Introduction to Read Alignment. UCD Genome Center Bioinformatics Core Tuesday 15 September 2015
|
|
|
- Donald Gregory
- 5 years ago
- Views:
Transcription
1 Introduction to Read Alignment UCD Genome Center Bioinformatics Core Tuesday 15 September 2015
2 From reads to molecules
3 Why align? Individual A Individual B ATGATAGCATCGTCGGGTGTCTGCTCAATAATAGTGCCGTATCATGCTGGTGTTATAATCGCCGCATGACATGATCAATGG CAATAAAAGTGCCGTATCATGCTGGTGTTACAATCGCCGCA CGTATCATGCTGGTGTTACAATCGCCGCATGACATGATCAATGG TGTCTGCTCAATAAAAGTGCCGTATCATGCTGGTGTTACAATC ATCGTCGGGTGTCTGCTCAATAAAAGTGCCGTATCATG--GGTGTTATAA CTCAATAAGAGTGCCGTATCATG--GGTGTTATAATCGCCGCA GTTATAATCGCCGCATGACATGATCAATGG To measure variation.
4 Why align?
5 Why align?
6 Short Read Aligners (DNA, not RNA) Short read (Illumina) aligners (e.g. MAQ, BWA aln ) were originally glocal = global with respect to the read, local with respect to the reference only full length read alignments with no indels found. Due to increasing read lengths, improved algorithms, desire for SV detection current short read aligners (BWA MEM, Bowtie2) can find local ( = partial) alignments within reads. Throughput continues to grow
7 Short Read Aligners (DNA, not RNA) Summer 2015:... >400 Gb per day* * HiSeq 3000/4000 Specification Sheet
8 Burrows-Wheeler Aligners Burrows-Wheeler Transform used in bzip2 file compression tool; FM-index (Ferragina & Manzini) allow efficient finding of substring matches within compressed text algorithm is sub-linear with respect to time and storage space required for a certain set of input data (reference 'ome, essentially). Reduced memory footprint, faster execution.
9 BWA BWA is fast, and can do gapped alignments. When run without seeding, it will find all hits within a given edit distance (short read aligner). Current long read aligner is also fast, and can find chimeric / local alignments for multiple read technologies. BWA is actively developed and has a strong user / developer community. bio-bwa.sourceforge.net Short reads under 200 bp BWA Backtrack = bwa aln Li H. and Durbin R. (2009) Fast and accurate short read alignment with Burrows- Wheeler Transform. Bioinformatics, 25: [PMID: ] Long reads over 200 bp BWA BWASW = bwa bwasw Li H. and Durbin R. (2010) Fast and accurate long read alignment with Burrows- Wheeler Transform. Bioinformatics, 26: [PMID: ] Long reads over 200 bp BWA-MEM = bwa mem [no publication yet]
10 Bowtie Bowtie (now Bowtie 2) is probably faster than BWA for some types of alignment, but it may not find the best alignments (see discussions on sensitivity, accuracy on SeqAnswers.com). Bowtie is part of a suite of tools (Bowtie, Tophat, Cufflinks, CummeRbund, Ballgown, Monocle...) that address data analysis for RNA-Seq experiments. Langmead B, Salzberg S (2012) Fast gapped-read alignment with Bowtie2 Nature Methods 9:357 [doi: /nmeth.1923]
11 Alignment concepts / parameters Paired-End reads Mate-Paired reads
12 Alignment concepts / parameters
13 Alignment concepts / parameters
14 Alignment concepts / parameters
15 Alignment concepts / parameters
16 Alignment Viewers IGV (Integrated Genomics Viewer) BAMview, tview (in SAMtools), IGB, GenomeView, SAMscope... UCSC Genome Browser, GBrowse
17 IGV red box indicates region of reference in view below coverage track: read coverage depth plot read alignments: (various view styles - squished shown here) read positions, orientations, pairing, sequence that disagrees with reference highlighted, improper pairs highlighted, etc. annotation tracks (GTF, BED, etc.)
18 IGV colored bases where they disagree with reference (substitution, indel, etc.) improper pairs (mate aligns far away, in wrong orientation, or on another chromosome) reference sequence, reading frames, etc.
19 IGV More on IGV s interface, file formats, and display can be found here: More on interpreting and customizing IGV s display can be found here:
Aligners. J Fass 23 August 2017
Aligners J Fass 23 August 2017 Definitions Assembly: I ve found the shredded remains of an important document; put it back together! UC Davis Genome Center Bioinformatics Core J Fass Aligners 2017-08-23
Aligners. J Fass 21 June 2017
Aligners J Fass 21 June 2017 Definitions Assembly: I ve found the shredded remains of an important document; put it back together! UC Davis Genome Center Bioinformatics Core J Fass Aligners 2017-06-21
SAM and VCF formats. UCD Genome Center Bioinformatics Core Tuesday 14 June 2016
SAM and VCF formats UCD Genome Center Bioinformatics Core Tuesday 14 June 2016 File Format: SAM / BAM / CRAM! NEW http://samtools.sourceforge.net/ - deprecated! http://www.htslib.org/ - SAMtools 1.0 and
RNA-seq. Manpreet S. Katari
RNA-seq Manpreet S. Katari Evolution of Sequence Technology Normalizing the Data RPKM (Reads per Kilobase of exons per million reads) Score = R NT R = # of unique reads for the gene N = Size of the gene
Short Read Alignment. Mapping Reads to a Reference
Short Read Alignment Mapping Reads to a Reference Brandi Cantarel, Ph.D. & Daehwan Kim, Ph.D. BICF 05/2018 Introduction to Mapping Short Read Aligners DNA vs RNA Alignment Quality Pitfalls and Improvements
Mapping NGS reads for genomics studies
Mapping NGS reads for genomics studies Valencia, 28-30 Sep 2015 BIER Alejandro Alemán aaleman@cipf.es Genomics Data Analysis CIBERER Where are we? Fastq Sequence preprocessing Fastq Alignment BAM Visualization
Read Mapping. Slides by Carl Kingsford
Read Mapping Slides by Carl Kingsford Bowtie Ultrafast and memory-efficient alignment of short DNA sequences to the human genome Ben Langmead, Cole Trapnell, Mihai Pop and Steven L Salzberg, Genome Biology
High-throughput sequencing: Alignment and related topic. Simon Anders EMBL Heidelberg
High-throughput sequencing: Alignment and related topic Simon Anders EMBL Heidelberg Established platforms HTS Platforms Illumina HiSeq, ABI SOLiD, Roche 454 Newcomers: Benchtop machines 454 GS Junior,
RNA-seq Data Analysis
Seyed Abolfazl Motahari RNA-seq Data Analysis Basics Next Generation Sequencing Biological Samples Data Cost Data Volume Big Data Analysis in Biology تحلیل داده ها کنترل سیستمهای بیولوژیکی تشخیص بیماریها
GPUBwa -Parallelization of Burrows Wheeler Aligner using Graphical Processing Units
GPUBwa -Parallelization of Burrows Wheeler Aligner using Graphical Processing Units Abstract A very popular discipline in bioinformatics is Next-Generation Sequencing (NGS) or DNA sequencing. It specifies
Under the Hood of Alignment Algorithms for NGS Researchers
Under the Hood of Alignment Algorithms for NGS Researchers April 16, 2014 Gabe Rudy VP of Product Development Golden Helix Questions during the presentation Use the Questions pane in your GoToWebinar window
High-throughput sequencing: Alignment and related topic. Simon Anders EMBL Heidelberg
High-throughput sequencing: Alignment and related topic Simon Anders EMBL Heidelberg Established platforms HTS Platforms Illumina HiSeq, ABI SOLiD, Roche 454 Newcomers: Benchtop machines: Illumina MiSeq,
Bioinformatics in next generation sequencing projects
Bioinformatics in next generation sequencing projects Rickard Sandberg Assistant Professor Department of Cell and Molecular Biology Karolinska Institutet March 2011 Once sequenced the problem becomes computational
Galaxy Platform For NGS Data Analyses
Galaxy Platform For NGS Data Analyses Weihong Yan wyan@chem.ucla.edu Collaboratory Web Site http://qcb.ucla.edu/collaboratory Collaboratory Workshops Workshop Outline ü Day 1 UCLA galaxy and user account
Pre-processing and quality control of sequence data. Barbera van Schaik KEBB - Bioinformatics Laboratory
Pre-processing and quality control of sequence data Barbera van Schaik KEBB - Bioinformatics Laboratory b.d.vanschaik@amc.uva.nl Topic: quality control and prepare data for the interesting stuf Keep Throw
Review of Recent NGS Short Reads Alignment Tools BMI-231 final project, Chenxi Chen Spring 2014
Review of Recent NGS Short Reads Alignment Tools BMI-231 final project, Chenxi Chen Spring 2014 Deciphering the information contained in DNA sequences began decades ago since the time of Sanger sequencing.
Welcome to MAPHiTS (Mapping Analysis Pipeline for High-Throughput Sequences) tutorial page.
Welcome to MAPHiTS (Mapping Analysis Pipeline for High-Throughput Sequences) tutorial page. In this page you will learn to use the tools of the MAPHiTS suite. A little advice before starting : rename your
File Formats: SAM, BAM, and CRAM. UCD Genome Center Bioinformatics Core Tuesday 15 September 2015
File Formats: SAM, BAM, and CRAM UCD Genome Center Bioinformatics Core Tuesday 15 September 2015 / BAM / CRAM NEW! http://samtools.sourceforge.net/ - deprecated! http://www.htslib.org/ - SAMtools 1.0 and
NGS Data Visualization and Exploration Using IGV
1 What is Galaxy Galaxy for Bioinformaticians Galaxy for Experimental Biologists Using Galaxy for NGS Analysis NGS Data Visualization and Exploration Using IGV 2 What is Galaxy Galaxy for Bioinformaticians
Illumina Next Generation Sequencing Data analysis
Illumina Next Generation Sequencing Data analysis Chiara Dal Fiume Sr Field Application Scientist Italy 2010 Illumina, Inc. All rights reserved. Illumina, illuminadx, Solexa, Making Sense Out of Life,
Maize genome sequence in FASTA format. Gene annotation file in gff format
Exercise 1. Using Tophat/Cufflinks to analyze RNAseq data. Step 1. One of CBSU BioHPC Lab workstations has been allocated for your workshop exercise. The allocations are listed on the workshop exercise
Resequencing and Mapping. Andreas Gisel Inernational Institute of Tropical Agriculture (IITA) Ibadan, Nigeria
Resequencing and Mapping Andreas Gisel Inernational Institute of Tropical Agriculture (IITA) Ibadan, Nigeria The Principle of Mapping reads good, ood_, d_mo, morn, orni, ning, ing_, g_be, beau, auti, utif,
RNA-Seq in Galaxy: Tuxedo protocol. Igor Makunin, UQ RCC, QCIF
RNA-Seq in Galaxy: Tuxedo protocol Igor Makunin, UQ RCC, QCIF Acknowledgments Genomics Virtual Lab: gvl.org.au Galaxy for tutorials: galaxy-tut.genome.edu.au Galaxy Australia: galaxy-aust.genome.edu.au
A Fast Read Alignment Method based on Seed-and-Vote For Next GenerationSequencing
A Fast Read Alignment Method based on Seed-and-Vote For Next GenerationSequencing Song Liu 1,2, Yi Wang 3, Fei Wang 1,2 * 1 Shanghai Key Lab of Intelligent Information Processing, Shanghai, China. 2 School
Colorado State University Bioinformatics Algorithms Assignment 6: Analysis of High- Throughput Biological Data Hamidreza Chitsaz, Ali Sharifi- Zarchi
Colorado State University Bioinformatics Algorithms Assignment 6: Analysis of High- Throughput Biological Data Hamidreza Chitsaz, Ali Sharifi- Zarchi Although a little- bit long, this is an easy exercise
Short Read Alignment Algorithms
Short Read Alignment Algorithms Raluca Gordân Department of Biostatistics and Bioinformatics Department of Computer Science Department of Molecular Genetics and Microbiology Center for Genomic and Computational
SlopMap: a software application tool for quick and flexible identification of similar sequences using exact k-mer matching
SlopMap: a software application tool for quick and flexible identification of similar sequences using exact k-mer matching Ilya Y. Zhbannikov 1, Samuel S. Hunter 1,2, Matthew L. Settles 1,2, and James
Scalable RNA Sequencing on Clusters of Multicore Processors
JOAQUÍN DOPAZO JOAQUÍN TARRAGA SERGIO BARRACHINA MARÍA ISABEL CASTILLO HÉCTOR MARTÍNEZ ENRIQUE S. QUINTANA ORTÍ IGNACIO MEDINA INTRODUCTION DNA Exon 0 Exon 1 Exon 2 Intron 0 Intron 1 Reads Sequencing RNA
RNA-Seq Analysis With the Tuxedo Suite
June 2016 RNA-Seq Analysis With the Tuxedo Suite Dena Leshkowitz Introduction In this exercise we will learn how to analyse RNA-Seq data using the Tuxedo Suite tools: Tophat, Cuffmerge, Cufflinks and Cuffdiff.
GenomeStudio Software Release Notes
GenomeStudio Software 2009.2 Release Notes 1. GenomeStudio Software 2009.2 Framework... 1 2. Illumina Genome Viewer v1.5...2 3. Genotyping Module v1.5... 4 4. Gene Expression Module v1.5... 6 5. Methylation
High-throughout sequencing and using short-read aligners. Simon Anders
High-throughout sequencing and using short-read aligners Simon Anders High-throughput sequencing (HTS) Sequencing millions of short DNA fragments in parallel. a.k.a.: next-generation sequencing (NGS) massively-parallel
Variation among genomes
Variation among genomes Comparing genomes The reference genome http://www.ncbi.nlm.nih.gov/nuccore/26556996 Arabidopsis thaliana, a model plant Col-0 variety is from Landsberg, Germany Ler is a mutant
Analysis of ChIP-seq data
Before we start: 1. Log into tak (step 0 on the exercises) 2. Go to your lab space and create a folder for the class (see separate hand out) 3. Connect to your lab space through the wihtdata network and
Using Galaxy for NGS Analyses Luce Skrabanek
Using Galaxy for NGS Analyses Luce Skrabanek Registering for a Galaxy account Before we begin, first create an account on the main public Galaxy portal. Go to: https://main.g2.bx.psu.edu/ Under the User
The Galaxy Track Browser: Transforming the Genome Browser from Visualization Tool to Analysis Tool
The Galaxy Track Browser: Transforming the Genome Browser from Visualization Tool to Analysis Tool Jeremy Goecks * Kanwei Li Ω Dave Clements ℵ The Galaxy Team James Taylor ℇ Emory University Emory University
Next generation sequencing: assembly by mapping reads. Laurent Falquet, Vital-IT Helsinki, June 3, 2010
Next generation sequencing: assembly by mapping reads Laurent Falquet, Vital-IT Helsinki, June 3, 2010 Overview What is assembly by mapping? Methods BWT File formats Tools Issues Visualization Discussion
NGS Analysis Using Galaxy
NGS Analysis Using Galaxy Sequences and Alignment Format Galaxy overview and Interface Get;ng Data in Galaxy Analyzing Data in Galaxy Quality Control Mapping Data History and workflow Galaxy Exercises
NGS Data and Sequence Alignment
Applications and Servers SERVER/REMOTE Compute DB WEB Data files NGS Data and Sequence Alignment SSH WEB SCP Manpreet S. Katari App Aug 11, 2016 Service Terminal IGV Data files Window Personal Computer/Local
Cyverse tutorial 1 Logging in to Cyverse and data management. Open an Internet browser window and navigate to the Cyverse discovery environment:
Cyverse tutorial 1 Logging in to Cyverse and data management Open an Internet browser window and navigate to the Cyverse discovery environment: https://de.cyverse.org/de/ Click Log in with your CyVerse
Long Read RNA-seq Mapper
UNIVERSITY OF ZAGREB FACULTY OF ELECTRICAL ENGENEERING AND COMPUTING MASTER THESIS no. 1005 Long Read RNA-seq Mapper Josip Marić Zagreb, February 2015. Table of Contents 1. Introduction... 1 2. RNA Sequencing...
Aligning reads: tools and theory
Aligning reads: tools and theory Genome Sequence read :LM-Mel-14neg :LM-Mel-42neg :LM-Mel-14neg :LM-Mel-14pos :LM-Mel-42neg :LM-Mel-14neg :LM-Mel-42neg :LM-Mel-14neg chrx: 152139280 152139290 152139300
Galaxy workshop at the Winter School Igor Makunin
Galaxy workshop at the Winter School 2016 Igor Makunin i.makunin@uq.edu.au Winter school, UQ, July 6, 2016 Plan Overview of the Genomics Virtual Lab Introduce Galaxy, a web based platform for analysis
UNIVERSITY OF OSLO. Department of informatics. Parallel alignment of short sequence reads on graphics processors. Master thesis. Bjørnar Andreas Ruud
UNIVERSITY OF OSLO Department of informatics Parallel alignment of short sequence reads on graphics processors Master thesis Bjørnar Andreas Ruud April 29, 2011 2 Table of Contents 1 Abstract... 7 2 Acknowledgements...
Read Mapping and Assembly
Statistical Bioinformatics: Read Mapping and Assembly Stefan Seemann seemann@rth.dk University of Copenhagen April 9th 2019 Why sequencing? Why sequencing? Which organism does the sample comes from? Assembling
BGGN-213: FOUNDATIONS OF BIOINFORMATICS (Lecture 14)
BGGN-213: FOUNDATIONS OF BIOINFORMATICS (Lecture 14) Genome Informatics (Part 1) https://bioboot.github.io/bggn213_f17/lectures/#14 Dr. Barry Grant Nov 2017 Overview: The purpose of this lab session is
The Burrows-Wheeler Transform and Bioinformatics. J. Matthew Holt April 1st, 2015
The Burrows-Wheeler Transform and Bioinformatics J. Matthew Holt April 1st, 2015 Outline Recall Suffix Arrays The Burrows-Wheeler Transform The FM-index Pattern Matching Multi-string BWTs Merge Algorithms
!"#$%&$'()#$*)+,-./).01"0#,23+3,303456"6,&((46,7$+-./&((468,
!"#$%&$'()#$*)+,-./).01"0#,23+3,303456"6,&((46,7$+-./&((468, 9"(1(02)1+(',:.;.4(*.',?9@A,!."2.4B.'#A,C(;.
Mapping and Viewing Deep Sequencing Data bowtie2, samtools, igv
Mapping and Viewing Deep Sequencing Data bowtie2, samtools, igv Frederick J Tan Bioinformatics Research Faculty Carnegie Institution of Washington, Department of Embryology tan@ciwemb.edu 27 August 2013
Omega: an Overlap-graph de novo Assembler for Metagenomics
Omega: an Overlap-graph de novo Assembler for Metagenomics B a h l e l H a i d e r, Ta e - H y u k A h n, B r i a n B u s h n e l l, J u a n j u a n C h a i, A l e x C o p e l a n d, C h o n g l e Pa n
INTRODUCTION AUX FORMATS DE FICHIERS
INTRODUCTION AUX FORMATS DE FICHIERS Plan. Formats de séquences brutes.. Format fasta.2. Format fastq 2. Formats d alignements 2.. Format SAM 2.2. Format BAM 4. Format «Variant Calling» 4.. Format Varscan
USING BRAT-BW Table 1. Feature comparison of BRAT-bw, BRAT-large, Bismark and BS Seeker (as of on March, 2012)
USING BRAT-BW-2.0.1 BRAT-bw is a tool for BS-seq reads mapping, i.e. mapping of bisulfite-treated sequenced reads. BRAT-bw is a part of BRAT s suit. Therefore, input and output formats for BRAT-bw are
Basics of high- throughput sequencing
InsBtute for ComputaBonal Biomedicine Basics of high- throughput sequencing Olivier Elemento, PhD TA: Jenny Giannopoulou, PhD Plan 1. What high- throughput sequencing is used for 2. Illumina technology
A Nearest Neighbors Algorithm for Strings. R. Lederman Technical Report YALEU/DCS/TR-1453 April 5, 2012
A randomized algorithm is presented for fast nearest neighbors search in libraries of strings. The algorithm is discussed in the context of one of the practical applications: aligning DNA reads to a reference
RNAseq analysis: SNP calling. BTI bioinformatics course, spring 2013
RNAseq analysis: SNP calling BTI bioinformatics course, spring 2013 RNAseq overview RNAseq overview Choose technology 454 Illumina SOLiD 3 rd generation (Ion Torrent, PacBio) Library types Single reads
David Crossman, Ph.D. UAB Heflin Center for Genomic Science. GCC2012 Wednesday, July 25, 2012
David Crossman, Ph.D. UAB Heflin Center for Genomic Science GCC2012 Wednesday, July 25, 2012 Galaxy Splash Page Colors Random Galaxy icons/colors Queued Running Completed Download/Save Failed Icons Display
Genomic Files. University of Massachusetts Medical School. October, 2014
.. Genomic Files University of Massachusetts Medical School October, 2014 2 / 39. A Typical Deep-Sequencing Workflow Samples Fastq Files Fastq Files Sam / Bam Files Various files Deep Sequencing Further
Next Generation Sequence Alignment on the BRC Cluster. Steve Newhouse 22 July 2010
Next Generation Sequence Alignment on the BRC Cluster Steve Newhouse 22 July 2010 Overview Practical guide to processing next generation sequencing data on the cluster No details on the inner workings
Our typical RNA quantification pipeline
RNA-Seq primer Our typical RNA quantification pipeline Upload your sequence data (fastq) Align to the ribosome (Bow>e) Align remaining reads to genome (TopHat) or transcriptome (RSEM) Make report of quality
Halvade: scalable sequence analysis with MapReduce
Bioinformatics Advance Access published March 26, 2015 Halvade: scalable sequence analysis with MapReduce Dries Decap 1,5, Joke Reumers 2,5, Charlotte Herzeel 3,5, Pascal Costanza, 4,5 and Jan Fostier
The Burrows-Wheeler Transform and Bioinformatics. J. Matthew Holt
The Burrows-Wheeler Transform and Bioinformatics J. Matthew Holt holtjma@cs.unc.edu Last Class - Multiple Pattern Matching Problem m - length of text d - max length of pattern x - number of patterns Method
Accelerating Genomic Sequence Alignment Workload with Scalable Vector Architecture
Accelerating Genomic Sequence Alignment Workload with Scalable Vector Architecture Dong-hyeon Park, Jon Beaumont, Trevor Mudge University of Michigan, Ann Arbor Genomics Past Weeks ~$3 billion Human Genome
Sequence Analysis Pipeline
Sequence Analysis Pipeline Transcript fragments 1. PREPROCESSING 2. ASSEMBLY (today) Removal of contaminants, vector, adaptors, etc Put overlapping sequence together and calculate bigger sequences 3. Analysis/Annotation
NGS FASTQ file format
NGS FASTQ file format Line1: Begins with @ and followed by a sequence idenefier and opeonal descripeon Line2: Raw sequence leiers Line3: + Line4: Encodes the quality values for the sequence in Line2 (see
Variant calling using SAMtools
Variant calling using SAMtools Calling variants - a trivial use of an Interactive Session We are going to conduct the variant calling exercises in an interactive idev session just so you can get a feel
Genetics 211 Genomics Winter 2014 Problem Set 4
Genomics - Part 1 due Friday, 2/21/2014 by 9:00am Part 2 due Friday, 3/7/2014 by 9:00am For this problem set, we re going to use real data from a high-throughput sequencing project to look for differential
Dr. Gabriela Salinas Dr. Orr Shomroni Kaamini Rhaithata
Analysis of RNA sequencing data sets using the Galaxy environment Dr. Gabriela Salinas Dr. Orr Shomroni Kaamini Rhaithata Microarray and Deep-sequencing core facility 30.10.2017 RNA-seq workflow I Hypothesis
AgroMarker Finder manual (1.1)
AgroMarker Finder manual (1.1) 1. Introduction 2. Installation 3. How to run? 4. How to use? 5. Java program for calculating of restriction enzyme sites (TaqαI). 1. Introduction AgroMarker Finder (AMF)is
Tutorial: Using BWA aligner to identify low-coverage genomes in metagenome sample Umer Zeeshan Ijaz
Tutorial: Using BWA aligner to identify low-coverage genomes in metagenome sample Umer Zeeshan Ijaz We will use NexteraXT_even_1ng_HISEQ_AGGCAGAA-CTCTCTAT dataset to identify the list of genomes with low
EpiGnome Methyl Seq Bioinformatics User Guide Rev. 0.1
EpiGnome Methyl Seq Bioinformatics User Guide Rev. 0.1 Introduction This guide contains data analysis recommendations for libraries prepared using Epicentre s EpiGnome Methyl Seq Kit, and sequenced on
Bioinformatics for High-throughput Sequencing
Bioinformatics for High-throughput Sequencing An Overview Simon Anders EBI is an Outstation of the European Molecular Biology Laboratory. Overview In recent years, new sequencing schemes, also called high-throughput
ITMO Ecole de Bioinformatique Hands-on session: smallrna-seq N. Servant 21 rd November 2013
ITMO Ecole de Bioinformatique Hands-on session: smallrna-seq N. Servant 21 rd November 2013 1. Data and objectives We will use the data from GEO (GSE35368, Toedling, Servant et al. 2011). Two samples were
Next Generation Sequencing
Next Generation Sequencing Based on Lecture Notes by R. Shamir [7] E.M. Bakker 1 Overview Introduction Next Generation Technologies The Mapping Problem The MAQ Algorithm The Bowtie Algorithm Burrows-Wheeler
Lecture 12: January 6, Algorithms for Next Generation Sequencing Data
Computational Genomics Fall Semester, 2010 Lecture 12: January 6, 2011 Lecturer: Ron Shamir Scribe: Anat Gluzman and Eran Mick 12.1 Algorithms for Next Generation Sequencing Data 12.1.1 Introduction Ever
Ballgown. flexible RNA-seq differential expression analysis. Alyssa Frazee Johns Hopkins
Ballgown flexible RNA-seq differential expression analysis Alyssa Frazee Johns Hopkins Biostatistics @acfrazee RNA-seq data Reads (50-100 bases) Transcripts (RNA) Genome (DNA) [use tool of your choice]
AMAS: optimizing the partition and filtration of adaptive seeds to speed up read mapping
AMAS: optimizing the partition and filtration of adaptive seeds to speed up read mapping Ngoc Hieu Tran 1, * Email: nhtran@ntu.edu.sg Xin Chen 1 Email: chenxin@ntu.edu.sg 1 School of Physical and Mathematical
SAM : Sequence Alignment/Map format. A TAB-delimited text format storing the alignment information. A header section is optional.
Alignment of NGS reads, samtools and visualization Hands-on Software used in this practical BWA MEM : Burrows-Wheeler Aligner. A software package for mapping low-divergent sequences against a large reference
Supplementary Information. Detecting and annotating genetic variations using the HugeSeq pipeline
Supplementary Information Detecting and annotating genetic variations using the HugeSeq pipeline Hugo Y. K. Lam 1,#, Cuiping Pan 1, Michael J. Clark 1, Phil Lacroute 1, Rui Chen 1, Rajini Haraksingh 1,
WM2 Bioinformatics. ExomeSeq data analysis part 1. Dietmar Rieder
WM2 Bioinformatics ExomeSeq data analysis part 1 Dietmar Rieder RAW data Use putty to logon to cluster.i med.ac.at In your home directory make directory to store raw data $ mkdir 00_RAW Copy raw fastq
Part 1: How to use IGV to visualize variants
Using IGV to identify true somatic variants from the false variants http://www.broadinstitute.org/igv A FAQ, sample files and a user guide are available on IGV website If you use IGV in your publication:
Lam, TW; Li, R; Tam, A; Wong, S; Wu, E; Yiu, SM.
Title High throughput short read alignment via bi-directional BWT Author(s) Lam, TW; Li, R; Tam, A; Wong, S; Wu, E; Yiu, SM Citation The IEEE International Conference on Bioinformatics and Biomedicine
ChIP-seq hands-on practical using Galaxy
ChIP-seq hands-on practical using Galaxy In this exercise we will cover some of the basic NGS analysis steps for ChIP-seq using the Galaxy framework: Quality control Mapping of reads using Bowtie2 Peak-calling
Services Performed. The following checklist confirms the steps of the RNA-Seq Service that were performed on your samples.
Services Performed The following checklist confirms the steps of the RNA-Seq Service that were performed on your samples. SERVICE Sample Received Sample Quality Evaluated Sample Prepared for Sequencing
Genome 373: Mapping Short Sequence Reads III. Doug Fowler
Genome 373: Mapping Short Sequence Reads III Doug Fowler What is Galaxy? Galaxy is a free, open source web platform for running all sorts of computational analyses including pretty much all of the sequencing-related
Read mapping with BWA and BOWTIE
Read mapping with BWA and BOWTIE Before We Start In order to save a lot of typing, and to allow us some flexibility in designing these courses, we will establish a UNIX shell variable BASE to point to
Accurate Long-Read Alignment using Similarity Based Multiple Pattern Alignment and Prefix Tree Indexing
Proposal for diploma thesis Accurate Long-Read Alignment using Similarity Based Multiple Pattern Alignment and Prefix Tree Indexing Astrid Rheinländer 01-09-2010 Supervisor: Prof. Dr. Ulf Leser Motivation
Reads Alignment and Variant Calling
Reads Alignment and Variant Calling CB2-201 Computational Biology and Bioinformatics February 22, 2016 Emidio Capriotti http://biofold.org/ Institute for Mathematical Modeling of Biological Systems Department
CMSC423: Bioinformatic Algorithms, Databases and Tools. Exact string matching: Suffix trees Suffix arrays
CMSC423: Bioinformatic Algorithms, Databases and Tools Exact string matching: Suffix trees Suffix arrays Searching multiple strings Can we search multiple strings at the same time? Would it help if we
Ensembl RNASeq Practical. Overview
Ensembl RNASeq Practical The aim of this practical session is to use BWA to align 2 lanes of Zebrafish paired end Illumina RNASeq reads to chromosome 12 of the zebrafish ZV9 assembly. We have restricted
A Tutorial: Genome- based RNA- Seq Analysis Using the TUXEDO Package
A Tutorial: Genome- based RNA- Seq Analysis Using the TUXEDO Package The following data and software resources are required for following the tutorial. Data: ftp://ftp.broad.mit.edu/pub/users/bhaas/rnaseq_workshop/rnaseq_workshop_dat
I519 Introduction to Bioinformatics. Indexing techniques. Yuzhen Ye School of Informatics & Computing, IUB
I519 Introduction to Bioinformatics Indexing techniques Yuzhen Ye (yye@indiana.edu) School of Informatics & Computing, IUB Contents We have seen indexing technique used in BLAST Applications that rely
A Virtual Machine to teach NGS data analysis. Andreas Gisel CNR - ITB Bari, Italy
A Virtual Machine to teach NGS data analysis Andreas Gisel CNR - ITB Bari, Italy The Virtual Machine A virtual machine is a tightly isolated software container that can run its own operating systems and
GSNAP: Fast and SNP-tolerant detection of complex variants and splicing in short reads by Thomas D. Wu and Serban Nacu
GSNAP: Fast and SNP-tolerant detection of complex variants and splicing in short reads by Thomas D. Wu and Serban Nacu Matt Huska Freie Universität Berlin Computational Methods for High-Throughput Omics
Resolving Load Balancing Issues in BWA on NUMA Multicore Architectures
Resolving Load Balancing Issues in BWA on NUMA Multicore Architectures Charlotte Herzeel 1,4, Thomas J. Ashby 1,4 Pascal Costanza 3,4, and Wolfgang De Meuter 2 1 imec, Kapeldreef 75, B-3001 Leuven, Belgium,
BRAT-BW: Efficient and accurate mapping of bisulfite-treated reads [Supplemental Material]
![BRAT-BW: Efficient and accurate mapping of bisulfite-treated reads [Supplemental Material]](/thumbs/72/66393769.jpg "BRAT-BW: Efficient and accurate mapping of bisulfite-treated reads [Supplemental Material]")
BRAT-BW: Efficient and accurate mapping of bisulfite-treated reads [Supplemental Material] Elena Y. Harris 1, Nadia Ponts 2,3, Karine G. Le Roch 2 and Stefano Lonardi 1 1 Department of Computer Science
SAM / BAM Tutorial. EMBL Heidelberg. Course Materials. Tobias Rausch September 2012
SAM / BAM Tutorial EMBL Heidelberg Course Materials Tobias Rausch September 2012 Contents 1 SAM / BAM 3 1.1 Introduction................................... 3 1.2 Tasks.......................................
Genomic Files. University of Massachusetts Medical School. October, 2015
.. Genomic Files University of Massachusetts Medical School October, 2015 2 / 55. A Typical Deep-Sequencing Workflow Samples Fastq Files Fastq Files Sam / Bam Files Various files Deep Sequencing Further
SpliceTAPyR - An efficient method for transcriptome alignment
International Journal of Foundations of Computer Science c World Scientific Publishing Company SpliceTAPyR - An efficient method for transcriptome alignment Andreia Sofia Teixeira IDSS Lab, INESC-ID /
RCAC. Job files Example: Running seqyclean (a module)
RCAC Job files Why? When you log into an RCAC server you are using a special server designed for multiple users. This is called a frontend node ( or sometimes a head node). There are (I think) three front
Mapping reads to a reference genome
Introduction Mapping reads to a reference genome Dr. Robert Kofler October 17, 2014 Dr. Robert Kofler Mapping reads to a reference genome October 17, 2014 1 / 52 Introduction RESOURCES the lecture: http://drrobertkofler.wikispaces.com/ngsandeelecture
A Comparison of Seed-and-Extend Techniques in Modern DNA Read Alignment Algorithms
Delft University of Technology A Comparison of Seed-and-Extend Techniques in Modern DNA Read Alignment Algorithms Ahmed, Nauman; Bertels, Koen; Al-Ars, Zaid DOI 10.1109/BIBM.2016.7822731 Publication date