Background and Strategy. Smitha, Adrian, Devin, Jeff, Ali, Sanjeev, Karthikeyan
|
|
- Pauline Stone
- 6 years ago
- Views:
Transcription
1 Background and Strategy Smitha, Adrian, Devin, Jeff, Ali, Sanjeev, Karthikeyan
2 What is a genome browser? A web/desktop based graphical tool for rapid and reliable display of any requested portion of the genome at any scale, integrated with a large collection of annotations. A browser could be configured to display, Genome sequence -contigs \ -assembly -mrna -ESTs -Poly A sites -Splicing boundaries -Non coding RNAs -multiple gene predictions -gene expression -qpcr primers -Origin of replication -conserved sites -cross-species homologies -SNPs -in/dels -CNVs -Inversions
3 -transposons -repeats -microsatellites -DNAse hypersensitivity sites -TF binding sites -DNA Methylation sites -Literature -GWAS catalog -Mutations (OMIM) Text and sequence-based searches provide quick and precise access to any region of specific interest. Secondary links from individual features lead to sequence details and supplementary off-site databases. Representation of data along a single co-ordinate axis is the USP of a genome browser *The Human Genome Browser at UCSC,W. James Kent, Charles W. Sugnet, Terrence S. Furey, et al.,genome Res :
4 The browser history ;) C.elegans database (ACEDB) (Eeckman and Urbin,1995) The Saccharomyces Genome Database (SGD) (Cherry et al, 1998) N.Meningitidis browser (Comp Genomics et al, 2014) Ensembl (Birney et al, 2001) UCSC genome browser (Kent et al, 2002)
5 Genome Browser Examples UCSC UTGB Dalliance GBrowse JBrowse
6 UCSC
7 UCSC (University of California, Santa Cruz) Shows annotations for variable chromosomal region size Designed to handle large volume of complex data quickly Overkill For each fasta file, need to make several converted files and many tables in db.
8 UTGB
9 UTGB (University of Tokyo Genome Browser) Uses AJAX-based web interfaces to avoid excessive reloading of web pages Already equipped with a stand-alone web server and database management system for querying genome databases for easy installation. Generated genome browsers work in Windows, Mac and Linux and can be deployed to remote web servers. Lastest update December 1, 2011
10 Dalliance
11 Lightweight visualization tool HTML5 DAS (Distributed Annotation System) System deals badly with searches which match to more than one region of the genome
12 GBrowse
13 The Generic Model Organism Database Project (GMOD) developed the Generic Genome Browser (Gbrowse) Perl based Customizable plug in, blast, dump and import many formats Glyph library
14 JBrowse
15 Fast, smooth navigation and zooming Can handle multi-gigabase genomes and deep-coverage sequencing Supports BED, GFF3, FASTA, BioLLDB, Chado, WIG, BAM, BigWig, UCSC (intron/exon structure, name lookups, quantitative plots). Relatively easy to get running Capable of thousands of track selections Very lightweight. Requires little server resource requirements (no back-end server code, just data file formatting tools read directly over HTTP)
16 JBrowse Details
17 Storing/Querying Data Contig1 GENE id=g1135;name=glmm;signature="glmm: phosphoglucosamine mutase",... Contig1 GENE id=g469;name=folp; Synonyms=dhpS;signature="Pterin binding enzyme",...
18 Storing/Querying Data Ordered by Start: ABCDEFGHIJKLMNOP SELECT * FROM Intervals Ordered by End: ABEDFHGJICKMLNPO WHERE Interval.Start < Query.End AND Interval.End > Query.Start Alekseyenko AV, Lee CJ. Nested Containment List (NCList): a new algorithm for accelerating interval query of genome alignment and interval databases. Bioinformatics. 2007;23(11):
19 Nested Containment List Store data as a tree where each interval keeps a sublist of contained intervals. Sorts sublist intervals by start AND end simultaneously.
20 Storing/Querying Data Alekseyenko AV, Lee CJ. Nested Containment List (NCList): a new algorithm for accelerating interval query of genome alignment and interval databases. Bioinformatics. 2007;23(11):
21 Storing/Querying Data JBrowse: NC List UCSC: Binning GBrowse: R-Tree Alekseyenko AV, Lee CJ. Nested Containment List (NCList): a new algorithm for accelerating interval query of genome alignment and interval databases. Bioinformatics. 2007;23(11):
22 Storing/Querying Data JBrowse DOES NOT use a relational database!!! Nested Containment List not implemented in a relational database at the start of JBrowse development Has since been implemented, but not in use by JBrowse Wiley LK, Sivley RM, Bush WS. Rapid storage and retrieval of genomic intervals from a relational database system using nested containment lists. Database (Oxford). 2013;2013:bat056.
23 Extra Features BLAST BLAST ATLAS (Genewiz, Brigs) TREES ALIGNMENTS (MAUVE) SNP CALLING MULTIPLE SEQUENCE ALIGNMENT
Genome Browser. Background & Strategy. Spring 2017 Faction II
Genome Browser Background & Strategy Spring 2017 Faction II Outline Beginning of the Last Phase Goals State of Art Applicable Genome Browsers Not So Genome Browsers Storing Data Strategy for the website
More informationJBrowse. To get started early: Double click VirtualBox on the desktop Click JBrowse 2016 Tutorial Click Start
JBrowse To get started early: Double click VirtualBox on the desktop Click JBrowse 2016 Tutorial Click Start JBrowse PAG 2015 Scott Cain GMOD Coordinator scott@scottcain.net What is GMOD? A set of interoperable
More informationGenome Browser. Background and Strategy
Genome Browser Background and Strategy Contents What is a genome browser? Purpose of a genome browser Examples Structure Extra Features Contents What is a genome browser? Purpose of a genome browser Examples
More informationGenome Browsers Guide
Genome Browsers Guide Take a Class This guide supports the Galter Library class called Genome Browsers. See our Classes schedule for the next available offering. If this class is not on our upcoming schedule,
More informationGenome Browsers - The UCSC Genome Browser
Genome Browsers - The UCSC Genome Browser Background The UCSC Genome Browser is a well-curated site that provides users with a view of gene or sequence information in genomic context for a specific species,
More informationToday's outline. Resources. Genome browser components. Genome browsers: Discovering biology through genomics. Genome browser tutorial materials
Today's outline Genome browsers: Discovering biology through genomics BaRC Hot Topics April 2013 George Bell, Ph.D. http://jura.wi.mit.edu/bio/education/hot_topics/ Genome browser introduction Popular
More informationGenome Browser Background and Strategy
Genome Browser Background and Strategy April 12th, 2017 BIOL 7210 - Faction I (Outbreak) - Genome Browser Group Adam Dabrowski Mrunal Dehankar Shareef Khalid Hubert Pan Ajay Ramakrishnan Ankit Srivastava
More informationAdvanced genome browsers: Integrated Genome Browser and others Heiko Muller Computational Research
Genomic Computing, DEIB, 4-7 March 2013 Advanced genome browsers: Integrated Genome Browser and others Heiko Muller Computational Research IIT@SEMM heiko.muller@iit.it List of Genome Browsers Alamut Annmap
More informationBrowser Exercises - I. Alignments and Comparative genomics
Browser Exercises - I Alignments and Comparative genomics 1. Navigating to the Genome Browser (GBrowse) Note: For this exercise use http://www.tritrypdb.org a. Navigate to the Genome Browser (GBrowse)
More informationHow to use KAIKObase Version 3.1.0
How to use KAIKObase Version 3.1.0 Version3.1.0 29/Nov/2010 http://sgp2010.dna.affrc.go.jp/kaikobase/ Copyright National Institute of Agrobiological Sciences. All rights reserved. Outline 1. System overview
More informationGenome Browser. Shruti Bhide Abhiram Das Khanjan Gandhi Viswateja Nelakuditi
Genome Browser Shruti Bhide Abhiram Das Khanjan Gandhi Viswateja Nelakuditi Present Scenario Need of Databases and Genome Browser Present Scenario Need of Databases and Genome Browser Put all the ingredients
More informationChIP-seq (NGS) Data Formats
ChIP-seq (NGS) Data Formats Biological samples Sequence reads SRA/SRF, FASTQ Quality control SAM/BAM/Pileup?? Mapping Assembly... DE Analysis Variant Detection Peak Calling...? Counts, RPKM VCF BED/narrowPeak/
More informationIntroduction to Genome Browsers
Introduction to Genome Browsers Rolando Garcia-Milian, MLS, AHIP (Rolando.milian@ufl.edu) Department of Biomedical and Health Information Services Health Sciences Center Libraries, University of Florida
More informationAdvanced UCSC Browser Functions
Advanced UCSC Browser Functions Dr. Thomas Randall tarandal@email.unc.edu bioinformatics.unc.edu UCSC Browser: genome.ucsc.edu Overview Custom Tracks adding your own datasets Utilities custom tools for
More informationPart 1: How to use IGV to visualize variants
Using IGV to identify true somatic variants from the false variants http://www.broadinstitute.org/igv A FAQ, sample files and a user guide are available on IGV website If you use IGV in your publication:
More informationTutorial: How to use the Wheat TILLING database
Tutorial: How to use the Wheat TILLING database Last Updated: 9/7/16 1. Visit http://dubcovskylab.ucdavis.edu/wheat_blast to go to the BLAST page or click on the Wheat BLAST button on the homepage. 2.
More informationGenomic Analysis with Genome Browsers.
Genomic Analysis with Genome Browsers http://barc.wi.mit.edu/hot_topics/ 1 Outline Genome browsers overview UCSC Genome Browser Navigating: View your list of regions in the browser Available tracks (eg.
More informationSequencing Data. Paul Agapow 2011/02/03
Webservices for Next Generation Sequencing Data Paul Agapow 2011/02/03 Aims Assumed parameters: Must have a system for non-technical users to browse and manipulate their Next Generation Sequencing (NGS)
More informationAnalyzing Variant Call results using EuPathDB Galaxy, Part II
Analyzing Variant Call results using EuPathDB Galaxy, Part II In this exercise, we will work in groups to examine the results from the SNP analysis workflow that we started yesterday. The first step is
More informationHow to use earray to create custom content for the SureSelect Target Enrichment platform. Page 1
How to use earray to create custom content for the SureSelect Target Enrichment platform Page 1 Getting Started Access earray Access earray at: https://earray.chem.agilent.com/earray/ Log in to earray,
More informationGeneric Model Organism Database. Lavanya Rishishwar
Generic Model Organism Database Lavanya Rishishwar Outline Purpose Genome database Basics of webserver & database GMOD 4/7/2016 Generic Model Organism Database 2 Presentation Assumption What do we understand:
More informationNGS Data Visualization and Exploration Using IGV
1 What is Galaxy Galaxy for Bioinformaticians Galaxy for Experimental Biologists Using Galaxy for NGS Analysis NGS Data Visualization and Exploration Using IGV 2 What is Galaxy Galaxy for Bioinformaticians
More informationThe Galaxy Track Browser: Transforming the Genome Browser from Visualization Tool to Analysis Tool
The Galaxy Track Browser: Transforming the Genome Browser from Visualization Tool to Analysis Tool Jeremy Goecks * Kanwei Li Ω Dave Clements ℵ The Galaxy Team James Taylor ℇ Emory University Emory University
More informationYou will be re-directed to the following result page.
ENCODE Element Browser Goal: to navigate the candidate DNA elements predicted by the ENCODE consortium, including gene expression, DNase I hypersensitive sites, TF binding sites, and candidate enhancers/promoters.
More informationIntegrative Genomics Viewer. Prat Thiru
Integrative Genomics Viewer Prat Thiru 1 Overview User Interface Basics Browsing the Data Data Formats IGV Tools Demo Outline Based on ISMB 2010 Tutorial by Robinson and Thorvaldsdottir 2 Why IGV? IGV
More informationGenomics 92 (2008) Contents lists available at ScienceDirect. Genomics. journal homepage:
Genomics 92 (2008) 75 84 Contents lists available at ScienceDirect Genomics journal homepage: www.elsevier.com/locate/ygeno Review UCSC genome browser tutorial Ann S. Zweig a,, Donna Karolchik a, Robert
More informationThe UCSC Genome Browser
The UCSC Genome Browser Donna Karolchik, 1 Angie S. Hinrichs, 1 and W. James Kent 1 UNIT 1.4 1 Center for Biomolecular Science and Engineering, University of California Santa Cruz, Santa Cruz, California
More informationTutorial 1: Exploring the UCSC Genome Browser
Last updated: May 12, 2011 Tutorial 1: Exploring the UCSC Genome Browser Open the homepage of the UCSC Genome Browser at: http://genome.ucsc.edu/ In the blue bar at the top, click on the Genomes link.
More informationEasy visualization of the read coverage using the CoverageView package
Easy visualization of the read coverage using the CoverageView package Ernesto Lowy European Bioinformatics Institute EMBL June 13, 2018 > options(width=40) > library(coverageview) 1 Introduction This
More informationThe UCSC Genome Browser
The UCSC Genome Browser Search, retrieve and display the data that you want Materials prepared by Warren C. Lathe, Ph.D. Mary Mangan, Ph.D. www.openhelix.com Updated: Q3 2006 Version_0906 Copyright OpenHelix.
More informationBioinformatics in next generation sequencing projects
Bioinformatics in next generation sequencing projects Rickard Sandberg Assistant Professor Department of Cell and Molecular Biology Karolinska Institutet March 2011 Once sequenced the problem becomes computational
More informationExercise 2: Browser-Based Annotation and RNA-Seq Data
Exercise 2: Browser-Based Annotation and RNA-Seq Data Jeremy Buhler July 24, 2018 This exercise continues your introduction to practical issues in comparative annotation. You ll be annotating genomic sequence
More informationCLC Server. End User USER MANUAL
CLC Server End User USER MANUAL Manual for CLC Server 10.0.1 Windows, macos and Linux March 8, 2018 This software is for research purposes only. QIAGEN Aarhus Silkeborgvej 2 Prismet DK-8000 Aarhus C Denmark
More informationChen lab workshop. Christian Frech
GBrowse Generic genome browser Chen lab workshop Christian Frech January 18, 2010 1 A generic genome browser why do we need it? Genome databases have similar requirements View DNA sequence and its associated
More informationThe UCSC Genome Browser
The UCSC Genome Browser UNIT 1.4 The rapid progress of public sequencing and mapping efforts on vertebrate genomes has increased the demand for tools that offer quick and easy access to the data at many
More informationBIOINFORMATICS. Savant: Genome Browser for High Throughput Sequencing Data
BIOINFORMATICS Vol. 00 no. 00 2010 Pages 1 6 Savant: Genome Browser for High Throughput Sequencing Data Marc Fiume 1,, Vanessa Williams 1, and Michael Brudno 1,2 1 Department of Computer Science, University
More informationTopics of the talk. Biodatabases. Data types. Some sequence terminology...
Topics of the talk Biodatabases Jarno Tuimala / Eija Korpelainen CSC What data are stored in biological databases? What constitutes a good database? Nucleic acid sequence databases Amino acid sequence
More informationAnalyzing ChIP- Seq Data in Galaxy
Analyzing ChIP- Seq Data in Galaxy Lauren Mills RISS ABSTRACT Step- by- step guide to basic ChIP- Seq analysis using the Galaxy platform. Table of Contents Introduction... 3 Links to helpful information...
More informationChIP-seq hands-on practical using Galaxy
ChIP-seq hands-on practical using Galaxy In this exercise we will cover some of the basic NGS analysis steps for ChIP-seq using the Galaxy framework: Quality control Mapping of reads using Bowtie2 Peak-calling
More informationWelcome to GenomeView 101!
Welcome to GenomeView 101! 1. Start your computer 2. Download and extract the example data http://www.broadinstitute.org/~tabeel/broade.zip Suggestion: - Linux, Mac: make new folder in your home directory
More informationChIP-seq hands-on practical using Galaxy
ChIP-seq hands-on practical using Galaxy In this exercise we will cover some of the basic NGS analysis steps for ChIP-seq using the Galaxy framework: Quality control Mapping of reads using Bowtie2 Peak-calling
More informationChIP-seq practical: peak detection and peak annotation. Mali Salmon-Divon Remco Loos Myrto Kostadima
ChIP-seq practical: peak detection and peak annotation Mali Salmon-Divon Remco Loos Myrto Kostadima March 2012 Introduction The goal of this hands-on session is to perform some basic tasks in the analysis
More informationChromatin signature discovery via histone modification profile alignments Jianrong Wang, Victoria V. Lunyak and I. King Jordan
Supplementary Information for: Chromatin signature discovery via histone modification profile alignments Jianrong Wang, Victoria V. Lunyak and I. King Jordan Contents Instructions for installing and running
More informationUser Manual. Ver. 3.0 March 19, 2012
User Manual Ver. 3.0 March 19, 2012 Table of Contents 1. Introduction... 2 1.1 Rationale... 2 1.2 Software Work-Flow... 3 1.3 New in GenomeGems 3.0... 4 2. Software Description... 5 2.1 Key Features...
More informationUCSC Genome Browser ASHG 2014 Workshop
UCSC Genome Browser ASHG 2014 Workshop We will be using human assembly hg19. Some steps may seem a bit cryptic or truncated. That is by design, so you will think about things as you go. In this document,
More informationFinding and Exporting Data. BioMart
September 2017 Finding and Exporting Data Not sure what tool to use to find and export data? BioMart is used to retrieve data for complex queries, involving a few or many genes or even complete genomes.
More informationHIPPIE User Manual. (v0.0.2-beta, 2015/4/26, Yih-Chii Hwang, yihhwang [at] mail.med.upenn.edu)
HIPPIE User Manual (v0.0.2-beta, 2015/4/26, Yih-Chii Hwang, yihhwang [at] mail.med.upenn.edu) OVERVIEW OF HIPPIE o Flowchart of HIPPIE o Requirements PREPARE DIRECTORY STRUCTURE FOR HIPPIE EXECUTION o
More informationBovineMine Documentation
BovineMine Documentation Release 1.0 Deepak Unni, Aditi Tayal, Colin Diesh, Christine Elsik, Darren Hag Oct 06, 2017 Contents 1 Tutorial 3 1.1 Overview.................................................
More information2) NCBI BLAST tutorial This is a users guide written by the education department at NCBI.
Web resources -- Tour. page 1 of 8 This is a guided tour. Any homework is separate. In fact, this exercise is used for multiple classes and is publicly available to everyone. The entire tour will take
More informationSequence Alignment. GBIO0002 Archana Bhardwaj University of Liege
Sequence Alignment GBIO0002 Archana Bhardwaj University of Liege 1 What is Sequence Alignment? A sequence alignment is a way of arranging the sequences of DNA, RNA, or protein to identify regions of similarity.
More informationLEMONS Database Generator GUI
LEMONS Database Generator GUI For more details and updates : http://lifeserv.bgu.ac.il/wb/dmishmar/pages/lemons.php If you have any questions or requests, please contact us by email: lemons.help@gmail.com
More informationTable of contents Genomatix AG 1
Table of contents! Introduction! 3 Getting started! 5 The Genome Browser window! 9 The toolbar! 9 The general annotation tracks! 12 Annotation tracks! 13 The 'Sequence' track! 14 The 'Position' track!
More informationThe UCSC Gene Sorter, Table Browser & Custom Tracks
The UCSC Gene Sorter, Table Browser & Custom Tracks Advanced searching and discovery using the UCSC Table Browser and Custom Tracks Osvaldo Graña Bioinformatics Unit, CNIO 1 Table Browser and Custom Tracks
More informationGenome Environment Browser (GEB) user guide
Genome Environment Browser (GEB) user guide GEB is a Java application developed to provide a dynamic graphical interface to visualise the distribution of genome features and chromosome-wide experimental
More informationChIP-Seq Tutorial on Galaxy
1 Introduction ChIP-Seq Tutorial on Galaxy 2 December 2010 (modified April 6, 2017) Rory Stark The aim of this practical is to give you some experience handling ChIP-Seq data. We will be working with data
More informationCOMPARATIVE MICROBIAL GENOMICS ANALYSIS WORKSHOP. Exercise 2: Predicting Protein-encoding Genes, BlastMatrix, BlastAtlas
COMPARATIVE MICROBIAL GENOMICS ANALYSIS WORKSHOP Exercise 2: Predicting Protein-encoding Genes, BlastMatrix, BlastAtlas First of all connect once again to the CBS system: Open ssh shell client. Press Quick
More informationDr. Gabriela Salinas Dr. Orr Shomroni Kaamini Rhaithata
Analysis of RNA sequencing data sets using the Galaxy environment Dr. Gabriela Salinas Dr. Orr Shomroni Kaamini Rhaithata Microarray and Deep-sequencing core facility 30.10.2017 RNA-seq workflow I Hypothesis
More informationOur data for today is a small subset of Saimaa ringed seal RNA sequencing data (RNA_seq_reads.fasta). Let s first see how many reads are there:
Practical Course in Genome Bioinformatics 19.2.2016 (CORRECTED 22.2.2016) Exercises - Day 5 http://ekhidna.biocenter.helsinki.fi/downloads/teaching/spring2016/ Answer the 5 questions (Q1-Q5) according
More informationIntegrated Genome browser (IGB) installation
Integrated Genome browser (IGB) installation Navigate to the IGB download page http://bioviz.org/igb/download.html You will see three icons for download: The three icons correspond to different memory
More informationepigenomegateway.wustl.edu
Everything can be found at epigenomegateway.wustl.edu REFERENCES 1. Zhou X, et al., Nature Methods 8, 989-990 (2011) 2. Zhou X & Wang T, Current Protocols in Bioinformatics Unit 10.10 (2012) 3. Zhou X,
More informationGalaxy Platform For NGS Data Analyses
Galaxy Platform For NGS Data Analyses Weihong Yan wyan@chem.ucla.edu Collaboratory Web Site http://qcb.ucla.edu/collaboratory Collaboratory Workshops Workshop Outline ü Day 1 UCLA galaxy and user account
More informationHymenopteraMine Documentation
HymenopteraMine Documentation Release 1.0 Aditi Tayal, Deepak Unni, Colin Diesh, Chris Elsik, Darren Hagen Apr 06, 2017 Contents 1 Welcome to HymenopteraMine 3 1.1 Overview of HymenopteraMine.....................................
More informationpanda Documentation Release 1.0 Daniel Vera
panda Documentation Release 1.0 Daniel Vera February 12, 2014 Contents 1 mat.make 3 1.1 Usage and option summary....................................... 3 1.2 Arguments................................................
More informationUCSC Genome Browser Pittsburgh Workshop -- Practical Exercises
UCSC Genome Browser Pittsburgh Workshop -- Practical Exercises We will be using human assembly hg19. These problems will take you through a variety of resources at the UCSC Genome Browser. You will learn
More informationm6aviewer Version Documentation
m6aviewer Version 1.6.0 Documentation Contents 1. About 2. Requirements 3. Launching m6aviewer 4. Running Time Estimates 5. Basic Peak Calling 6. Running Modes 7. Multiple Samples/Sample Replicates 8.
More informationApplications of a generic model of genomic variations functional analysis
Applications of a generic model of genomic variations functional analysis Sarah N. Mapelli, Uberto Pozzoli data annotations variations FUNCTION The tools developer point of view: a general analysis flow
More informationRNA-Seq in Galaxy: Tuxedo protocol. Igor Makunin, UQ RCC, QCIF
RNA-Seq in Galaxy: Tuxedo protocol Igor Makunin, UQ RCC, QCIF Acknowledgments Genomics Virtual Lab: gvl.org.au Galaxy for tutorials: galaxy-tut.genome.edu.au Galaxy Australia: galaxy-aust.genome.edu.au
More informationUseful software utilities for computational genomics. Shamith Samarajiwa CRUK Autumn School in Bioinformatics September 2017
Useful software utilities for computational genomics Shamith Samarajiwa CRUK Autumn School in Bioinformatics September 2017 Overview Search and download genomic datasets: GEOquery, GEOsearch and GEOmetadb,
More informationSupplementary Figure 1. Fast read-mapping algorithm of BrowserGenome.
Supplementary Figure 1 Fast read-mapping algorithm of BrowserGenome. (a) Indexing strategy: The genome sequence of interest is divided into non-overlapping 12-mers. A Hook table is generated that contains
More informationGenome Browser. Background and Strategy. 12 April 2010
Genome Browser Background and Strategy 12 April 2010 I. Background 1. Project definition 2. Survey of genome browsers II. Strategy Alejandro Caro, Chandni Desai, Neha Gupta, Jay Humphrey, Chengwei Luo,
More informationPractical Course in Genome Bioinformatics
Practical Course in Genome Bioinformatics 20/01/2017 Exercises - Day 1 http://ekhidna.biocenter.helsinki.fi/downloads/teaching/spring2017/ Answer questions Q1-Q3 below and include requested Figures 1-5
More informationA short Introduction to UCSC Genome Browser
A short Introduction to UCSC Genome Browser Elodie Girard, Nicolas Servant Institut Curie/INSERM U900 Bioinformatics, Biostatistics, Epidemiology and computational Systems Biology of Cancer 1 Why using
More informationTutorial: Jump Start on the Human Epigenome Browser at Washington University
Tutorial: Jump Start on the Human Epigenome Browser at Washington University This brief tutorial aims to introduce some of the basic features of the Human Epigenome Browser, allowing users to navigate
More informationBGGN-213: FOUNDATIONS OF BIOINFORMATICS (Lecture 14)
BGGN-213: FOUNDATIONS OF BIOINFORMATICS (Lecture 14) Genome Informatics (Part 1) https://bioboot.github.io/bggn213_f17/lectures/#14 Dr. Barry Grant Nov 2017 Overview: The purpose of this lab session is
More informationINTRODUCTION TO BIOINFORMATICS
Molecular Biology-2019 1 INTRODUCTION TO BIOINFORMATICS In this section, we want to provide a simple introduction to using the web site of the National Center for Biotechnology Information NCBI) to obtain
More informationWilson Leung 01/03/2018 An Introduction to NCBI BLAST. Prerequisites: Detecting and Interpreting Genetic Homology: Lecture Notes on Alignment
An Introduction to NCBI BLAST Prerequisites: Detecting and Interpreting Genetic Homology: Lecture Notes on Alignment Resources: The BLAST web server is available at https://blast.ncbi.nlm.nih.gov/blast.cgi
More informationRNA-seq. Manpreet S. Katari
RNA-seq Manpreet S. Katari Evolution of Sequence Technology Normalizing the Data RPKM (Reads per Kilobase of exons per million reads) Score = R NT R = # of unique reads for the gene N = Size of the gene
More informationFor Research Use Only. Not for use in diagnostic procedures.
SMRT View Guide For Research Use Only. Not for use in diagnostic procedures. P/N 100-088-600-02 Copyright 2012, Pacific Biosciences of California, Inc. All rights reserved. Information in this document
More informationUser's guide to ChIP-Seq applications: command-line usage and option summary
User's guide to ChIP-Seq applications: command-line usage and option summary 1. Basics about the ChIP-Seq Tools The ChIP-Seq software provides a set of tools performing common genome-wide ChIPseq analysis
More informationGFF3sort: an efficient tool to sort GFF3 files for tabix indexing
biorxiv preprint first posted online Jun., 0; doi: http://dx.doi.org/0.0/. The copyright holder for this preprint (which was not peer-reviewed) is the author/funder. It is made available under a CC-BY-NC.0
More informationFast-track to Gene Annotation and Genome Analysis
Fast-track to Gene Annotation and Genome Analysis Contents Section Page 1.1 Introduction DNA Subway is a bioinformatics workspace that wraps high-level analysis tools in an intuitive and appealing interface.
More informationHelpful Galaxy screencasts are available at:
This user guide serves as a simplified, graphic version of the CloudMap paper for applicationoriented end-users. For more details, please see the CloudMap paper. Video versions of these user guides and
More informationAgilent Genomic Workbench Lite Edition 6.5
Agilent Genomic Workbench Lite Edition 6.5 SureSelect Quality Analyzer User Guide For Research Use Only. Not for use in diagnostic procedures. Agilent Technologies Notices Agilent Technologies, Inc. 2010
More informationPreprint. Bovine Genome Database: Tools for Mining the Bos taurus Genome. Running Title: Bovine Genome Database
Preprint Hagen D.E., Unni D.R., Tayal A., Burns G.W., Elsik C.G. (2018) Bovine Genome Database: Tools for Mining the Bos taurus Genome. In: Kollmar M. (eds) Eukaryotic Genomic Databases. Methods in Molecular
More informationOur Task At Hand Aggregate data from every group
Where magical things happen Our Task At Hand Aggregate data from every group That s not too bad? Make it accessible to the public Just some basic HTML? Simple enough, right? Our Real Task Manage 1 million+
More informationAgilent Genomic Workbench 7.0
Agilent Genomic Workbench 7.0 Data Viewing User Guide Agilent Technologies Notices Agilent Technologies, Inc. 2012, 2015 No part of this manual may be reproduced in any form or by any means (including
More informationSequence Analysis Pipeline
Sequence Analysis Pipeline Transcript fragments 1. PREPROCESSING 2. ASSEMBLY (today) Removal of contaminants, vector, adaptors, etc Put overlapping sequence together and calculate bigger sequences 3. Analysis/Annotation
More informationUsing the Galaxy Local Bioinformatics Cloud at CARC
Using the Galaxy Local Bioinformatics Cloud at CARC Lijing Bu Sr. Research Scientist Bioinformatics Specialist Center for Evolutionary and Theoretical Immunology (CETI) Department of Biology, University
More informationUsing WebGBrowse to Visualize Genome Annotation on GBrowse
Protocol Using WebGBrowse to Visualize Genome Annotation on GBrowse Ram Podicheti and Qunfeng Dong 1 Center for Genomics and Bioinformatics, Indiana University, Bloomington, IN 47405, USA INTRODUCTION
More informationIntroduction to Read Alignment. UCD Genome Center Bioinformatics Core Tuesday 15 September 2015
Introduction to Read Alignment UCD Genome Center Bioinformatics Core Tuesday 15 September 2015 From reads to molecules Why align? Individual A Individual B ATGATAGCATCGTCGGGTGTCTGCTCAATAATAGTGCCGTATCATGCTGGTGTTATAATCGCCGCATGACATGATCAATGG
More informationSupplementary Information. Detecting and annotating genetic variations using the HugeSeq pipeline
Supplementary Information Detecting and annotating genetic variations using the HugeSeq pipeline Hugo Y. K. Lam 1,#, Cuiping Pan 1, Michael J. Clark 1, Phil Lacroute 1, Rui Chen 1, Rajini Haraksingh 1,
More informationAn Efficient Interval Query Algorithm Based on Inverted List in Cloud Environment *
Proceeding of the IEEE International Conference on Information and Automation Shenyang, China, June 2012 An Efficient Interval Query Algorithm Based on Inverted List in Cloud Environment * Zhiqiong Wang,
More informationQIAseq Targeted RNAscan Panel Analysis Plugin USER MANUAL
QIAseq Targeted RNAscan Panel Analysis Plugin USER MANUAL User manual for QIAseq Targeted RNAscan Panel Analysis 0.5.2 beta 1 Windows, Mac OS X and Linux February 5, 2018 This software is for research
More informationJBrowse: A next-generation genome browser
Resource Mitchell E. Skinner, 1 Andrew V. Uzilov, 1 Lincoln D. Stein, 2 Christopher J. Mungall, 3 and Ian H. Holmes 1,3,4 1 Department of Bioengineering, University of California at Berkeley, Berkeley,
More informationUsing The Arabidopsis Information Resource (TAIR) to Find Information About Arabidopsis Genes
UNIT 1.11 Using The Arabidopsis Information Resource (TAIR) to Find Information About Arabidopsis Genes Leonore Reiser 1, Shabari Subramaniam 1, Donghui Li 1, and Eva Huala 1 1 Phoenix Bioinformatics,
More informationJBrowse: a next-generation genome browser
JBrowse: a next-generation genome browser Mitchell E. Skinner, Andrew V. Uzilov, Lincoln D. Stein, Christopher J. Mungall, and Ian H. Holmes June 13, 2009 Abstract We describe an open source, portable,
More informationFor Research Use Only. Not for use in diagnostic procedures.
SMRT View Guide For Research Use Only. Not for use in diagnostic procedures. P/N 100-088-600-03 Copyright 2012, Pacific Biosciences of California, Inc. All rights reserved. Information in this document
More informationThe BEDTools manual. Last updated: 21-September-2010 Current as of BEDTools version Aaron R. Quinlan and Ira M. Hall University of Virginia
The BEDTools manual Last updated: 21-September-2010 Current as of BEDTools version 2.10.0 Aaron R. Quinlan and Ira M. Hall University of Virginia Contact: aaronquinlan@gmail.com 1. OVERVIEW... 7 1.1 BACKGROUND...7
More informationEval: A Gene Set Comparison System
Masters Project Report Eval: A Gene Set Comparison System Evan Keibler evan@cse.wustl.edu Table of Contents Table of Contents... - 2 - Chapter 1: Introduction... - 5-1.1 Gene Structure... - 5-1.2 Gene
More informationNextBrowse: An integrated and interactive web-based genome browser for analyzing and interpreting genomic data
NextBrowse: An integrated and interactive web-based genome browser for analyzing and interpreting genomic data Phillip J. Whisenhunt Thesis submitted to the Faculty of the Virginia Polytechnic Institute
More information