Background and Strategy. Smitha, Adrian, Devin, Jeff, Ali, Sanjeev, Karthikeyan

Size: px
Start display at page:

Download "Background and Strategy. Smitha, Adrian, Devin, Jeff, Ali, Sanjeev, Karthikeyan"

Transcription

1 Background and Strategy Smitha, Adrian, Devin, Jeff, Ali, Sanjeev, Karthikeyan

2 What is a genome browser? A web/desktop based graphical tool for rapid and reliable display of any requested portion of the genome at any scale, integrated with a large collection of annotations. A browser could be configured to display, Genome sequence -contigs \ -assembly -mrna -ESTs -Poly A sites -Splicing boundaries -Non coding RNAs -multiple gene predictions -gene expression -qpcr primers -Origin of replication -conserved sites -cross-species homologies -SNPs -in/dels -CNVs -Inversions

3 -transposons -repeats -microsatellites -DNAse hypersensitivity sites -TF binding sites -DNA Methylation sites -Literature -GWAS catalog -Mutations (OMIM) Text and sequence-based searches provide quick and precise access to any region of specific interest. Secondary links from individual features lead to sequence details and supplementary off-site databases. Representation of data along a single co-ordinate axis is the USP of a genome browser *The Human Genome Browser at UCSC,W. James Kent, Charles W. Sugnet, Terrence S. Furey, et al.,genome Res :

4 The browser history ;) C.elegans database (ACEDB) (Eeckman and Urbin,1995) The Saccharomyces Genome Database (SGD) (Cherry et al, 1998) N.Meningitidis browser (Comp Genomics et al, 2014) Ensembl (Birney et al, 2001) UCSC genome browser (Kent et al, 2002)

5 Genome Browser Examples UCSC UTGB Dalliance GBrowse JBrowse

6 UCSC

7 UCSC (University of California, Santa Cruz) Shows annotations for variable chromosomal region size Designed to handle large volume of complex data quickly Overkill For each fasta file, need to make several converted files and many tables in db.

8 UTGB

9 UTGB (University of Tokyo Genome Browser) Uses AJAX-based web interfaces to avoid excessive reloading of web pages Already equipped with a stand-alone web server and database management system for querying genome databases for easy installation. Generated genome browsers work in Windows, Mac and Linux and can be deployed to remote web servers. Lastest update December 1, 2011

10 Dalliance

11 Lightweight visualization tool HTML5 DAS (Distributed Annotation System) System deals badly with searches which match to more than one region of the genome

12 GBrowse

13 The Generic Model Organism Database Project (GMOD) developed the Generic Genome Browser (Gbrowse) Perl based Customizable plug in, blast, dump and import many formats Glyph library

14 JBrowse

15 Fast, smooth navigation and zooming Can handle multi-gigabase genomes and deep-coverage sequencing Supports BED, GFF3, FASTA, BioLLDB, Chado, WIG, BAM, BigWig, UCSC (intron/exon structure, name lookups, quantitative plots). Relatively easy to get running Capable of thousands of track selections Very lightweight. Requires little server resource requirements (no back-end server code, just data file formatting tools read directly over HTTP)

16 JBrowse Details

17 Storing/Querying Data Contig1 GENE id=g1135;name=glmm;signature="glmm: phosphoglucosamine mutase",... Contig1 GENE id=g469;name=folp; Synonyms=dhpS;signature="Pterin binding enzyme",...

18 Storing/Querying Data Ordered by Start: ABCDEFGHIJKLMNOP SELECT * FROM Intervals Ordered by End: ABEDFHGJICKMLNPO WHERE Interval.Start < Query.End AND Interval.End > Query.Start Alekseyenko AV, Lee CJ. Nested Containment List (NCList): a new algorithm for accelerating interval query of genome alignment and interval databases. Bioinformatics. 2007;23(11):

19 Nested Containment List Store data as a tree where each interval keeps a sublist of contained intervals. Sorts sublist intervals by start AND end simultaneously.

20 Storing/Querying Data Alekseyenko AV, Lee CJ. Nested Containment List (NCList): a new algorithm for accelerating interval query of genome alignment and interval databases. Bioinformatics. 2007;23(11):

21 Storing/Querying Data JBrowse: NC List UCSC: Binning GBrowse: R-Tree Alekseyenko AV, Lee CJ. Nested Containment List (NCList): a new algorithm for accelerating interval query of genome alignment and interval databases. Bioinformatics. 2007;23(11):

22 Storing/Querying Data JBrowse DOES NOT use a relational database!!! Nested Containment List not implemented in a relational database at the start of JBrowse development Has since been implemented, but not in use by JBrowse Wiley LK, Sivley RM, Bush WS. Rapid storage and retrieval of genomic intervals from a relational database system using nested containment lists. Database (Oxford). 2013;2013:bat056.

23 Extra Features BLAST BLAST ATLAS (Genewiz, Brigs) TREES ALIGNMENTS (MAUVE) SNP CALLING MULTIPLE SEQUENCE ALIGNMENT

Genome Browser. Background & Strategy. Spring 2017 Faction II

Genome Browser. Background & Strategy. Spring 2017 Faction II Genome Browser Background & Strategy Spring 2017 Faction II Outline Beginning of the Last Phase Goals State of Art Applicable Genome Browsers Not So Genome Browsers Storing Data Strategy for the website

More information

JBrowse. To get started early: Double click VirtualBox on the desktop Click JBrowse 2016 Tutorial Click Start

JBrowse. To get started early: Double click VirtualBox on the desktop Click JBrowse 2016 Tutorial Click Start JBrowse To get started early: Double click VirtualBox on the desktop Click JBrowse 2016 Tutorial Click Start JBrowse PAG 2015 Scott Cain GMOD Coordinator scott@scottcain.net What is GMOD? A set of interoperable

More information

Genome Browser. Background and Strategy

Genome Browser. Background and Strategy Genome Browser Background and Strategy Contents What is a genome browser? Purpose of a genome browser Examples Structure Extra Features Contents What is a genome browser? Purpose of a genome browser Examples

More information

Genome Browsers Guide

Genome Browsers Guide Genome Browsers Guide Take a Class This guide supports the Galter Library class called Genome Browsers. See our Classes schedule for the next available offering. If this class is not on our upcoming schedule,

More information

Genome Browsers - The UCSC Genome Browser

Genome Browsers - The UCSC Genome Browser Genome Browsers - The UCSC Genome Browser Background The UCSC Genome Browser is a well-curated site that provides users with a view of gene or sequence information in genomic context for a specific species,

More information

Today's outline. Resources. Genome browser components. Genome browsers: Discovering biology through genomics. Genome browser tutorial materials

Today's outline. Resources. Genome browser components. Genome browsers: Discovering biology through genomics. Genome browser tutorial materials Today's outline Genome browsers: Discovering biology through genomics BaRC Hot Topics April 2013 George Bell, Ph.D. http://jura.wi.mit.edu/bio/education/hot_topics/ Genome browser introduction Popular

More information

Genome Browser Background and Strategy

Genome Browser Background and Strategy Genome Browser Background and Strategy April 12th, 2017 BIOL 7210 - Faction I (Outbreak) - Genome Browser Group Adam Dabrowski Mrunal Dehankar Shareef Khalid Hubert Pan Ajay Ramakrishnan Ankit Srivastava

More information

Advanced genome browsers: Integrated Genome Browser and others Heiko Muller Computational Research

Advanced genome browsers: Integrated Genome Browser and others Heiko Muller Computational Research Genomic Computing, DEIB, 4-7 March 2013 Advanced genome browsers: Integrated Genome Browser and others Heiko Muller Computational Research IIT@SEMM heiko.muller@iit.it List of Genome Browsers Alamut Annmap

More information

Browser Exercises - I. Alignments and Comparative genomics

Browser Exercises - I. Alignments and Comparative genomics Browser Exercises - I Alignments and Comparative genomics 1. Navigating to the Genome Browser (GBrowse) Note: For this exercise use http://www.tritrypdb.org a. Navigate to the Genome Browser (GBrowse)

More information

How to use KAIKObase Version 3.1.0

How to use KAIKObase Version 3.1.0 How to use KAIKObase Version 3.1.0 Version3.1.0 29/Nov/2010 http://sgp2010.dna.affrc.go.jp/kaikobase/ Copyright National Institute of Agrobiological Sciences. All rights reserved. Outline 1. System overview

More information

Genome Browser. Shruti Bhide Abhiram Das Khanjan Gandhi Viswateja Nelakuditi

Genome Browser. Shruti Bhide Abhiram Das Khanjan Gandhi Viswateja Nelakuditi Genome Browser Shruti Bhide Abhiram Das Khanjan Gandhi Viswateja Nelakuditi Present Scenario Need of Databases and Genome Browser Present Scenario Need of Databases and Genome Browser Put all the ingredients

More information

ChIP-seq (NGS) Data Formats

ChIP-seq (NGS) Data Formats ChIP-seq (NGS) Data Formats Biological samples Sequence reads SRA/SRF, FASTQ Quality control SAM/BAM/Pileup?? Mapping Assembly... DE Analysis Variant Detection Peak Calling...? Counts, RPKM VCF BED/narrowPeak/

More information

Introduction to Genome Browsers

Introduction to Genome Browsers Introduction to Genome Browsers Rolando Garcia-Milian, MLS, AHIP (Rolando.milian@ufl.edu) Department of Biomedical and Health Information Services Health Sciences Center Libraries, University of Florida

More information

Advanced UCSC Browser Functions

Advanced UCSC Browser Functions Advanced UCSC Browser Functions Dr. Thomas Randall tarandal@email.unc.edu bioinformatics.unc.edu UCSC Browser: genome.ucsc.edu Overview Custom Tracks adding your own datasets Utilities custom tools for

More information

Part 1: How to use IGV to visualize variants

Part 1: How to use IGV to visualize variants Using IGV to identify true somatic variants from the false variants http://www.broadinstitute.org/igv A FAQ, sample files and a user guide are available on IGV website If you use IGV in your publication:

More information

Tutorial: How to use the Wheat TILLING database

Tutorial: How to use the Wheat TILLING database Tutorial: How to use the Wheat TILLING database Last Updated: 9/7/16 1. Visit http://dubcovskylab.ucdavis.edu/wheat_blast to go to the BLAST page or click on the Wheat BLAST button on the homepage. 2.

More information

Genomic Analysis with Genome Browsers.

Genomic Analysis with Genome Browsers. Genomic Analysis with Genome Browsers http://barc.wi.mit.edu/hot_topics/ 1 Outline Genome browsers overview UCSC Genome Browser Navigating: View your list of regions in the browser Available tracks (eg.

More information

Sequencing Data. Paul Agapow 2011/02/03

Sequencing Data. Paul Agapow 2011/02/03 Webservices for Next Generation Sequencing Data Paul Agapow 2011/02/03 Aims Assumed parameters: Must have a system for non-technical users to browse and manipulate their Next Generation Sequencing (NGS)

More information

Analyzing Variant Call results using EuPathDB Galaxy, Part II

Analyzing Variant Call results using EuPathDB Galaxy, Part II Analyzing Variant Call results using EuPathDB Galaxy, Part II In this exercise, we will work in groups to examine the results from the SNP analysis workflow that we started yesterday. The first step is

More information

How to use earray to create custom content for the SureSelect Target Enrichment platform. Page 1

How to use earray to create custom content for the SureSelect Target Enrichment platform. Page 1 How to use earray to create custom content for the SureSelect Target Enrichment platform Page 1 Getting Started Access earray Access earray at: https://earray.chem.agilent.com/earray/ Log in to earray,

More information

Generic Model Organism Database. Lavanya Rishishwar

Generic Model Organism Database. Lavanya Rishishwar Generic Model Organism Database Lavanya Rishishwar Outline Purpose Genome database Basics of webserver & database GMOD 4/7/2016 Generic Model Organism Database 2 Presentation Assumption What do we understand:

More information

NGS Data Visualization and Exploration Using IGV

NGS Data Visualization and Exploration Using IGV 1 What is Galaxy Galaxy for Bioinformaticians Galaxy for Experimental Biologists Using Galaxy for NGS Analysis NGS Data Visualization and Exploration Using IGV 2 What is Galaxy Galaxy for Bioinformaticians

More information

The Galaxy Track Browser: Transforming the Genome Browser from Visualization Tool to Analysis Tool

The Galaxy Track Browser: Transforming the Genome Browser from Visualization Tool to Analysis Tool The Galaxy Track Browser: Transforming the Genome Browser from Visualization Tool to Analysis Tool Jeremy Goecks * Kanwei Li Ω Dave Clements ℵ The Galaxy Team James Taylor ℇ Emory University Emory University

More information

You will be re-directed to the following result page.

You will be re-directed to the following result page. ENCODE Element Browser Goal: to navigate the candidate DNA elements predicted by the ENCODE consortium, including gene expression, DNase I hypersensitive sites, TF binding sites, and candidate enhancers/promoters.

More information

Integrative Genomics Viewer. Prat Thiru

Integrative Genomics Viewer. Prat Thiru Integrative Genomics Viewer Prat Thiru 1 Overview User Interface Basics Browsing the Data Data Formats IGV Tools Demo Outline Based on ISMB 2010 Tutorial by Robinson and Thorvaldsdottir 2 Why IGV? IGV

More information

Genomics 92 (2008) Contents lists available at ScienceDirect. Genomics. journal homepage:

Genomics 92 (2008) Contents lists available at ScienceDirect. Genomics. journal homepage: Genomics 92 (2008) 75 84 Contents lists available at ScienceDirect Genomics journal homepage: www.elsevier.com/locate/ygeno Review UCSC genome browser tutorial Ann S. Zweig a,, Donna Karolchik a, Robert

More information

The UCSC Genome Browser

The UCSC Genome Browser The UCSC Genome Browser Donna Karolchik, 1 Angie S. Hinrichs, 1 and W. James Kent 1 UNIT 1.4 1 Center for Biomolecular Science and Engineering, University of California Santa Cruz, Santa Cruz, California

More information

Tutorial 1: Exploring the UCSC Genome Browser

Tutorial 1: Exploring the UCSC Genome Browser Last updated: May 12, 2011 Tutorial 1: Exploring the UCSC Genome Browser Open the homepage of the UCSC Genome Browser at: http://genome.ucsc.edu/ In the blue bar at the top, click on the Genomes link.

More information

Easy visualization of the read coverage using the CoverageView package

Easy visualization of the read coverage using the CoverageView package Easy visualization of the read coverage using the CoverageView package Ernesto Lowy European Bioinformatics Institute EMBL June 13, 2018 > options(width=40) > library(coverageview) 1 Introduction This

More information

The UCSC Genome Browser

The UCSC Genome Browser The UCSC Genome Browser Search, retrieve and display the data that you want Materials prepared by Warren C. Lathe, Ph.D. Mary Mangan, Ph.D. www.openhelix.com Updated: Q3 2006 Version_0906 Copyright OpenHelix.

More information

Bioinformatics in next generation sequencing projects

Bioinformatics in next generation sequencing projects Bioinformatics in next generation sequencing projects Rickard Sandberg Assistant Professor Department of Cell and Molecular Biology Karolinska Institutet March 2011 Once sequenced the problem becomes computational

More information

Exercise 2: Browser-Based Annotation and RNA-Seq Data

Exercise 2: Browser-Based Annotation and RNA-Seq Data Exercise 2: Browser-Based Annotation and RNA-Seq Data Jeremy Buhler July 24, 2018 This exercise continues your introduction to practical issues in comparative annotation. You ll be annotating genomic sequence

More information

CLC Server. End User USER MANUAL

CLC Server. End User USER MANUAL CLC Server End User USER MANUAL Manual for CLC Server 10.0.1 Windows, macos and Linux March 8, 2018 This software is for research purposes only. QIAGEN Aarhus Silkeborgvej 2 Prismet DK-8000 Aarhus C Denmark

More information

Chen lab workshop. Christian Frech

Chen lab workshop. Christian Frech GBrowse Generic genome browser Chen lab workshop Christian Frech January 18, 2010 1 A generic genome browser why do we need it? Genome databases have similar requirements View DNA sequence and its associated

More information

The UCSC Genome Browser

The UCSC Genome Browser The UCSC Genome Browser UNIT 1.4 The rapid progress of public sequencing and mapping efforts on vertebrate genomes has increased the demand for tools that offer quick and easy access to the data at many

More information

BIOINFORMATICS. Savant: Genome Browser for High Throughput Sequencing Data

BIOINFORMATICS. Savant: Genome Browser for High Throughput Sequencing Data BIOINFORMATICS Vol. 00 no. 00 2010 Pages 1 6 Savant: Genome Browser for High Throughput Sequencing Data Marc Fiume 1,, Vanessa Williams 1, and Michael Brudno 1,2 1 Department of Computer Science, University

More information

Topics of the talk. Biodatabases. Data types. Some sequence terminology...

Topics of the talk. Biodatabases. Data types. Some sequence terminology... Topics of the talk Biodatabases Jarno Tuimala / Eija Korpelainen CSC What data are stored in biological databases? What constitutes a good database? Nucleic acid sequence databases Amino acid sequence

More information

Analyzing ChIP- Seq Data in Galaxy

Analyzing ChIP- Seq Data in Galaxy Analyzing ChIP- Seq Data in Galaxy Lauren Mills RISS ABSTRACT Step- by- step guide to basic ChIP- Seq analysis using the Galaxy platform. Table of Contents Introduction... 3 Links to helpful information...

More information

ChIP-seq hands-on practical using Galaxy

ChIP-seq hands-on practical using Galaxy ChIP-seq hands-on practical using Galaxy In this exercise we will cover some of the basic NGS analysis steps for ChIP-seq using the Galaxy framework: Quality control Mapping of reads using Bowtie2 Peak-calling

More information

Welcome to GenomeView 101!

Welcome to GenomeView 101! Welcome to GenomeView 101! 1. Start your computer 2. Download and extract the example data http://www.broadinstitute.org/~tabeel/broade.zip Suggestion: - Linux, Mac: make new folder in your home directory

More information

ChIP-seq hands-on practical using Galaxy

ChIP-seq hands-on practical using Galaxy ChIP-seq hands-on practical using Galaxy In this exercise we will cover some of the basic NGS analysis steps for ChIP-seq using the Galaxy framework: Quality control Mapping of reads using Bowtie2 Peak-calling

More information

ChIP-seq practical: peak detection and peak annotation. Mali Salmon-Divon Remco Loos Myrto Kostadima

ChIP-seq practical: peak detection and peak annotation. Mali Salmon-Divon Remco Loos Myrto Kostadima ChIP-seq practical: peak detection and peak annotation Mali Salmon-Divon Remco Loos Myrto Kostadima March 2012 Introduction The goal of this hands-on session is to perform some basic tasks in the analysis

More information

Chromatin signature discovery via histone modification profile alignments Jianrong Wang, Victoria V. Lunyak and I. King Jordan

Chromatin signature discovery via histone modification profile alignments Jianrong Wang, Victoria V. Lunyak and I. King Jordan Supplementary Information for: Chromatin signature discovery via histone modification profile alignments Jianrong Wang, Victoria V. Lunyak and I. King Jordan Contents Instructions for installing and running

More information

User Manual. Ver. 3.0 March 19, 2012

User Manual. Ver. 3.0 March 19, 2012 User Manual Ver. 3.0 March 19, 2012 Table of Contents 1. Introduction... 2 1.1 Rationale... 2 1.2 Software Work-Flow... 3 1.3 New in GenomeGems 3.0... 4 2. Software Description... 5 2.1 Key Features...

More information

UCSC Genome Browser ASHG 2014 Workshop

UCSC Genome Browser ASHG 2014 Workshop UCSC Genome Browser ASHG 2014 Workshop We will be using human assembly hg19. Some steps may seem a bit cryptic or truncated. That is by design, so you will think about things as you go. In this document,

More information

Finding and Exporting Data. BioMart

Finding and Exporting Data. BioMart September 2017 Finding and Exporting Data Not sure what tool to use to find and export data? BioMart is used to retrieve data for complex queries, involving a few or many genes or even complete genomes.

More information

HIPPIE User Manual. (v0.0.2-beta, 2015/4/26, Yih-Chii Hwang, yihhwang [at] mail.med.upenn.edu)

HIPPIE User Manual. (v0.0.2-beta, 2015/4/26, Yih-Chii Hwang, yihhwang [at] mail.med.upenn.edu) HIPPIE User Manual (v0.0.2-beta, 2015/4/26, Yih-Chii Hwang, yihhwang [at] mail.med.upenn.edu) OVERVIEW OF HIPPIE o Flowchart of HIPPIE o Requirements PREPARE DIRECTORY STRUCTURE FOR HIPPIE EXECUTION o

More information

BovineMine Documentation

BovineMine Documentation BovineMine Documentation Release 1.0 Deepak Unni, Aditi Tayal, Colin Diesh, Christine Elsik, Darren Hag Oct 06, 2017 Contents 1 Tutorial 3 1.1 Overview.................................................

More information

2) NCBI BLAST tutorial This is a users guide written by the education department at NCBI.

2) NCBI BLAST tutorial   This is a users guide written by the education department at NCBI. Web resources -- Tour. page 1 of 8 This is a guided tour. Any homework is separate. In fact, this exercise is used for multiple classes and is publicly available to everyone. The entire tour will take

More information

Sequence Alignment. GBIO0002 Archana Bhardwaj University of Liege

Sequence Alignment. GBIO0002 Archana Bhardwaj University of Liege Sequence Alignment GBIO0002 Archana Bhardwaj University of Liege 1 What is Sequence Alignment? A sequence alignment is a way of arranging the sequences of DNA, RNA, or protein to identify regions of similarity.

More information

LEMONS Database Generator GUI

LEMONS Database Generator GUI LEMONS Database Generator GUI For more details and updates : http://lifeserv.bgu.ac.il/wb/dmishmar/pages/lemons.php If you have any questions or requests, please contact us by email: lemons.help@gmail.com

More information

Table of contents Genomatix AG 1

Table of contents Genomatix AG 1 Table of contents! Introduction! 3 Getting started! 5 The Genome Browser window! 9 The toolbar! 9 The general annotation tracks! 12 Annotation tracks! 13 The 'Sequence' track! 14 The 'Position' track!

More information

The UCSC Gene Sorter, Table Browser & Custom Tracks

The UCSC Gene Sorter, Table Browser & Custom Tracks The UCSC Gene Sorter, Table Browser & Custom Tracks Advanced searching and discovery using the UCSC Table Browser and Custom Tracks Osvaldo Graña Bioinformatics Unit, CNIO 1 Table Browser and Custom Tracks

More information

Genome Environment Browser (GEB) user guide

Genome Environment Browser (GEB) user guide Genome Environment Browser (GEB) user guide GEB is a Java application developed to provide a dynamic graphical interface to visualise the distribution of genome features and chromosome-wide experimental

More information

ChIP-Seq Tutorial on Galaxy

ChIP-Seq Tutorial on Galaxy 1 Introduction ChIP-Seq Tutorial on Galaxy 2 December 2010 (modified April 6, 2017) Rory Stark The aim of this practical is to give you some experience handling ChIP-Seq data. We will be working with data

More information

COMPARATIVE MICROBIAL GENOMICS ANALYSIS WORKSHOP. Exercise 2: Predicting Protein-encoding Genes, BlastMatrix, BlastAtlas

COMPARATIVE MICROBIAL GENOMICS ANALYSIS WORKSHOP. Exercise 2: Predicting Protein-encoding Genes, BlastMatrix, BlastAtlas COMPARATIVE MICROBIAL GENOMICS ANALYSIS WORKSHOP Exercise 2: Predicting Protein-encoding Genes, BlastMatrix, BlastAtlas First of all connect once again to the CBS system: Open ssh shell client. Press Quick

More information

Dr. Gabriela Salinas Dr. Orr Shomroni Kaamini Rhaithata

Dr. Gabriela Salinas Dr. Orr Shomroni Kaamini Rhaithata Analysis of RNA sequencing data sets using the Galaxy environment Dr. Gabriela Salinas Dr. Orr Shomroni Kaamini Rhaithata Microarray and Deep-sequencing core facility 30.10.2017 RNA-seq workflow I Hypothesis

More information

Our data for today is a small subset of Saimaa ringed seal RNA sequencing data (RNA_seq_reads.fasta). Let s first see how many reads are there:

Our data for today is a small subset of Saimaa ringed seal RNA sequencing data (RNA_seq_reads.fasta). Let s first see how many reads are there: Practical Course in Genome Bioinformatics 19.2.2016 (CORRECTED 22.2.2016) Exercises - Day 5 http://ekhidna.biocenter.helsinki.fi/downloads/teaching/spring2016/ Answer the 5 questions (Q1-Q5) according

More information

Integrated Genome browser (IGB) installation

Integrated Genome browser (IGB) installation Integrated Genome browser (IGB) installation Navigate to the IGB download page http://bioviz.org/igb/download.html You will see three icons for download: The three icons correspond to different memory

More information

epigenomegateway.wustl.edu

epigenomegateway.wustl.edu Everything can be found at epigenomegateway.wustl.edu REFERENCES 1. Zhou X, et al., Nature Methods 8, 989-990 (2011) 2. Zhou X & Wang T, Current Protocols in Bioinformatics Unit 10.10 (2012) 3. Zhou X,

More information

Galaxy Platform For NGS Data Analyses

Galaxy Platform For NGS Data Analyses Galaxy Platform For NGS Data Analyses Weihong Yan wyan@chem.ucla.edu Collaboratory Web Site http://qcb.ucla.edu/collaboratory Collaboratory Workshops Workshop Outline ü Day 1 UCLA galaxy and user account

More information

HymenopteraMine Documentation

HymenopteraMine Documentation HymenopteraMine Documentation Release 1.0 Aditi Tayal, Deepak Unni, Colin Diesh, Chris Elsik, Darren Hagen Apr 06, 2017 Contents 1 Welcome to HymenopteraMine 3 1.1 Overview of HymenopteraMine.....................................

More information

panda Documentation Release 1.0 Daniel Vera

panda Documentation Release 1.0 Daniel Vera panda Documentation Release 1.0 Daniel Vera February 12, 2014 Contents 1 mat.make 3 1.1 Usage and option summary....................................... 3 1.2 Arguments................................................

More information

UCSC Genome Browser Pittsburgh Workshop -- Practical Exercises

UCSC Genome Browser Pittsburgh Workshop -- Practical Exercises UCSC Genome Browser Pittsburgh Workshop -- Practical Exercises We will be using human assembly hg19. These problems will take you through a variety of resources at the UCSC Genome Browser. You will learn

More information

m6aviewer Version Documentation

m6aviewer Version Documentation m6aviewer Version 1.6.0 Documentation Contents 1. About 2. Requirements 3. Launching m6aviewer 4. Running Time Estimates 5. Basic Peak Calling 6. Running Modes 7. Multiple Samples/Sample Replicates 8.

More information

Applications of a generic model of genomic variations functional analysis

Applications of a generic model of genomic variations functional analysis Applications of a generic model of genomic variations functional analysis Sarah N. Mapelli, Uberto Pozzoli data annotations variations FUNCTION The tools developer point of view: a general analysis flow

More information

RNA-Seq in Galaxy: Tuxedo protocol. Igor Makunin, UQ RCC, QCIF

RNA-Seq in Galaxy: Tuxedo protocol. Igor Makunin, UQ RCC, QCIF RNA-Seq in Galaxy: Tuxedo protocol Igor Makunin, UQ RCC, QCIF Acknowledgments Genomics Virtual Lab: gvl.org.au Galaxy for tutorials: galaxy-tut.genome.edu.au Galaxy Australia: galaxy-aust.genome.edu.au

More information

Useful software utilities for computational genomics. Shamith Samarajiwa CRUK Autumn School in Bioinformatics September 2017

Useful software utilities for computational genomics. Shamith Samarajiwa CRUK Autumn School in Bioinformatics September 2017 Useful software utilities for computational genomics Shamith Samarajiwa CRUK Autumn School in Bioinformatics September 2017 Overview Search and download genomic datasets: GEOquery, GEOsearch and GEOmetadb,

More information

Supplementary Figure 1. Fast read-mapping algorithm of BrowserGenome.

Supplementary Figure 1. Fast read-mapping algorithm of BrowserGenome. Supplementary Figure 1 Fast read-mapping algorithm of BrowserGenome. (a) Indexing strategy: The genome sequence of interest is divided into non-overlapping 12-mers. A Hook table is generated that contains

More information

Genome Browser. Background and Strategy. 12 April 2010

Genome Browser. Background and Strategy. 12 April 2010 Genome Browser Background and Strategy 12 April 2010 I. Background 1. Project definition 2. Survey of genome browsers II. Strategy Alejandro Caro, Chandni Desai, Neha Gupta, Jay Humphrey, Chengwei Luo,

More information

Practical Course in Genome Bioinformatics

Practical Course in Genome Bioinformatics Practical Course in Genome Bioinformatics 20/01/2017 Exercises - Day 1 http://ekhidna.biocenter.helsinki.fi/downloads/teaching/spring2017/ Answer questions Q1-Q3 below and include requested Figures 1-5

More information

A short Introduction to UCSC Genome Browser

A short Introduction to UCSC Genome Browser A short Introduction to UCSC Genome Browser Elodie Girard, Nicolas Servant Institut Curie/INSERM U900 Bioinformatics, Biostatistics, Epidemiology and computational Systems Biology of Cancer 1 Why using

More information

Tutorial: Jump Start on the Human Epigenome Browser at Washington University

Tutorial: Jump Start on the Human Epigenome Browser at Washington University Tutorial: Jump Start on the Human Epigenome Browser at Washington University This brief tutorial aims to introduce some of the basic features of the Human Epigenome Browser, allowing users to navigate

More information

BGGN-213: FOUNDATIONS OF BIOINFORMATICS (Lecture 14)

BGGN-213: FOUNDATIONS OF BIOINFORMATICS (Lecture 14) BGGN-213: FOUNDATIONS OF BIOINFORMATICS (Lecture 14) Genome Informatics (Part 1) https://bioboot.github.io/bggn213_f17/lectures/#14 Dr. Barry Grant Nov 2017 Overview: The purpose of this lab session is

More information

INTRODUCTION TO BIOINFORMATICS

INTRODUCTION TO BIOINFORMATICS Molecular Biology-2019 1 INTRODUCTION TO BIOINFORMATICS In this section, we want to provide a simple introduction to using the web site of the National Center for Biotechnology Information NCBI) to obtain

More information

Wilson Leung 01/03/2018 An Introduction to NCBI BLAST. Prerequisites: Detecting and Interpreting Genetic Homology: Lecture Notes on Alignment

Wilson Leung 01/03/2018 An Introduction to NCBI BLAST. Prerequisites: Detecting and Interpreting Genetic Homology: Lecture Notes on Alignment An Introduction to NCBI BLAST Prerequisites: Detecting and Interpreting Genetic Homology: Lecture Notes on Alignment Resources: The BLAST web server is available at https://blast.ncbi.nlm.nih.gov/blast.cgi

More information

RNA-seq. Manpreet S. Katari

RNA-seq. Manpreet S. Katari RNA-seq Manpreet S. Katari Evolution of Sequence Technology Normalizing the Data RPKM (Reads per Kilobase of exons per million reads) Score = R NT R = # of unique reads for the gene N = Size of the gene

More information

For Research Use Only. Not for use in diagnostic procedures.

For Research Use Only. Not for use in diagnostic procedures. SMRT View Guide For Research Use Only. Not for use in diagnostic procedures. P/N 100-088-600-02 Copyright 2012, Pacific Biosciences of California, Inc. All rights reserved. Information in this document

More information

User's guide to ChIP-Seq applications: command-line usage and option summary

User's guide to ChIP-Seq applications: command-line usage and option summary User's guide to ChIP-Seq applications: command-line usage and option summary 1. Basics about the ChIP-Seq Tools The ChIP-Seq software provides a set of tools performing common genome-wide ChIPseq analysis

More information

GFF3sort: an efficient tool to sort GFF3 files for tabix indexing

GFF3sort: an efficient tool to sort GFF3 files for tabix indexing biorxiv preprint first posted online Jun., 0; doi: http://dx.doi.org/0.0/. The copyright holder for this preprint (which was not peer-reviewed) is the author/funder. It is made available under a CC-BY-NC.0

More information

Fast-track to Gene Annotation and Genome Analysis

Fast-track to Gene Annotation and Genome Analysis Fast-track to Gene Annotation and Genome Analysis Contents Section Page 1.1 Introduction DNA Subway is a bioinformatics workspace that wraps high-level analysis tools in an intuitive and appealing interface.

More information

Helpful Galaxy screencasts are available at:

Helpful Galaxy screencasts are available at: This user guide serves as a simplified, graphic version of the CloudMap paper for applicationoriented end-users. For more details, please see the CloudMap paper. Video versions of these user guides and

More information

Agilent Genomic Workbench Lite Edition 6.5

Agilent Genomic Workbench Lite Edition 6.5 Agilent Genomic Workbench Lite Edition 6.5 SureSelect Quality Analyzer User Guide For Research Use Only. Not for use in diagnostic procedures. Agilent Technologies Notices Agilent Technologies, Inc. 2010

More information

Preprint. Bovine Genome Database: Tools for Mining the Bos taurus Genome. Running Title: Bovine Genome Database

Preprint. Bovine Genome Database: Tools for Mining the Bos taurus Genome. Running Title: Bovine Genome Database Preprint Hagen D.E., Unni D.R., Tayal A., Burns G.W., Elsik C.G. (2018) Bovine Genome Database: Tools for Mining the Bos taurus Genome. In: Kollmar M. (eds) Eukaryotic Genomic Databases. Methods in Molecular

More information

Our Task At Hand Aggregate data from every group

Our Task At Hand Aggregate data from every group Where magical things happen Our Task At Hand Aggregate data from every group That s not too bad? Make it accessible to the public Just some basic HTML? Simple enough, right? Our Real Task Manage 1 million+

More information

Agilent Genomic Workbench 7.0

Agilent Genomic Workbench 7.0 Agilent Genomic Workbench 7.0 Data Viewing User Guide Agilent Technologies Notices Agilent Technologies, Inc. 2012, 2015 No part of this manual may be reproduced in any form or by any means (including

More information

Sequence Analysis Pipeline

Sequence Analysis Pipeline Sequence Analysis Pipeline Transcript fragments 1. PREPROCESSING 2. ASSEMBLY (today) Removal of contaminants, vector, adaptors, etc Put overlapping sequence together and calculate bigger sequences 3. Analysis/Annotation

More information

Using the Galaxy Local Bioinformatics Cloud at CARC

Using the Galaxy Local Bioinformatics Cloud at CARC Using the Galaxy Local Bioinformatics Cloud at CARC Lijing Bu Sr. Research Scientist Bioinformatics Specialist Center for Evolutionary and Theoretical Immunology (CETI) Department of Biology, University

More information

Using WebGBrowse to Visualize Genome Annotation on GBrowse

Using WebGBrowse to Visualize Genome Annotation on GBrowse Protocol Using WebGBrowse to Visualize Genome Annotation on GBrowse Ram Podicheti and Qunfeng Dong 1 Center for Genomics and Bioinformatics, Indiana University, Bloomington, IN 47405, USA INTRODUCTION

More information

Introduction to Read Alignment. UCD Genome Center Bioinformatics Core Tuesday 15 September 2015

Introduction to Read Alignment. UCD Genome Center Bioinformatics Core Tuesday 15 September 2015 Introduction to Read Alignment UCD Genome Center Bioinformatics Core Tuesday 15 September 2015 From reads to molecules Why align? Individual A Individual B ATGATAGCATCGTCGGGTGTCTGCTCAATAATAGTGCCGTATCATGCTGGTGTTATAATCGCCGCATGACATGATCAATGG

More information

Supplementary Information. Detecting and annotating genetic variations using the HugeSeq pipeline

Supplementary Information. Detecting and annotating genetic variations using the HugeSeq pipeline Supplementary Information Detecting and annotating genetic variations using the HugeSeq pipeline Hugo Y. K. Lam 1,#, Cuiping Pan 1, Michael J. Clark 1, Phil Lacroute 1, Rui Chen 1, Rajini Haraksingh 1,

More information

An Efficient Interval Query Algorithm Based on Inverted List in Cloud Environment *

An Efficient Interval Query Algorithm Based on Inverted List in Cloud Environment * Proceeding of the IEEE International Conference on Information and Automation Shenyang, China, June 2012 An Efficient Interval Query Algorithm Based on Inverted List in Cloud Environment * Zhiqiong Wang,

More information

QIAseq Targeted RNAscan Panel Analysis Plugin USER MANUAL

QIAseq Targeted RNAscan Panel Analysis Plugin USER MANUAL QIAseq Targeted RNAscan Panel Analysis Plugin USER MANUAL User manual for QIAseq Targeted RNAscan Panel Analysis 0.5.2 beta 1 Windows, Mac OS X and Linux February 5, 2018 This software is for research

More information

JBrowse: A next-generation genome browser

JBrowse: A next-generation genome browser Resource Mitchell E. Skinner, 1 Andrew V. Uzilov, 1 Lincoln D. Stein, 2 Christopher J. Mungall, 3 and Ian H. Holmes 1,3,4 1 Department of Bioengineering, University of California at Berkeley, Berkeley,

More information

Using The Arabidopsis Information Resource (TAIR) to Find Information About Arabidopsis Genes

Using The Arabidopsis Information Resource (TAIR) to Find Information About Arabidopsis Genes UNIT 1.11 Using The Arabidopsis Information Resource (TAIR) to Find Information About Arabidopsis Genes Leonore Reiser 1, Shabari Subramaniam 1, Donghui Li 1, and Eva Huala 1 1 Phoenix Bioinformatics,

More information

JBrowse: a next-generation genome browser

JBrowse: a next-generation genome browser JBrowse: a next-generation genome browser Mitchell E. Skinner, Andrew V. Uzilov, Lincoln D. Stein, Christopher J. Mungall, and Ian H. Holmes June 13, 2009 Abstract We describe an open source, portable,

More information

For Research Use Only. Not for use in diagnostic procedures.

For Research Use Only. Not for use in diagnostic procedures. SMRT View Guide For Research Use Only. Not for use in diagnostic procedures. P/N 100-088-600-03 Copyright 2012, Pacific Biosciences of California, Inc. All rights reserved. Information in this document

More information

The BEDTools manual. Last updated: 21-September-2010 Current as of BEDTools version Aaron R. Quinlan and Ira M. Hall University of Virginia

The BEDTools manual. Last updated: 21-September-2010 Current as of BEDTools version Aaron R. Quinlan and Ira M. Hall University of Virginia The BEDTools manual Last updated: 21-September-2010 Current as of BEDTools version 2.10.0 Aaron R. Quinlan and Ira M. Hall University of Virginia Contact: aaronquinlan@gmail.com 1. OVERVIEW... 7 1.1 BACKGROUND...7

More information

Eval: A Gene Set Comparison System

Eval: A Gene Set Comparison System Masters Project Report Eval: A Gene Set Comparison System Evan Keibler evan@cse.wustl.edu Table of Contents Table of Contents... - 2 - Chapter 1: Introduction... - 5-1.1 Gene Structure... - 5-1.2 Gene

More information

NextBrowse: An integrated and interactive web-based genome browser for analyzing and interpreting genomic data

NextBrowse: An integrated and interactive web-based genome browser for analyzing and interpreting genomic data NextBrowse: An integrated and interactive web-based genome browser for analyzing and interpreting genomic data Phillip J. Whisenhunt Thesis submitted to the Faculty of the Virginia Polytechnic Institute

More information