Galaxy Galaxy for Bioinformaticians
More informationCLC Server. End User USER MANUAL
CLC Server End User USER MANUAL Manual for CLC Server 10.0.1 Windows, macos and Linux March 8, 2018 This software is for research purposes only. QIAGEN Aarhus Silkeborgvej 2 Prismet DK-8000 Aarhus C Denmark
More informationThe UCSC Gene Sorter, Table Browser & Custom Tracks
The UCSC Gene Sorter, Table Browser & Custom Tracks Advanced searching and discovery using the UCSC Table Browser and Custom Tracks Osvaldo Graña Bioinformatics Unit, CNIO 1 Table Browser and Custom Tracks
More informationWelcome to GenomeView 101!
Welcome to GenomeView 101! 1. Start your computer 2. Download and extract the example data http://www.broadinstitute.org/~tabeel/broade.zip Suggestion: - Linux, Mac: make new folder in your home directory
More informationde.nbi and its Galaxy interface for RNA-Seq
de.nbi and its Galaxy interface for RNA-Seq Jörg Fallmann Thanks to Björn Grüning (RBC-Freiburg) and Sarah Diehl (MPI-Freiburg) Institute for Bioinformatics University of Leipzig http://www.bioinf.uni-leipzig.de/
More informationPackage TxRegInfra. March 17, 2019
Package TxRegInfra March 17, 2019 Title Metadata management for multiomic specification of transcriptional regulatory networks This package provides interfaces to genomic metadata employed in regulatory
More informationPackage DASiR. R topics documented: October 4, Type Package. Title Distributed Annotation System in R. Version
Package DASiR October 4, 2013 Type Package Title Distributed Annotation System in R Version 1.0.1 Date 2013-06-14 Author Oscar Flores, Anna Mantsoki Maintainer Oscar Flores , Anna
More informationBackground and Strategy. Smitha, Adrian, Devin, Jeff, Ali, Sanjeev, Karthikeyan
Background and Strategy Smitha, Adrian, Devin, Jeff, Ali, Sanjeev, Karthikeyan What is a genome browser? A web/desktop based graphical tool for rapid and reliable display of any requested portion of the
More informationWorkshop 6: DNA Methylation Analysis using Bisulfite Sequencing. Fides D Lay UCLA QCB Fellow
Workshop 6: DNA Methylation Analysis using Bisulfite Sequencing Fides D Lay UCLA QCB Fellow lay.fides@gmail.com Workshop 6 Outline Day 1: Introduction to DNA methylation & WGBS Quick review of linux, Hoffman2
More informationGoldmine: Integrating information to place sets of genomic ranges into biological contexts Jeff Bhasin
Goldmine: Integrating information to place sets of genomic ranges into biological contexts Jeff Bhasin 2016-04-22 Contents Purpose 1 Prerequisites 1 Installation 2 Example 1: Annotation of Any Set of Genomic
More informationRNA-Seq Analysis With the Tuxedo Suite
June 2016 RNA-Seq Analysis With the Tuxedo Suite Dena Leshkowitz Introduction In this exercise we will learn how to analyse RNA-Seq data using the Tuxedo Suite tools: Tophat, Cuffmerge, Cufflinks and Cuffdiff.
More informationBadRegionFinder an R/Bioconductor package for identifying regions with bad coverage
BadRegionFinder an R/Bioconductor package for identifying regions with bad coverage Sarah Sandmann April 30, 2018 Contents 1 Introduction 1 1.1 Loading the package.................................... 2
More informationChIP-Seq Tutorial on Galaxy
1 Introduction ChIP-Seq Tutorial on Galaxy 2 December 2010 (modified April 6, 2017) Rory Stark The aim of this practical is to give you some experience handling ChIP-Seq data. We will be working with data
More informationUCSC Genome Browser Pittsburgh Workshop -- Practical Exercises
UCSC Genome Browser Pittsburgh Workshop -- Practical Exercises We will be using human assembly hg19. These problems will take you through a variety of resources at the UCSC Genome Browser. You will learn
More informationThe rtracklayer package
The rtracklayer package Michael Lawrence January 22, 2018 Contents 1 Introduction 2 2 Gene expression and microrna target sites 2 2.1 Creating a target site track..................... 2 2.1.1 Constructing
More informationBGGN-213: FOUNDATIONS OF BIOINFORMATICS (Lecture 14)
BGGN-213: FOUNDATIONS OF BIOINFORMATICS (Lecture 14) Genome Informatics (Part 1) https://bioboot.github.io/bggn213_f17/lectures/#14 Dr. Barry Grant Nov 2017 Overview: The purpose of this lab session is
More informationxmapbridge: Graphically Displaying Numeric Data in the X:Map Genome Browser
xmapbridge: Graphically Displaying Numeric Data in the X:Map Genome Browser Tim Yates, Crispin J Miller April 30, 2018 Contents 1 Introduction 1 2 Quickstart 2 3 Plotting Graphs, the simple way 4 4 Multiple
More informationPackage rgreat. June 19, 2018
Type Package Title Client for GREAT Analysis Version 1.12.0 Date 2018-2-20 Author Zuguang Gu Maintainer Zuguang Gu Package rgreat June 19, 2018 Depends R (>= 3.1.2), GenomicRanges, IRanges,
More informationmetilene - a tool for fast and sensitive detection of differential DNA methylation
metilene - a tool for fast and sensitive detection of differential DNA methylation Frank Jühling, Helene Kretzmer, Stephan H. Bernhart, Christian Otto, Peter F. Stadler, Steve Hoffmann Version 0.23 1 Introduction
More informationVisualisation, transformations and arithmetic operations for grouped genomic intervals
## Warning: replacing previous import ggplot2::position by BiocGenerics::Position when loading soggi Visualisation, transformations and arithmetic operations for grouped genomic intervals Thomas Carroll
More informationUnderstanding and Pre-processing Raw Illumina Data
Understanding and Pre-processing Raw Illumina Data Matt Johnson October 4, 2013 1 Understanding FASTQ files After an Illumina sequencing run, the data is stored in very large text files in a standard format
More informationClick Trust to launch TableView.
Visualizing Expression data using the Co-expression Tool Web service and TableView Introduction. TableView was written by James (Jim) E. Johnson and colleagues at the University of Minnesota Center for
More informationPackage Repliscope. February 6, 2019
Type Package Language en-gb Package Repliscope February 6, 2019 Title Replication Timing Profiling using DNA Copy Number Version 1.0.0 Author Dzmitry G Batrakou Maintainer Dzmitry G Batrakou
More informationImporting your Exeter NGS data into Galaxy:
Importing your Exeter NGS data into Galaxy: The aim of this tutorial is to show you how to import your raw Illumina FASTQ files and/or assemblies and remapping files into Galaxy. As of 1 st July 2011 Illumina
More informationregioner: Association analysis of genomic regions based on permutation tests
regioner: Association analysis of genomic regions based on permutation tests Bernat Gel, Anna Díez-Villanueva and Roberto Malinverni Edited: September 9, 215; Compiled: May 15, 216 Contents 1 Introduction
More informationPackage roar. August 31, 2018
Type Package Package roar August 31, 2018 Title Identify differential APA usage from RNA-seq alignments Version 1.16.0 Date 2016-03-21 Author Elena Grassi Maintainer Elena Grassi Identify
More informationRange-based containers in Bioconductor
Range-based containers in Bioconductor Hervé Pagès hpages@fhcrc.org Fred Hutchinson Cancer Research Center Seattle, WA, USA 21 January 2014 Introduction IRanges objects GRanges objects Splitting a GRanges
More informationSequence Analysis Pipeline
Sequence Analysis Pipeline Transcript fragments 1. PREPROCESSING 2. ASSEMBLY (today) Removal of contaminants, vector, adaptors, etc Put overlapping sequence together and calculate bigger sequences 3. Analysis/Annotation
More informationBiomedical Genomics Workbench APPLICATION BASED MANUAL
Biomedical Genomics Workbench APPLICATION BASED MANUAL Manual for Biomedical Genomics Workbench 4.0 Windows, Mac OS X and Linux January 23, 2017 This software is for research purposes only. QIAGEN Aarhus
More informationRsubread package: high-performance read alignment, quantification and mutation discovery
Rsubread package: high-performance read alignment, quantification and mutation discovery Wei Shi 14 September 2015 1 Introduction This vignette provides a brief description to the Rsubread package. For
More informationPODKAT. An R Package for Association Testing Involving Rare and Private Variants. Ulrich Bodenhofer
Software Manual Institute of Bioinformatics, Johannes Kepler University Linz PODKAT An R Package for Association Testing Involving Rare and Private Variants Ulrich Bodenhofer Institute of Bioinformatics,
More informationDocumentation of S MART
Documentation of S MART Matthias Zytnicki March 14, 2012 Contents 1 Introduction 3 2 Installation and requirements 3 2.1 For Windows............................. 3 2.2 For Mac................................
More informationpanda Documentation Release 1.0 Daniel Vera
panda Documentation Release 1.0 Daniel Vera February 12, 2014 Contents 1 mat.make 3 1.1 Usage and option summary....................................... 3 1.2 Arguments................................................
More informationITMO Ecole de Bioinformatique Hands-on session: smallrna-seq N. Servant 21 rd November 2013
ITMO Ecole de Bioinformatique Hands-on session: smallrna-seq N. Servant 21 rd November 2013 1. Data and objectives We will use the data from GEO (GSE35368, Toedling, Servant et al. 2011). Two samples were
More informationRNA-Seq. Joshua Ainsley, PhD Postdoctoral Researcher Lab of Leon Reijmers Neuroscience Department Tufts University
RNA-Seq Joshua Ainsley, PhD Postdoctoral Researcher Lab of Leon Reijmers Neuroscience Department Tufts University joshua.ainsley@tufts.edu Day four Quantifying expression Intro to R Differential expression
More informationROTS: Reproducibility Optimized Test Statistic
ROTS: Reproducibility Optimized Test Statistic Fatemeh Seyednasrollah, Tomi Suomi, Laura L. Elo fatsey (at) utu.fi March 3, 2016 Contents 1 Introduction 2 2 Algorithm overview 3 3 Input data 3 4 Preprocessing
More information