diamond Requirements Time Torque/PBS Examples Diamond with single query (simple)
|
|
- Rolf Marsh
- 5 years ago
- Views:
Transcription
1 diamond Diamond is a sequence database searching program with the same function as BlastX, but 1000X faster. A whole transcriptome search of the NCBI nr database, for instance, may take weeks using BlastX, but can be completed in hours with Diamond. Highly recommended for transcriptome analysis Requirements 1. reference database, i suggest uniref90 1. but use nr for MEGAN, this coice is handled in the third example 2. query le(s) in fasta or fastq format. All query sequences should be in a single le Time Diamond is very fast large searches trinity assembly with 5.1 M predicted transcripts vs ncbi nr cpu hrs on snyder with 20 ppn, memory~20gb 54.1 Million x 100 base fastq reads (5.4Gbase) cpu hrs on snyder with 20 ppn, memory~35 Gb Torque/PBS Examples 1. Simple job le for a single query. The following output format is useful for annotation because it include the subject sequence annotation line. --outfmt 6 qseqid qlen qstart qend sseqid slen sstart send length pident evalue stitle Diamond with single query (simple)
2 !/bin/bash PBS -q mgribsko PBS -N diamond PBS -l walltime=300:00:00 PBS -l nodes=1:ppn=20 PBS -l epilogue=/home/mgribsko/jobs/epilogue.sh PBS -l naccesspolicy=shared cd $PBS_O_WORKDIR module load diamond echo "indexing database" make indexed database, only need to do this once for each reference diamond makedb --in uniref90.ren.fasta --db uniref90.ren.dmnd echo "starting search" diamond blastx \ --db uniref90.ren.dmnd \ --threads 20 \ --evalue 1e-05 \ --query all_euk_from_megan.ren.fa \ --outfmt 6 \ --out all_euk_megan.ren.uniref90.dmnd.blastx use the --outfmt option above to get BlastTab output for MEGAN6 for more complete output for annotation use --outfmt 6 qseqid qlen qstart qend sseqid slen sstart send length pident evalue stitle diamond v by Benjamin Buchnk <buchnk@gmail.com> Check for updates. Syntax: diamond COMMAND [OPTIONS] Commands: makedb Build DIAMOND database from a FASTA le blastp Align amino acid query sequences against a protein reference database blastx Align DNA query sequences against a protein reference database view View DIAMOND alignment archive (DAA) formatted le help Produce help message version Display version information getseq Retrieve sequences from a DIAMOND database le General options: --threads (-p) number of CPU threads --db (-d) database le --out (-o) output le --outfmt (-f) output format
3 2. Automated script for use with MEGAN6 Diamond automated script (complex)!/bin/bash PBS -q mgribsko PBS -N diamond PBS -l walltime=8:00:00 PBS -l nodes=1:ppn=20 PBS -l epilogue=/home/mgribsko/jobs/epilogue.sh PBS -l naccesspolicy=shared Diamond blastx; 1000X faster than BlastX query is specied in $taget: fasta or fastq nucleotide sequences are OK the alignment parameters are setup for use with MEGAN6 usage qsub diamond_mult.job run on cluster diamond_mult.job debug print command strings and exit index=false run indexing if true use_personal_exe=true use personally installed exe below diamond_exe="/scratch/snyder/m/mgribsko/src/diamond" datadir="." directory where query les are found target="srr123*.fastq" reference="/scratch/snyder/m/mgribsko/src/megan/nr" reference database fasta db="/scratch/snyder/m/mgribsko/src/megan/nr" indexed reference database echo "Diamond" echo "target: $datadir/$target" echo "index: $index" echo "reference: $reference" echo "db: $db" Begin script; hopefully you should have to change nothing below this if [ $PBS_O_WORKDIR ]; then execute only if qsub if $use_personal_exe; then
4 diamond=$diamond_exe echo -e "diamond exe: $diamond\n" else module load diamond echo -e "diamond exe: bioinfo\n" cd $PBS_O_WORKDIR create index; only if $index is true if $index; then echo "indexing database" make indexed database com0=" $diamond_exe makedb \ --in $reference \ --db $db" echo -e "$com0\n" if [[ $1!= "debug" ]]; then $com Execute search for all les matching $target echo -e "starting search\n" shopt -s nullglob for query in $datadir/$target; do out="${query%\.*}.dmnd.blastx" out="${out\.*/}" com1="$diamond blastx \ --threads 20 \ --db $db \ --query $query \ --outfmt 6 \ --top 10 \ --min-score 50 \ --out $out " echo -e "$com1\n" if [[ $1!= "debug" ]]; then $com1
5 done 3. Most recent automated More automated - works for MEGAN or annotation!/bin/bash PBS -q standby PBS -N diamond PBS -l walltime=150:00:00 PBS -l nodes=1:ppn=20 PBS -l epilogue=/home/mgribsko/jobs/epilogue.sh PBS -l naccesspolicy=shared Diamond blastx; 1000X faster than BlastX query is specied in $target: fasta or fastq nucleotide sequences are OK output le names are <query>.<database>.<outsufx> use mode="megan" for get output suitable for MEGAN6 megan mode assumes the database is ncbi nr and that it's located in $megandir otherwise output will be my favorite for annotation usage qsub diamond_mult.job run on cluster diamond_mult.job debug print command strings and exit mode="megan" index=true datadir="." les are found target="*.fasta.reformatted" outsufx=".dmnd.blastx" run indexing if true directory where query sufx for query les sufx for output les use_personal_exe=true use personally installed exe below diamond_exe="/scratch/snyder/m/mgribsko/src/diamond" reference sequence database. normally the indexed db (dbidx) has the same name as the fasta lei (dbfasta), if you give your database a different name you will have to give these symbols different values. Diamond assumes the the index has the sufx.dmnd
6 dbfasta="/scratch/snyder/m/mgribsko/uniref_180625/diamond /180625uniref90.ren.fasta" dbidx=$dbfasta set up for MEGAN mode, if not MEGAN mode, annotation mode is assumed megandir="/scratch/snyder/m/mgribsko/src/megan" megan reference directory mode_opts="--outfmt 6 qseqid qlen qstart qend sseqid slen sstart send length pident evalue stitle" if [[ $mode == "megan" ]] [[ $mode == "MEGAN" ]]; then echo -e "\nrunning in MEGAN mode" dbfasta="$megandir/nr" dbidx=$dbfasta mode_opts="--outfmt 6 \ --min-score 50 \ --top 10" else echo -e "\nrunning in annotation mode" echo "Diamond" echo "query target: $datadir/$target" echo "output sufx: $outsufx" echo "db index: $dbidx" echo "db fasta: $dbfasta" echo "mode: $mode" Begin script; hopefully you should have to change nothing below this run personal version or bioinfo version if $use_personal_exe; then diamond=$diamond_exe echo -e "diamond exe: $diamond\n" else echo -e "diamond exe: bioinfo\n" if [ $PBS_O_WORKDIR ]; then module load diamond if [ $PBS_O_WORKDIR ]; then
7 execute only if qsub cd $PBS_O_WORKDIR create index; only if $index is true index le is normally in the same directory as the fasta le if $index; then echo -e "\nindexing database" make indexed database com0="$diamond_exe makedb \ --in $dbfasta \ --db $dbidx" echo -e "${com0// /\\n\\t }\n" if [[ $1!= "debug" ]]; then $com Execute search for all les matching $target echo -e "\nstarting search" shopt -s nullglob for query in $datadir/$target; do base db name basedb=${dbidx*/} basedb=${basedb%%\.*} out="${query*/}" out="${out%%\.*}.$basedb$outsufx" com1="$diamond blastx \ --threads 20 \ --db $dbidx \ --query $query \ $mode_opts \ --out $out " com1out=${com1// /\\n\\t } echo -e "\n$com1out" if [[ $1!= "debug" ]]; then $com1 done
8 diamond v by Benjamin Buchnk Licensed under the GNU AGPL < Check for updates. Syntax: diamond COMMAND [OPTIONS] Commands: makedb Build DIAMOND database from a FASTA le blastp Align amino acid query sequences against a protein reference database blastx Align DNA query sequences against a protein reference database view View DIAMOND alignment archive (DAA) formatted le help Produce help message version Display version information getseq Retrieve sequences from a DIAMOND database le dbinfo Print information about a DIAMOND database le General options: --threads (-p) number of CPU threads --db (-d) database le --out (-o) output le --outfmt (-f) output format 0 = BLAST pairwise 5 = BLAST XML 6 = BLAST tabular 100 = DIAMOND alignment archive (DAA) 101 = SAM Value 6 may be followed by a space-separated list of these keywords: qseqid means Query Seq - id qlen means Query sequence length sseqid means Subject Seq - id sallseqid means All subject Seq - id(s), separated by a ';' slen means Subject sequence length qstart means Start of alignment in query qend means End of alignment in query sstart means Start of alignment in subject send means End of alignment in subject qseq means Aligned part of query sequence sseq means Aligned part of subject sequence full_sseq means Full subject sequence evalue means Expect value bitscore means Bit score score means Raw score length means Alignment length pident means Percentage of identical matches nident means Number of identical matches mismatch means Number of mismatches
9 positive means Number of positive - scoring matches gapopen means Number of gap openings gaps means Total number of gaps ppos means Percentage of positive - scoring matches qframe means Query frame btop means Blast traceback operations(btop) staxids means unique Subject Taxonomy ID(s), separated by a ';' (in numerical order) stitle means Subject Title salltitles means All Subject Title(s), separated by a '<>' qcovhsp means Query Coverage Per HSP qtitle means Query title Default: qseqid sseqid pident length mismatch gapopen qstart qend sstart send evalue bitscore --verbose (-v) verbose console output --log enable debug log --quiet disable console output Makedb options: --in input reference le in FASTA format Aligner options: --query (-q) input query le --strand query strands to search (both/minus/plus) --un le for unaligned queries --unal report unaligned queries (0=no, 1=yes) --max-target-seqs (-k) maximum number of target sequences to report alignments for --top report alignments within this percentage range of top alignment score (overrides --max-target-seqs) --range-culling restrict hit culling to overlapping query ranges --compress compression for output les (0=none, 1=gzip) --evalue (-e) maximum e-value to report alignments (default=0.001) --min-score minimum bit score to report alignments (overrides e-value setting) --id minimum identity% to report an alignment --query-cover minimum query cover% to report an alignment --subject-cover minimum subject cover% to report an alignment --sensitive enable sensitive mode (default: fast) --more-sensitive enable more sensitive mode (default: fast) --block-size (-b) sequence block size in billions of letters (default=2.0) --index-chunks (-c) number of chunks for index processing --tmpdir (-t) directory for temporary les --gapopen gap open penalty --gapextend gap extension penalty --frameshift (-F) frame shift penalty (default=disabled) --matrix score matrix for protein alignment (default=blosum62) --custom-matrix le containing custom scoring matrix
10 --lambda lambda parameter for custom matrix --K K parameter for custom matrix --comp-based-stats enable composition based statistics (0 /1=default) --masking enable masking of low complexity regions (0 /1=default) --query-gencode genetic code to use to translate query (see user manual) --salltitles include full subject titles in DAA le --sallseqid include all subject ids in DAA le --no-self-hits suppress reporting of identical self hits --taxonmap protein accession to taxid mapping le --taxonnodes taxonomy nodes.dmp from NCBI --taxonlist restrict search to list of taxon ids (commaseparated) Advanced options: --algo Seed search algorithm (0=double-indexed /1=query-indexed) --bin number of query bins for seed search --min-orf (-l) ignore translated sequences without an open reading frame of at least this length --freq-sd number of standard deviations for ignoring frequent seeds --id2 minimum number of identities for stage 1 hit --window (-w) window size for local hit search --xdrop (-x) xdrop for ungapped alignment --ungapped-score minimum alignment score to continue local extension --hit-band band for hit verication --hit-score minimum score to keep a tentative alignment --gapped-xdrop (-X) xdrop for gapped alignment in bits --band band for dynamic programming computation --shapes (-s) number of seed shapes (0 = all available) --shape-mask seed shapes --index-mode index mode (0=4x12, 1=16x9) --rank-ratio include subjects within this ratio of last hit (stage 1) --rank-ratio2 include subjects within this ratio of last hit (stage 2) --max-hsps maximum number of HSPs per subject sequence to save for each query --range-cover percentage of query range to be covered for hit culling (default=50) --dbsize effective database size (in letters) --no-auto-append disable auto appending of DAA and DMND le extensions --xml-blord-format Use gnl BL_ORD_ID style format in XML output View options: --daa (-a) DIAMOND alignment archive (DAA) le --forwardonly only show alignments of forward strand
11 Getseq options: --seq Sequence numbers to display. Related articles Bbmap Blast DESeq2/EdgeR diamond FastQC Featurecounts HISAT2 HTSeq Kallisto RSEM Salmon SOAPdenovo-Trans Tophat/Cufflinks Transrate Trimmomatic
diamond v February 15, 2018
The DIAMOND protein aligner Introduction DIAMOND is a sequence aligner for protein and translated DNA searches, designed for high performance analysis of big sequence data. The key features are: Pairwise
More informationHow to Run NCBI BLAST on zcluster at GACRC
How to Run NCBI BLAST on zcluster at GACRC BLAST: Basic Local Alignment Search Tool Georgia Advanced Computing Resource Center University of Georgia Suchitra Pakala pakala@uga.edu 1 OVERVIEW What is BLAST?
More informationSequence alignment theory and applications Session 3: BLAST algorithm
Sequence alignment theory and applications Session 3: BLAST algorithm Introduction to Bioinformatics online course : IBT Sonal Henson Learning Objectives Understand the principles of the BLAST algorithm
More informationExamining De Novo Transcriptome Assemblies via a Quality Assessment Pipeline
Examining De Novo Transcriptome Assemblies via a Quality Assessment Pipeline Noushin Ghaffari, Osama A. Arshad, Hyundoo Jeong, John Thiltges, Michael F. Criscitiello, Byung-Jun Yoon, Aniruddha Datta, Charles
More informationBasic Local Alignment Search Tool (BLAST)
BLAST 26.04.2018 Basic Local Alignment Search Tool (BLAST) BLAST (Altshul-1990) is an heuristic Pairwise Alignment composed by six-steps that search for local similarities. The most used access point to
More informationNotes for installing a local blast+ instance of NCBI BLAST F. J. Pineda 09/25/2017
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 Notes for installing a local blast+ instance of NCBI BLAST F. J. Pineda 09/25/2017
More informationDatabase Searching Using BLAST
Mahidol University Objectives SCMI512 Molecular Sequence Analysis Database Searching Using BLAST Lecture 2B After class, students should be able to: explain the FASTA algorithm for database searching explain
More informationAssessing Transcriptome Assembly
Assessing Transcriptome Assembly Matt Johnson July 9, 2015 1 Introduction Now that you have assembled a transcriptome, you are probably wondering about the sequence content. Are the sequences from the
More informationMiniproject 1. Part 1 Due: 16 February. The coverage problem. Method. Why it is hard. Data. Task1
Miniproject 1 Part 1 Due: 16 February The coverage problem given an assembled transcriptome (RNA) and a reference genome (DNA) 1. 2. what fraction (in bases) of the transcriptome sequences match to annotated
More informationBLAST - Basic Local Alignment Search Tool
Lecture for ic Bioinformatics (DD2450) April 11, 2013 Searching 1. Input: Query Sequence 2. Database of sequences 3. Subject Sequence(s) 4. Output: High Segment Pairs (HSPs) Sequence Similarity Measures:
More informationTutorial 4 BLAST Searching the CHO Genome
Tutorial 4 BLAST Searching the CHO Genome Accessing the CHO Genome BLAST Tool The CHO BLAST server can be accessed by clicking on the BLAST button on the home page or by selecting BLAST from the menu bar
More informationINTRODUCTION TO BIOINFORMATICS
Molecular Biology-2019 1 INTRODUCTION TO BIOINFORMATICS In this section, we want to provide a simple introduction to using the web site of the National Center for Biotechnology Information NCBI) to obtain
More informationINTRODUCTION TO BIOINFORMATICS
Molecular Biology-2017 1 INTRODUCTION TO BIOINFORMATICS In this section, we want to provide a simple introduction to using the web site of the National Center for Biotechnology Information NCBI) to obtain
More informationSequence Alignment: BLAST
E S S E N T I A L S O F N E X T G E N E R A T I O N S E Q U E N C I N G W O R K S H O P 2015 U N I V E R S I T Y O F K E N T U C K Y A G T C Class 6 Sequence Alignment: BLAST Be able to install and use
More informationHeuristic methods for pairwise alignment:
Bi03c_1 Unit 03c: Heuristic methods for pairwise alignment: k-tuple-methods k-tuple-methods for alignment of pairs of sequences Bi03c_2 dynamic programming is too slow for large databases Use heuristic
More informationAs of August 15, 2008, GenBank contained bases from reported sequences. The search procedure should be
48 Bioinformatics I, WS 09-10, S. Henz (script by D. Huson) November 26, 2009 4 BLAST and BLAT Outline of the chapter: 1. Heuristics for the pairwise local alignment of two sequences 2. BLAST: search and
More informationMetaPhyler Usage Manual
MetaPhyler Usage Manual Bo Liu boliu@umiacs.umd.edu March 13, 2012 Contents 1 What is MetaPhyler 1 2 Installation 1 3 Quick Start 2 3.1 Taxonomic profiling for metagenomic sequences.............. 2 3.2
More informationWilson Leung 01/03/2018 An Introduction to NCBI BLAST. Prerequisites: Detecting and Interpreting Genetic Homology: Lecture Notes on Alignment
An Introduction to NCBI BLAST Prerequisites: Detecting and Interpreting Genetic Homology: Lecture Notes on Alignment Resources: The BLAST web server is available at https://blast.ncbi.nlm.nih.gov/blast.cgi
More informationAnthill User Group Meeting, 2015
Agenda Anthill User Group Meeting, 2015 1. Introduction to the machines and the networks 2. Accessing the machines 3. Command line introduction 4. Setting up your environment to see the queues 5. The different
More informationBIR pipeline steps and subsequent output files description STEP 1: BLAST search
Lifeportal (Brief description) The Lifeportal at University of Oslo (https://lifeportal.uio.no) is a Galaxy based life sciences portal lifeportal.uio.no under the UiO tools section for phylogenomic analysis,
More informationCompares a sequence of protein to another sequence or database of a protein, or a sequence of DNA to another sequence or library of DNA.
Compares a sequence of protein to another sequence or database of a protein, or a sequence of DNA to another sequence or library of DNA. Fasta is used to compare a protein or DNA sequence to all of the
More informationChIP-seq Analysis Practical
ChIP-seq Analysis Practical Vladimir Teif (vteif@essex.ac.uk) An updated version of this document will be available at http://generegulation.info/index.php/teaching In this practical we will learn how
More information2018/08/16 14:47 1/36 CD-HIT User's Guide
2018/08/16 14:47 1/36 CD-HIT User's Guide CD-HIT User's Guide This page is moving to new CD-HIT wiki page at Github.com Last updated: 2017/06/20 07:38 http://cd-hit.org Program developed by Weizhong Li's
More informationCISC 636 Computational Biology & Bioinformatics (Fall 2016)
CISC 636 Computational Biology & Bioinformatics (Fall 2016) Sequence pairwise alignment Score statistics: E-value and p-value Heuristic algorithms: BLAST and FASTA Database search: gene finding and annotations
More informationSequence Alignment. GBIO0002 Archana Bhardwaj University of Liege
Sequence Alignment GBIO0002 Archana Bhardwaj University of Liege 1 What is Sequence Alignment? A sequence alignment is a way of arranging the sequences of DNA, RNA, or protein to identify regions of similarity.
More information24 Grundlagen der Bioinformatik, SS 10, D. Huson, April 26, This lecture is based on the following papers, which are all recommended reading:
24 Grundlagen der Bioinformatik, SS 10, D. Huson, April 26, 2010 3 BLAST and FASTA This lecture is based on the following papers, which are all recommended reading: D.J. Lipman and W.R. Pearson, Rapid
More informationBioinformatics. Sequence alignment BLAST Significance. Next time Protein Structure
Bioinformatics Sequence alignment BLAST Significance Next time Protein Structure 1 Experimental origins of sequence data The Sanger dideoxynucleotide method F Each color is one lane of an electrophoresis
More informationBiology 644: Bioinformatics
Find the best alignment between 2 sequences with lengths n and m, respectively Best alignment is very dependent upon the substitution matrix and gap penalties The Global Alignment Problem tries to find
More informationBioinformatics explained: BLAST. March 8, 2007
Bioinformatics Explained Bioinformatics explained: BLAST March 8, 2007 CLC bio Gustav Wieds Vej 10 8000 Aarhus C Denmark Telephone: +45 70 22 55 09 Fax: +45 70 22 55 19 www.clcbio.com info@clcbio.com Bioinformatics
More informationFASTA. Besides that, FASTA package provides SSEARCH, an implementation of the optimal Smith- Waterman algorithm.
FASTA INTRODUCTION Definition (by David J. Lipman and William R. Pearson in 1985) - Compares a sequence of protein to another sequence or database of a protein, or a sequence of DNA to another sequence
More informationLecture 5 Advanced BLAST
Introduction to Bioinformatics for Medical Research Gideon Greenspan gdg@cs.technion.ac.il Lecture 5 Advanced BLAST BLAST Recap Sequence Alignment Complexity and indexing BLASTN and BLASTP Basic parameters
More informationBLAST MCDB 187. Friday, February 8, 13
BLAST MCDB 187 BLAST Basic Local Alignment Sequence Tool Uses shortcut to compute alignments of a sequence against a database very quickly Typically takes about a minute to align a sequence against a database
More informationHomology Modeling FABP
Homology Modeling FABP Homology modeling is a technique used to approximate the 3D structure of a protein when no experimentally determined structure exists. It operates under the principle that protein
More informationBioinformatics for Biologists
Bioinformatics for Biologists Sequence Analysis: Part I. Pairwise alignment and database searching Fran Lewitter, Ph.D. Director Bioinformatics & Research Computing Whitehead Institute Topics to Cover
More informationHORIZONTAL GENE TRANSFER DETECTION
HORIZONTAL GENE TRANSFER DETECTION Sequenzanalyse und Genomik (Modul 10-202-2207) Alejandro Nabor Lozada-Chávez Before start, the user must create a new folder or directory (WORKING DIRECTORY) for all
More informationSimilarity Searches on Sequence Databases
Similarity Searches on Sequence Databases Lorenza Bordoli Swiss Institute of Bioinformatics EMBnet Course, Zürich, October 2004 Swiss Institute of Bioinformatics Swiss EMBnet node Outline Importance of
More informationCS313 Exercise 4 Cover Page Fall 2017
CS313 Exercise 4 Cover Page Fall 2017 Due by the start of class on Thursday, October 12, 2017. Name(s): In the TIME column, please estimate the time you spent on the parts of this exercise. Please try
More informationLab 4: Multiple Sequence Alignment (MSA)
Lab 4: Multiple Sequence Alignment (MSA) The objective of this lab is to become familiar with the features of several multiple alignment and visualization tools, including the data input and output, basic
More informationNGS Data and Sequence Alignment
Applications and Servers SERVER/REMOTE Compute DB WEB Data files NGS Data and Sequence Alignment SSH WEB SCP Manpreet S. Katari App Aug 11, 2016 Service Terminal IGV Data files Window Personal Computer/Local
More informationUsing the Galaxy Local Bioinformatics Cloud at CARC
Using the Galaxy Local Bioinformatics Cloud at CARC Lijing Bu Sr. Research Scientist Bioinformatics Specialist Center for Evolutionary and Theoretical Immunology (CETI) Department of Biology, University
More informationWilson Leung 05/27/2008 A Simple Introduction to NCBI BLAST
A Simple Introduction to NCBI BLAST Prerequisites: Detecting and Interpreting Genetic Homology: Lecture Notes on Alignment Resources: The BLAST web server is available at http://www.ncbi.nih.gov/blast/
More informationB L A S T! BLAST: Basic local alignment search tool. Copyright notice. February 6, Pairwise alignment: key points. Outline of tonight s lecture
February 6, 2008 BLAST: Basic local alignment search tool B L A S T! Jonathan Pevsner, Ph.D. Introduction to Bioinformatics pevsner@jhmi.edu 4.633.0 Copyright notice Many of the images in this powerpoint
More informationWhole genome assembly comparison of duplication originally described in Bailey et al
WGAC Whole genome assembly comparison of duplication originally described in Bailey et al. 2001. Inputs species name path to FASTA sequence(s) to be processed either a directory of chromosomal FASTA files
More informationExtreme high-speed sequence clustering, alignment and database search
Extreme high-speed sequence clustering, alignment and database search Robert C. Edgar bob@drive5.com http://www.drive5.com/uclust Version 1.1.579 March 29th, 2010 Questions and requests for new features
More informationExeter Sequencing Service
Exeter Sequencing Service A guide to your denovo RNA-seq results An overview Once your results are ready, you will receive an email with a password-protected link to them. Click the link to access your
More informationMercury BLASTN Biosequence Similarity Search System: Technical Reference Guide
Washington University in St. Louis Washington University Open Scholarship All Computer Science and Engineering Research Computer Science and Engineering Report Number: WUCSE-2011-56 2011 Mercury BLASTN
More information2 Algorithm. Algorithms for CD-HIT were described in three papers published in Bioinformatics.
CD-HIT User s Guide Last updated: 2012-04-25 http://cd-hit.org http://bioinformatics.org/cd-hit/ Program developed by Weizhong Li s lab at UCSD http://weizhong-lab.ucsd.edu liwz@sdsc.edu 1 Contents 2 1
More informationDynamic Programming User Manual v1.0 Anton E. Weisstein, Truman State University Aug. 19, 2014
Dynamic Programming User Manual v1.0 Anton E. Weisstein, Truman State University Aug. 19, 2014 Dynamic programming is a group of mathematical methods used to sequentially split a complicated problem into
More informationCAP BLAST. BIOINFORMATICS Su-Shing Chen CISE. 8/20/2005 Su-Shing Chen, CISE 1
CAP 5510-6 BLAST BIOINFORMATICS Su-Shing Chen CISE 8/20/2005 Su-Shing Chen, CISE 1 BLAST Basic Local Alignment Prof Search Su-Shing Chen Tool A Fast Pair-wise Alignment and Database Searching Tool 8/20/2005
More informationSingle Pass, BLAST-like, Approximate String Matching on FPGAs*
Single Pass, BLAST-like, Approximate String Matching on FPGAs* Martin Herbordt Josh Model Yongfeng Gu Bharat Sukhwani Tom VanCourt Computer Architecture and Automated Design Laboratory Department of Electrical
More informationIntroduction to UNIX command-line II
Introduction to UNIX command-line II Boyce Thompson Institute 2017 Prashant Hosmani Class Content Terminal file system navigation Wildcards, shortcuts and special characters File permissions Compression
More informationParameter searches and the batch system
Parameter searches and the batch system Scientific Computing Group css@rrzn.uni-hannover.de Parameter searches and the batch system Scientific Computing Group 1st of October 2012 1 Contents 1 Parameter
More informationBGGN 213 Foundations of Bioinformatics Barry Grant
BGGN 213 Foundations of Bioinformatics Barry Grant http://thegrantlab.org/bggn213 Recap From Last Time: 25 Responses: https://tinyurl.com/bggn213-02-f17 Why ALIGNMENT FOUNDATIONS Why compare biological
More informationASAP - Allele-specific alignment pipeline
ASAP - Allele-specific alignment pipeline Jan 09, 2012 (1) ASAP - Quick Reference ASAP needs a working version of Perl and is run from the command line. Furthermore, Bowtie needs to be installed on your
More informationGenome Assembly. 2 Sept. Groups. Wiki. Job files Read cleaning Other cleaning Genome Assembly
2 Sept Groups Group 5 was down to 3 people so I merged it into the other groups Group 1 is now 6 people anyone want to change? The initial drafter is not the official leader use any management structure
More informationCS 284A: Algorithms for Computational Biology Notes on Lecture: BLAST. The statistics of alignment scores.
CS 284A: Algorithms for Computational Biology Notes on Lecture: BLAST. The statistics of alignment scores. prepared by Oleksii Kuchaiev, based on presentation by Xiaohui Xie on February 20th. 1 Introduction
More informationBLAST Exercise 2: Using mrna and EST Evidence in Annotation Adapted by W. Leung and SCR Elgin from Annotation Using mrna and ESTs by Dr. J.
BLAST Exercise 2: Using mrna and EST Evidence in Annotation Adapted by W. Leung and SCR Elgin from Annotation Using mrna and ESTs by Dr. J. Buhler Prerequisites: BLAST Exercise: Detecting and Interpreting
More information2) NCBI BLAST tutorial This is a users guide written by the education department at NCBI.
Web resources -- Tour. page 1 of 8 This is a guided tour. Any homework is separate. In fact, this exercise is used for multiple classes and is publicly available to everyone. The entire tour will take
More informationWhen we search a nucleic acid databases, there is no need for you to carry out your own six frame translation. Mascot always performs a 6 frame
1 When we search a nucleic acid databases, there is no need for you to carry out your own six frame translation. Mascot always performs a 6 frame translation on the fly. That is, 3 reading frames from
More informationIntroduc)on to annota)on with Artemis. Download presenta.on and data
Introduc)on to annota)on with Artemis Download presenta.on and data Annota)on Assign an informa)on to genomic sequences???? Genome annota)on 1. Iden.fying genomic elements by: Predic)on (structural annota.on
More informationThese will serve as a basic guideline for read prep. This assumes you have demultiplexed Illumina data.
These will serve as a basic guideline for read prep. This assumes you have demultiplexed Illumina data. We have a few different choices for running jobs on DT2 we will explore both here. We need to alter
More informationFinding homologous sequences in databases
Finding homologous sequences in databases There are multiple algorithms to search sequences databases BLAST (EMBL, NCBI, DDBJ, local) FASTA (EMBL, local) For protein only databases scan via Smith-Waterman
More informationBenchmarking of RNA-seq aligners
Lecture 17 RNA-seq Alignment STAR Benchmarking of RNA-seq aligners Benchmarking of RNA-seq aligners Benchmarking of RNA-seq aligners Benchmarking of RNA-seq aligners Based on this analysis the most reliable
More informationBLAST, Profile, and PSI-BLAST
BLAST, Profile, and PSI-BLAST Jianlin Cheng, PhD School of Electrical Engineering and Computer Science University of Central Florida 26 Free for academic use Copyright @ Jianlin Cheng & original sources
More informationBLAST & Genome assembly
BLAST & Genome assembly Solon P. Pissis Tomáš Flouri Heidelberg Institute for Theoretical Studies November 17, 2012 1 Introduction Introduction 2 BLAST What is BLAST? The algorithm 3 Genome assembly De
More information.. Fall 2011 CSC 570: Bioinformatics Alexander Dekhtyar..
.. Fall 2011 CSC 570: Bioinformatics Alexander Dekhtyar.. PAM and BLOSUM Matrices Prepared by: Jason Banich and Chris Hoover Background As DNA sequences change and evolve, certain amino acids are more
More informationLecture Overview. Sequence search & alignment. Searching sequence databases. Sequence Alignment & Search. Goals: Motivations:
Lecture Overview Sequence Alignment & Search Karin Verspoor, Ph.D. Faculty, Computational Bioscience Program University of Colorado School of Medicine With credit and thanks to Larry Hunter for creating
More informationWorking with files. File Reading and Writing. Reading and writing. Opening a file
Working with files File Reading and Writing Reading get info into your program Parsing processing file contents Writing get info out of your program MBV-INFx410 Fall 2014 Reading and writing Three-step
More informationPairwise Sequence Alignment. Zhongming Zhao, PhD
Pairwise Sequence Alignment Zhongming Zhao, PhD Email: zhongming.zhao@vanderbilt.edu http://bioinfo.mc.vanderbilt.edu/ Sequence Similarity match mismatch A T T A C G C G T A C C A T A T T A T G C G A T
More informationUser Manual for MEGAN V6.10.6
User Manual for MEGAN V6.10.6 Daniel H. Huson December 20, 2017 Contents Contents 1 1 Introduction 3 2 Getting Started 5 3 Obtaining and Installing the Program 5 4 Program Overview 6 5 Importing, Reading
More informationA BANDED SMITH-WATERMAN FPGA ACCELERATOR FOR MERCURY BLASTP
A BANDED SITH-WATERAN FPGA ACCELERATOR FOR ERCURY BLASTP Brandon Harris*, Arpith C. Jacob*, Joseph. Lancaster*, Jeremy Buhler*, Roger D. Chamberlain* *Dept. of Computer Science and Engineering, Washington
More information11/8/2017 Trinity De novo Transcriptome Assembly Workshop trinityrnaseq/rnaseq_trinity_tuxedo_workshop Wiki GitHub
trinityrnaseq / RNASeq_Trinity_Tuxedo_Workshop Trinity De novo Transcriptome Assembly Workshop Brian Haas edited this page on Oct 17, 2015 14 revisions De novo RNA-Seq Assembly and Analysis Using Trinity
More informationSequence Analysis, WS 14/15, D. Huson & R. Neher (this part by D. Huson) January 8,
Sequence Analysis, WS 14/15, D. Huson & R. Neher (this part by D. Huson) January 8, 2015 1 8 The DIAMOND algorithm Functional analysis is an important computational problem in microbiome analysis. Typical
More informationScoring and heuristic methods for sequence alignment CG 17
Scoring and heuristic methods for sequence alignment CG 17 Amino Acid Substitution Matrices Used to score alignments. Reflect evolution of sequences. Unitary Matrix: M ij = 1 i=j { 0 o/w Genetic Code Matrix:
More informationSequence Alignment & Search
Sequence Alignment & Search Karin Verspoor, Ph.D. Faculty, Computational Bioscience Program University of Colorado School of Medicine With credit and thanks to Larry Hunter for creating the first version
More informationIntroduction to BLAST with Protein Sequences. Utah State University Spring 2014 STAT 5570: Statistical Bioinformatics Notes 6.2
Introduction to BLAST with Protein Sequences Utah State University Spring 2014 STAT 5570: Statistical Bioinformatics Notes 6.2 1 References Chapter 2 of Biological Sequence Analysis (Durbin et al., 2001)
More informationGuillimin HPC Users Meeting March 17, 2016
Guillimin HPC Users Meeting March 17, 2016 guillimin@calculquebec.ca McGill University / Calcul Québec / Compute Canada Montréal, QC Canada Outline Compute Canada News System Status Software Updates Training
More informationDaniel H. Huson and Stephan C. Schuster with contributions from Alexander F. Auch, Daniel C. Richter, Suparna Mitra and Qi Ji.
User Manual for MEGAN V3.9 Daniel H. Huson and Stephan C. Schuster with contributions from Alexander F. Auch, Daniel C. Richter, Suparna Mitra and Qi Ji March 30, 2010 Contents Contents 1 1 Introduction
More informationTutorial: How to use the Wheat TILLING database
Tutorial: How to use the Wheat TILLING database Last Updated: 9/7/16 1. Visit http://dubcovskylab.ucdavis.edu/wheat_blast to go to the BLAST page or click on the Wheat BLAST button on the homepage. 2.
More informationBLAST. Basic Local Alignment Search Tool. Used to quickly compare a protein or DNA sequence to a database.
BLAST Basic Local Alignment Search Tool Used to quickly compare a protein or DNA sequence to a database. There is no such thing as a free lunch BLAST is fast and highly sensitive compared to competitors.
More informationIntroduction to Computational Molecular Biology
18.417 Introduction to Computational Molecular Biology Lecture 13: October 21, 2004 Scribe: Eitan Reich Lecturer: Ross Lippert Editor: Peter Lee 13.1 Introduction We have been looking at algorithms to
More informationUnderstanding and Pre-processing Raw Illumina Data
Understanding and Pre-processing Raw Illumina Data Matt Johnson October 4, 2013 1 Understanding FASTQ files After an Illumina sequencing run, the data is stored in very large text files in a standard format
More informationMetagenome Processing and Analysis
San Jose State University SJSU ScholarWorks Master's Projects Master's Theses and Graduate Research Spring 2012 Metagenome Processing and Analysis Sheetal Gosrani Follow this and additional works at: http://scholarworks.sjsu.edu/etd_projects
More informationDr. Gabriela Salinas Dr. Orr Shomroni Kaamini Rhaithata
Analysis of RNA sequencing data sets using the Galaxy environment Dr. Gabriela Salinas Dr. Orr Shomroni Kaamini Rhaithata Microarray and Deep-sequencing core facility 30.10.2017 RNA-seq workflow I Hypothesis
More informationChapter 4: Blast. Chaochun Wei Fall 2014
Course organization Introduction ( Week 1-2) Course introduction A brief introduction to molecular biology A brief introduction to sequence comparison Part I: Algorithms for Sequence Analysis (Week 3-11)
More informationRAMMCAP The Rapid Analysis of Multiple Metagenomes with a Clustering and Annotation Pipeline
RAMMCAP The Rapid Analysis of Multiple Metagenomes with a Clustering and Annotation Pipeline Weizhong Li, liwz@sdsc.edu CAMERA project (http://camera.calit2.net) Contents: 1. Introduction 2. Implementation
More informationHIPPIE User Manual. (v0.0.2-beta, 2015/4/26, Yih-Chii Hwang, yihhwang [at] mail.med.upenn.edu)
HIPPIE User Manual (v0.0.2-beta, 2015/4/26, Yih-Chii Hwang, yihhwang [at] mail.med.upenn.edu) OVERVIEW OF HIPPIE o Flowchart of HIPPIE o Requirements PREPARE DIRECTORY STRUCTURE FOR HIPPIE EXECUTION o
More informationWei Shen Third Military Medical University, China Aug 2016
Wei Shen Third Military Medical University, China http://shenwei.me Aug 2016 About http://shenwei.me FASTA/Q formats FASTA FASTQ >cel-let-7 MI0000001 Caenorhabditis elegans let-7 stem-loop UACACUGUGGAUCCGGUGAGGUAGUAGGUUGUAUAGUUUGGAAUAUUACCACCGGUGAAC
More informationCOS 551: Introduction to Computational Molecular Biology Lecture: Oct 17, 2000 Lecturer: Mona Singh Scribe: Jacob Brenner 1. Database Searching
COS 551: Introduction to Computational Molecular Biology Lecture: Oct 17, 2000 Lecturer: Mona Singh Scribe: Jacob Brenner 1 Database Searching In database search, we typically have a large sequence database
More informationSequence Analysis Pipeline
Sequence Analysis Pipeline Transcript fragments 1. PREPROCESSING 2. ASSEMBLY (today) Removal of contaminants, vector, adaptors, etc Put overlapping sequence together and calculate bigger sequences 3. Analysis/Annotation
More informationWorking with files. File Reading and Writing. Reading and writing. Opening a file
Working with files File Reading and Writing Reading get info into your program Parsing processing file contents Writing get info out of your program MBV-INFx410 Fall 2015 Reading and writing Three-step
More informationPyMod 2. User s Guide. PyMod 2 Documention (Last updated: 7/11/2016)
PyMod 2 User s Guide PyMod 2 Documention (Last updated: 7/11/2016) http://schubert.bio.uniroma1.it/pymod/index.html Department of Biochemical Sciences A. Rossi Fanelli, Sapienza University of Rome, Italy
More informationsee also:
ESSENTIALS OF NEXT GENERATION SEQUENCING WORKSHOP 2014 UNIVERSITY OF KENTUCKY AGTC Class 3 Genome Assembly Newbler 2.9 Most assembly programs are run in a similar manner to one another. We will use the
More informationHow to run applications on Aziz supercomputer. Mohammad Rafi System Administrator Fujitsu Technology Solutions
How to run applications on Aziz supercomputer Mohammad Rafi System Administrator Fujitsu Technology Solutions Agenda Overview Compute Nodes Storage Infrastructure Servers Cluster Stack Environment Modules
More informationSimilarity searches in biological sequence databases
Similarity searches in biological sequence databases Volker Flegel september 2004 Page 1 Outline Keyword search in databases General concept Examples SRS Entrez Expasy Similarity searches in databases
More informationMapping Reads to Reference Genome
Mapping Reads to Reference Genome DNA carries genetic information DNA is a double helix of two complementary strands formed by four nucleotides (bases): Adenine, Cytosine, Guanine and Thymine 2 of 31 Gene
More informationEval: A Gene Set Comparison System
Masters Project Report Eval: A Gene Set Comparison System Evan Keibler evan@cse.wustl.edu Table of Contents Table of Contents... - 2 - Chapter 1: Introduction... - 5-1.1 Gene Structure... - 5-1.2 Gene
More informationThe BLASTER suite Documentation
The BLASTER suite Documentation Hadi Quesneville Bioinformatics and genomics Institut Jacques Monod, Paris, France http://www.ijm.fr/ijm/recherche/equipes/bioinformatique-genomique Last modification: 05/09/06
More informationBrowser Exercises - I. Alignments and Comparative genomics
Browser Exercises - I Alignments and Comparative genomics 1. Navigating to the Genome Browser (GBrowse) Note: For this exercise use http://www.tritrypdb.org a. Navigate to the Genome Browser (GBrowse)
More informationSequence analysis Pairwise sequence alignment
UMF11 Introduction to bioinformatics, 25 Sequence analysis Pairwise sequence alignment 1. Sequence alignment Lecturer: Marina lexandersson 12 September, 25 here are two types of sequence alignments, global
More information