diamond Requirements Time Torque/PBS Examples Diamond with single query (simple)

Size: px
Start display at page:

Download "diamond Requirements Time Torque/PBS Examples Diamond with single query (simple)"

Transcription

1 diamond Diamond is a sequence database searching program with the same function as BlastX, but 1000X faster. A whole transcriptome search of the NCBI nr database, for instance, may take weeks using BlastX, but can be completed in hours with Diamond. Highly recommended for transcriptome analysis Requirements 1. reference database, i suggest uniref90 1. but use nr for MEGAN, this coice is handled in the third example 2. query le(s) in fasta or fastq format. All query sequences should be in a single le Time Diamond is very fast large searches trinity assembly with 5.1 M predicted transcripts vs ncbi nr cpu hrs on snyder with 20 ppn, memory~20gb 54.1 Million x 100 base fastq reads (5.4Gbase) cpu hrs on snyder with 20 ppn, memory~35 Gb Torque/PBS Examples 1. Simple job le for a single query. The following output format is useful for annotation because it include the subject sequence annotation line. --outfmt 6 qseqid qlen qstart qend sseqid slen sstart send length pident evalue stitle Diamond with single query (simple)

2 !/bin/bash PBS -q mgribsko PBS -N diamond PBS -l walltime=300:00:00 PBS -l nodes=1:ppn=20 PBS -l epilogue=/home/mgribsko/jobs/epilogue.sh PBS -l naccesspolicy=shared cd $PBS_O_WORKDIR module load diamond echo "indexing database" make indexed database, only need to do this once for each reference diamond makedb --in uniref90.ren.fasta --db uniref90.ren.dmnd echo "starting search" diamond blastx \ --db uniref90.ren.dmnd \ --threads 20 \ --evalue 1e-05 \ --query all_euk_from_megan.ren.fa \ --outfmt 6 \ --out all_euk_megan.ren.uniref90.dmnd.blastx use the --outfmt option above to get BlastTab output for MEGAN6 for more complete output for annotation use --outfmt 6 qseqid qlen qstart qend sseqid slen sstart send length pident evalue stitle diamond v by Benjamin Buchnk <buchnk@gmail.com> Check for updates. Syntax: diamond COMMAND [OPTIONS] Commands: makedb Build DIAMOND database from a FASTA le blastp Align amino acid query sequences against a protein reference database blastx Align DNA query sequences against a protein reference database view View DIAMOND alignment archive (DAA) formatted le help Produce help message version Display version information getseq Retrieve sequences from a DIAMOND database le General options: --threads (-p) number of CPU threads --db (-d) database le --out (-o) output le --outfmt (-f) output format

3 2. Automated script for use with MEGAN6 Diamond automated script (complex)!/bin/bash PBS -q mgribsko PBS -N diamond PBS -l walltime=8:00:00 PBS -l nodes=1:ppn=20 PBS -l epilogue=/home/mgribsko/jobs/epilogue.sh PBS -l naccesspolicy=shared Diamond blastx; 1000X faster than BlastX query is specied in $taget: fasta or fastq nucleotide sequences are OK the alignment parameters are setup for use with MEGAN6 usage qsub diamond_mult.job run on cluster diamond_mult.job debug print command strings and exit index=false run indexing if true use_personal_exe=true use personally installed exe below diamond_exe="/scratch/snyder/m/mgribsko/src/diamond" datadir="." directory where query les are found target="srr123*.fastq" reference="/scratch/snyder/m/mgribsko/src/megan/nr" reference database fasta db="/scratch/snyder/m/mgribsko/src/megan/nr" indexed reference database echo "Diamond" echo "target: $datadir/$target" echo "index: $index" echo "reference: $reference" echo "db: $db" Begin script; hopefully you should have to change nothing below this if [ $PBS_O_WORKDIR ]; then execute only if qsub if $use_personal_exe; then

4 diamond=$diamond_exe echo -e "diamond exe: $diamond\n" else module load diamond echo -e "diamond exe: bioinfo\n" cd $PBS_O_WORKDIR create index; only if $index is true if $index; then echo "indexing database" make indexed database com0=" $diamond_exe makedb \ --in $reference \ --db $db" echo -e "$com0\n" if [[ $1!= "debug" ]]; then $com Execute search for all les matching $target echo -e "starting search\n" shopt -s nullglob for query in $datadir/$target; do out="${query%\.*}.dmnd.blastx" out="${out\.*/}" com1="$diamond blastx \ --threads 20 \ --db $db \ --query $query \ --outfmt 6 \ --top 10 \ --min-score 50 \ --out $out " echo -e "$com1\n" if [[ $1!= "debug" ]]; then $com1

5 done 3. Most recent automated More automated - works for MEGAN or annotation!/bin/bash PBS -q standby PBS -N diamond PBS -l walltime=150:00:00 PBS -l nodes=1:ppn=20 PBS -l epilogue=/home/mgribsko/jobs/epilogue.sh PBS -l naccesspolicy=shared Diamond blastx; 1000X faster than BlastX query is specied in $target: fasta or fastq nucleotide sequences are OK output le names are <query>.<database>.<outsufx> use mode="megan" for get output suitable for MEGAN6 megan mode assumes the database is ncbi nr and that it's located in $megandir otherwise output will be my favorite for annotation usage qsub diamond_mult.job run on cluster diamond_mult.job debug print command strings and exit mode="megan" index=true datadir="." les are found target="*.fasta.reformatted" outsufx=".dmnd.blastx" run indexing if true directory where query sufx for query les sufx for output les use_personal_exe=true use personally installed exe below diamond_exe="/scratch/snyder/m/mgribsko/src/diamond" reference sequence database. normally the indexed db (dbidx) has the same name as the fasta lei (dbfasta), if you give your database a different name you will have to give these symbols different values. Diamond assumes the the index has the sufx.dmnd

6 dbfasta="/scratch/snyder/m/mgribsko/uniref_180625/diamond /180625uniref90.ren.fasta" dbidx=$dbfasta set up for MEGAN mode, if not MEGAN mode, annotation mode is assumed megandir="/scratch/snyder/m/mgribsko/src/megan" megan reference directory mode_opts="--outfmt 6 qseqid qlen qstart qend sseqid slen sstart send length pident evalue stitle" if [[ $mode == "megan" ]] [[ $mode == "MEGAN" ]]; then echo -e "\nrunning in MEGAN mode" dbfasta="$megandir/nr" dbidx=$dbfasta mode_opts="--outfmt 6 \ --min-score 50 \ --top 10" else echo -e "\nrunning in annotation mode" echo "Diamond" echo "query target: $datadir/$target" echo "output sufx: $outsufx" echo "db index: $dbidx" echo "db fasta: $dbfasta" echo "mode: $mode" Begin script; hopefully you should have to change nothing below this run personal version or bioinfo version if $use_personal_exe; then diamond=$diamond_exe echo -e "diamond exe: $diamond\n" else echo -e "diamond exe: bioinfo\n" if [ $PBS_O_WORKDIR ]; then module load diamond if [ $PBS_O_WORKDIR ]; then

7 execute only if qsub cd $PBS_O_WORKDIR create index; only if $index is true index le is normally in the same directory as the fasta le if $index; then echo -e "\nindexing database" make indexed database com0="$diamond_exe makedb \ --in $dbfasta \ --db $dbidx" echo -e "${com0// /\\n\\t }\n" if [[ $1!= "debug" ]]; then $com Execute search for all les matching $target echo -e "\nstarting search" shopt -s nullglob for query in $datadir/$target; do base db name basedb=${dbidx*/} basedb=${basedb%%\.*} out="${query*/}" out="${out%%\.*}.$basedb$outsufx" com1="$diamond blastx \ --threads 20 \ --db $dbidx \ --query $query \ $mode_opts \ --out $out " com1out=${com1// /\\n\\t } echo -e "\n$com1out" if [[ $1!= "debug" ]]; then $com1 done

8 diamond v by Benjamin Buchnk Licensed under the GNU AGPL < Check for updates. Syntax: diamond COMMAND [OPTIONS] Commands: makedb Build DIAMOND database from a FASTA le blastp Align amino acid query sequences against a protein reference database blastx Align DNA query sequences against a protein reference database view View DIAMOND alignment archive (DAA) formatted le help Produce help message version Display version information getseq Retrieve sequences from a DIAMOND database le dbinfo Print information about a DIAMOND database le General options: --threads (-p) number of CPU threads --db (-d) database le --out (-o) output le --outfmt (-f) output format 0 = BLAST pairwise 5 = BLAST XML 6 = BLAST tabular 100 = DIAMOND alignment archive (DAA) 101 = SAM Value 6 may be followed by a space-separated list of these keywords: qseqid means Query Seq - id qlen means Query sequence length sseqid means Subject Seq - id sallseqid means All subject Seq - id(s), separated by a ';' slen means Subject sequence length qstart means Start of alignment in query qend means End of alignment in query sstart means Start of alignment in subject send means End of alignment in subject qseq means Aligned part of query sequence sseq means Aligned part of subject sequence full_sseq means Full subject sequence evalue means Expect value bitscore means Bit score score means Raw score length means Alignment length pident means Percentage of identical matches nident means Number of identical matches mismatch means Number of mismatches

9 positive means Number of positive - scoring matches gapopen means Number of gap openings gaps means Total number of gaps ppos means Percentage of positive - scoring matches qframe means Query frame btop means Blast traceback operations(btop) staxids means unique Subject Taxonomy ID(s), separated by a ';' (in numerical order) stitle means Subject Title salltitles means All Subject Title(s), separated by a '<>' qcovhsp means Query Coverage Per HSP qtitle means Query title Default: qseqid sseqid pident length mismatch gapopen qstart qend sstart send evalue bitscore --verbose (-v) verbose console output --log enable debug log --quiet disable console output Makedb options: --in input reference le in FASTA format Aligner options: --query (-q) input query le --strand query strands to search (both/minus/plus) --un le for unaligned queries --unal report unaligned queries (0=no, 1=yes) --max-target-seqs (-k) maximum number of target sequences to report alignments for --top report alignments within this percentage range of top alignment score (overrides --max-target-seqs) --range-culling restrict hit culling to overlapping query ranges --compress compression for output les (0=none, 1=gzip) --evalue (-e) maximum e-value to report alignments (default=0.001) --min-score minimum bit score to report alignments (overrides e-value setting) --id minimum identity% to report an alignment --query-cover minimum query cover% to report an alignment --subject-cover minimum subject cover% to report an alignment --sensitive enable sensitive mode (default: fast) --more-sensitive enable more sensitive mode (default: fast) --block-size (-b) sequence block size in billions of letters (default=2.0) --index-chunks (-c) number of chunks for index processing --tmpdir (-t) directory for temporary les --gapopen gap open penalty --gapextend gap extension penalty --frameshift (-F) frame shift penalty (default=disabled) --matrix score matrix for protein alignment (default=blosum62) --custom-matrix le containing custom scoring matrix

10 --lambda lambda parameter for custom matrix --K K parameter for custom matrix --comp-based-stats enable composition based statistics (0 /1=default) --masking enable masking of low complexity regions (0 /1=default) --query-gencode genetic code to use to translate query (see user manual) --salltitles include full subject titles in DAA le --sallseqid include all subject ids in DAA le --no-self-hits suppress reporting of identical self hits --taxonmap protein accession to taxid mapping le --taxonnodes taxonomy nodes.dmp from NCBI --taxonlist restrict search to list of taxon ids (commaseparated) Advanced options: --algo Seed search algorithm (0=double-indexed /1=query-indexed) --bin number of query bins for seed search --min-orf (-l) ignore translated sequences without an open reading frame of at least this length --freq-sd number of standard deviations for ignoring frequent seeds --id2 minimum number of identities for stage 1 hit --window (-w) window size for local hit search --xdrop (-x) xdrop for ungapped alignment --ungapped-score minimum alignment score to continue local extension --hit-band band for hit verication --hit-score minimum score to keep a tentative alignment --gapped-xdrop (-X) xdrop for gapped alignment in bits --band band for dynamic programming computation --shapes (-s) number of seed shapes (0 = all available) --shape-mask seed shapes --index-mode index mode (0=4x12, 1=16x9) --rank-ratio include subjects within this ratio of last hit (stage 1) --rank-ratio2 include subjects within this ratio of last hit (stage 2) --max-hsps maximum number of HSPs per subject sequence to save for each query --range-cover percentage of query range to be covered for hit culling (default=50) --dbsize effective database size (in letters) --no-auto-append disable auto appending of DAA and DMND le extensions --xml-blord-format Use gnl BL_ORD_ID style format in XML output View options: --daa (-a) DIAMOND alignment archive (DAA) le --forwardonly only show alignments of forward strand

11 Getseq options: --seq Sequence numbers to display. Related articles Bbmap Blast DESeq2/EdgeR diamond FastQC Featurecounts HISAT2 HTSeq Kallisto RSEM Salmon SOAPdenovo-Trans Tophat/Cufflinks Transrate Trimmomatic

diamond v February 15, 2018

diamond v February 15, 2018 The DIAMOND protein aligner Introduction DIAMOND is a sequence aligner for protein and translated DNA searches, designed for high performance analysis of big sequence data. The key features are: Pairwise

More information

How to Run NCBI BLAST on zcluster at GACRC

How to Run NCBI BLAST on zcluster at GACRC How to Run NCBI BLAST on zcluster at GACRC BLAST: Basic Local Alignment Search Tool Georgia Advanced Computing Resource Center University of Georgia Suchitra Pakala pakala@uga.edu 1 OVERVIEW What is BLAST?

More information

Sequence alignment theory and applications Session 3: BLAST algorithm

Sequence alignment theory and applications Session 3: BLAST algorithm Sequence alignment theory and applications Session 3: BLAST algorithm Introduction to Bioinformatics online course : IBT Sonal Henson Learning Objectives Understand the principles of the BLAST algorithm

More information

Examining De Novo Transcriptome Assemblies via a Quality Assessment Pipeline

Examining De Novo Transcriptome Assemblies via a Quality Assessment Pipeline Examining De Novo Transcriptome Assemblies via a Quality Assessment Pipeline Noushin Ghaffari, Osama A. Arshad, Hyundoo Jeong, John Thiltges, Michael F. Criscitiello, Byung-Jun Yoon, Aniruddha Datta, Charles

More information

Basic Local Alignment Search Tool (BLAST)

Basic Local Alignment Search Tool (BLAST) BLAST 26.04.2018 Basic Local Alignment Search Tool (BLAST) BLAST (Altshul-1990) is an heuristic Pairwise Alignment composed by six-steps that search for local similarities. The most used access point to

More information

Notes for installing a local blast+ instance of NCBI BLAST F. J. Pineda 09/25/2017

Notes for installing a local blast+ instance of NCBI BLAST F. J. Pineda 09/25/2017 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 Notes for installing a local blast+ instance of NCBI BLAST F. J. Pineda 09/25/2017

More information

Database Searching Using BLAST

Database Searching Using BLAST Mahidol University Objectives SCMI512 Molecular Sequence Analysis Database Searching Using BLAST Lecture 2B After class, students should be able to: explain the FASTA algorithm for database searching explain

More information

Assessing Transcriptome Assembly

Assessing Transcriptome Assembly Assessing Transcriptome Assembly Matt Johnson July 9, 2015 1 Introduction Now that you have assembled a transcriptome, you are probably wondering about the sequence content. Are the sequences from the

More information

Miniproject 1. Part 1 Due: 16 February. The coverage problem. Method. Why it is hard. Data. Task1

Miniproject 1. Part 1 Due: 16 February. The coverage problem. Method. Why it is hard. Data. Task1 Miniproject 1 Part 1 Due: 16 February The coverage problem given an assembled transcriptome (RNA) and a reference genome (DNA) 1. 2. what fraction (in bases) of the transcriptome sequences match to annotated

More information

BLAST - Basic Local Alignment Search Tool

BLAST - Basic Local Alignment Search Tool Lecture for ic Bioinformatics (DD2450) April 11, 2013 Searching 1. Input: Query Sequence 2. Database of sequences 3. Subject Sequence(s) 4. Output: High Segment Pairs (HSPs) Sequence Similarity Measures:

More information

Tutorial 4 BLAST Searching the CHO Genome

Tutorial 4 BLAST Searching the CHO Genome Tutorial 4 BLAST Searching the CHO Genome Accessing the CHO Genome BLAST Tool The CHO BLAST server can be accessed by clicking on the BLAST button on the home page or by selecting BLAST from the menu bar

More information

INTRODUCTION TO BIOINFORMATICS

INTRODUCTION TO BIOINFORMATICS Molecular Biology-2019 1 INTRODUCTION TO BIOINFORMATICS In this section, we want to provide a simple introduction to using the web site of the National Center for Biotechnology Information NCBI) to obtain

More information

INTRODUCTION TO BIOINFORMATICS

INTRODUCTION TO BIOINFORMATICS Molecular Biology-2017 1 INTRODUCTION TO BIOINFORMATICS In this section, we want to provide a simple introduction to using the web site of the National Center for Biotechnology Information NCBI) to obtain

More information

Sequence Alignment: BLAST

Sequence Alignment: BLAST E S S E N T I A L S O F N E X T G E N E R A T I O N S E Q U E N C I N G W O R K S H O P 2015 U N I V E R S I T Y O F K E N T U C K Y A G T C Class 6 Sequence Alignment: BLAST Be able to install and use

More information

Heuristic methods for pairwise alignment:

Heuristic methods for pairwise alignment: Bi03c_1 Unit 03c: Heuristic methods for pairwise alignment: k-tuple-methods k-tuple-methods for alignment of pairs of sequences Bi03c_2 dynamic programming is too slow for large databases Use heuristic

More information

As of August 15, 2008, GenBank contained bases from reported sequences. The search procedure should be

As of August 15, 2008, GenBank contained bases from reported sequences. The search procedure should be 48 Bioinformatics I, WS 09-10, S. Henz (script by D. Huson) November 26, 2009 4 BLAST and BLAT Outline of the chapter: 1. Heuristics for the pairwise local alignment of two sequences 2. BLAST: search and

More information

MetaPhyler Usage Manual

MetaPhyler Usage Manual MetaPhyler Usage Manual Bo Liu boliu@umiacs.umd.edu March 13, 2012 Contents 1 What is MetaPhyler 1 2 Installation 1 3 Quick Start 2 3.1 Taxonomic profiling for metagenomic sequences.............. 2 3.2

More information

Wilson Leung 01/03/2018 An Introduction to NCBI BLAST. Prerequisites: Detecting and Interpreting Genetic Homology: Lecture Notes on Alignment

Wilson Leung 01/03/2018 An Introduction to NCBI BLAST. Prerequisites: Detecting and Interpreting Genetic Homology: Lecture Notes on Alignment An Introduction to NCBI BLAST Prerequisites: Detecting and Interpreting Genetic Homology: Lecture Notes on Alignment Resources: The BLAST web server is available at https://blast.ncbi.nlm.nih.gov/blast.cgi

More information

Anthill User Group Meeting, 2015

Anthill User Group Meeting, 2015 Agenda Anthill User Group Meeting, 2015 1. Introduction to the machines and the networks 2. Accessing the machines 3. Command line introduction 4. Setting up your environment to see the queues 5. The different

More information

BIR pipeline steps and subsequent output files description STEP 1: BLAST search

BIR pipeline steps and subsequent output files description STEP 1: BLAST search Lifeportal (Brief description) The Lifeportal at University of Oslo (https://lifeportal.uio.no) is a Galaxy based life sciences portal lifeportal.uio.no under the UiO tools section for phylogenomic analysis,

More information

Compares a sequence of protein to another sequence or database of a protein, or a sequence of DNA to another sequence or library of DNA.

Compares a sequence of protein to another sequence or database of a protein, or a sequence of DNA to another sequence or library of DNA. Compares a sequence of protein to another sequence or database of a protein, or a sequence of DNA to another sequence or library of DNA. Fasta is used to compare a protein or DNA sequence to all of the

More information

ChIP-seq Analysis Practical

ChIP-seq Analysis Practical ChIP-seq Analysis Practical Vladimir Teif (vteif@essex.ac.uk) An updated version of this document will be available at http://generegulation.info/index.php/teaching In this practical we will learn how

More information

2018/08/16 14:47 1/36 CD-HIT User's Guide

2018/08/16 14:47 1/36 CD-HIT User's Guide 2018/08/16 14:47 1/36 CD-HIT User's Guide CD-HIT User's Guide This page is moving to new CD-HIT wiki page at Github.com Last updated: 2017/06/20 07:38 http://cd-hit.org Program developed by Weizhong Li's

More information

CISC 636 Computational Biology & Bioinformatics (Fall 2016)

CISC 636 Computational Biology & Bioinformatics (Fall 2016) CISC 636 Computational Biology & Bioinformatics (Fall 2016) Sequence pairwise alignment Score statistics: E-value and p-value Heuristic algorithms: BLAST and FASTA Database search: gene finding and annotations

More information

Sequence Alignment. GBIO0002 Archana Bhardwaj University of Liege

Sequence Alignment. GBIO0002 Archana Bhardwaj University of Liege Sequence Alignment GBIO0002 Archana Bhardwaj University of Liege 1 What is Sequence Alignment? A sequence alignment is a way of arranging the sequences of DNA, RNA, or protein to identify regions of similarity.

More information

24 Grundlagen der Bioinformatik, SS 10, D. Huson, April 26, This lecture is based on the following papers, which are all recommended reading:

24 Grundlagen der Bioinformatik, SS 10, D. Huson, April 26, This lecture is based on the following papers, which are all recommended reading: 24 Grundlagen der Bioinformatik, SS 10, D. Huson, April 26, 2010 3 BLAST and FASTA This lecture is based on the following papers, which are all recommended reading: D.J. Lipman and W.R. Pearson, Rapid

More information

Bioinformatics. Sequence alignment BLAST Significance. Next time Protein Structure

Bioinformatics. Sequence alignment BLAST Significance. Next time Protein Structure Bioinformatics Sequence alignment BLAST Significance Next time Protein Structure 1 Experimental origins of sequence data The Sanger dideoxynucleotide method F Each color is one lane of an electrophoresis

More information

Biology 644: Bioinformatics

Biology 644: Bioinformatics Find the best alignment between 2 sequences with lengths n and m, respectively Best alignment is very dependent upon the substitution matrix and gap penalties The Global Alignment Problem tries to find

More information

Bioinformatics explained: BLAST. March 8, 2007

Bioinformatics explained: BLAST. March 8, 2007 Bioinformatics Explained Bioinformatics explained: BLAST March 8, 2007 CLC bio Gustav Wieds Vej 10 8000 Aarhus C Denmark Telephone: +45 70 22 55 09 Fax: +45 70 22 55 19 www.clcbio.com info@clcbio.com Bioinformatics

More information

FASTA. Besides that, FASTA package provides SSEARCH, an implementation of the optimal Smith- Waterman algorithm.

FASTA. Besides that, FASTA package provides SSEARCH, an implementation of the optimal Smith- Waterman algorithm. FASTA INTRODUCTION Definition (by David J. Lipman and William R. Pearson in 1985) - Compares a sequence of protein to another sequence or database of a protein, or a sequence of DNA to another sequence

More information

Lecture 5 Advanced BLAST

Lecture 5 Advanced BLAST Introduction to Bioinformatics for Medical Research Gideon Greenspan gdg@cs.technion.ac.il Lecture 5 Advanced BLAST BLAST Recap Sequence Alignment Complexity and indexing BLASTN and BLASTP Basic parameters

More information

BLAST MCDB 187. Friday, February 8, 13

BLAST MCDB 187. Friday, February 8, 13 BLAST MCDB 187 BLAST Basic Local Alignment Sequence Tool Uses shortcut to compute alignments of a sequence against a database very quickly Typically takes about a minute to align a sequence against a database

More information

Homology Modeling FABP

Homology Modeling FABP Homology Modeling FABP Homology modeling is a technique used to approximate the 3D structure of a protein when no experimentally determined structure exists. It operates under the principle that protein

More information

Bioinformatics for Biologists

Bioinformatics for Biologists Bioinformatics for Biologists Sequence Analysis: Part I. Pairwise alignment and database searching Fran Lewitter, Ph.D. Director Bioinformatics & Research Computing Whitehead Institute Topics to Cover

More information

HORIZONTAL GENE TRANSFER DETECTION

HORIZONTAL GENE TRANSFER DETECTION HORIZONTAL GENE TRANSFER DETECTION Sequenzanalyse und Genomik (Modul 10-202-2207) Alejandro Nabor Lozada-Chávez Before start, the user must create a new folder or directory (WORKING DIRECTORY) for all

More information

Similarity Searches on Sequence Databases

Similarity Searches on Sequence Databases Similarity Searches on Sequence Databases Lorenza Bordoli Swiss Institute of Bioinformatics EMBnet Course, Zürich, October 2004 Swiss Institute of Bioinformatics Swiss EMBnet node Outline Importance of

More information

CS313 Exercise 4 Cover Page Fall 2017

CS313 Exercise 4 Cover Page Fall 2017 CS313 Exercise 4 Cover Page Fall 2017 Due by the start of class on Thursday, October 12, 2017. Name(s): In the TIME column, please estimate the time you spent on the parts of this exercise. Please try

More information

Lab 4: Multiple Sequence Alignment (MSA)

Lab 4: Multiple Sequence Alignment (MSA) Lab 4: Multiple Sequence Alignment (MSA) The objective of this lab is to become familiar with the features of several multiple alignment and visualization tools, including the data input and output, basic

More information

NGS Data and Sequence Alignment

NGS Data and Sequence Alignment Applications and Servers SERVER/REMOTE Compute DB WEB Data files NGS Data and Sequence Alignment SSH WEB SCP Manpreet S. Katari App Aug 11, 2016 Service Terminal IGV Data files Window Personal Computer/Local

More information

Using the Galaxy Local Bioinformatics Cloud at CARC

Using the Galaxy Local Bioinformatics Cloud at CARC Using the Galaxy Local Bioinformatics Cloud at CARC Lijing Bu Sr. Research Scientist Bioinformatics Specialist Center for Evolutionary and Theoretical Immunology (CETI) Department of Biology, University

More information

Wilson Leung 05/27/2008 A Simple Introduction to NCBI BLAST

Wilson Leung 05/27/2008 A Simple Introduction to NCBI BLAST A Simple Introduction to NCBI BLAST Prerequisites: Detecting and Interpreting Genetic Homology: Lecture Notes on Alignment Resources: The BLAST web server is available at http://www.ncbi.nih.gov/blast/

More information

B L A S T! BLAST: Basic local alignment search tool. Copyright notice. February 6, Pairwise alignment: key points. Outline of tonight s lecture

B L A S T! BLAST: Basic local alignment search tool. Copyright notice. February 6, Pairwise alignment: key points. Outline of tonight s lecture February 6, 2008 BLAST: Basic local alignment search tool B L A S T! Jonathan Pevsner, Ph.D. Introduction to Bioinformatics pevsner@jhmi.edu 4.633.0 Copyright notice Many of the images in this powerpoint

More information

Whole genome assembly comparison of duplication originally described in Bailey et al

Whole genome assembly comparison of duplication originally described in Bailey et al WGAC Whole genome assembly comparison of duplication originally described in Bailey et al. 2001. Inputs species name path to FASTA sequence(s) to be processed either a directory of chromosomal FASTA files

More information

Extreme high-speed sequence clustering, alignment and database search

Extreme high-speed sequence clustering, alignment and database search Extreme high-speed sequence clustering, alignment and database search Robert C. Edgar bob@drive5.com http://www.drive5.com/uclust Version 1.1.579 March 29th, 2010 Questions and requests for new features

More information

Exeter Sequencing Service

Exeter Sequencing Service Exeter Sequencing Service A guide to your denovo RNA-seq results An overview Once your results are ready, you will receive an email with a password-protected link to them. Click the link to access your

More information

Mercury BLASTN Biosequence Similarity Search System: Technical Reference Guide

Mercury BLASTN Biosequence Similarity Search System: Technical Reference Guide Washington University in St. Louis Washington University Open Scholarship All Computer Science and Engineering Research Computer Science and Engineering Report Number: WUCSE-2011-56 2011 Mercury BLASTN

More information

2 Algorithm. Algorithms for CD-HIT were described in three papers published in Bioinformatics.

2 Algorithm. Algorithms for CD-HIT were described in three papers published in Bioinformatics. CD-HIT User s Guide Last updated: 2012-04-25 http://cd-hit.org http://bioinformatics.org/cd-hit/ Program developed by Weizhong Li s lab at UCSD http://weizhong-lab.ucsd.edu liwz@sdsc.edu 1 Contents 2 1

More information

Dynamic Programming User Manual v1.0 Anton E. Weisstein, Truman State University Aug. 19, 2014

Dynamic Programming User Manual v1.0 Anton E. Weisstein, Truman State University Aug. 19, 2014 Dynamic Programming User Manual v1.0 Anton E. Weisstein, Truman State University Aug. 19, 2014 Dynamic programming is a group of mathematical methods used to sequentially split a complicated problem into

More information

CAP BLAST. BIOINFORMATICS Su-Shing Chen CISE. 8/20/2005 Su-Shing Chen, CISE 1

CAP BLAST. BIOINFORMATICS Su-Shing Chen CISE. 8/20/2005 Su-Shing Chen, CISE 1 CAP 5510-6 BLAST BIOINFORMATICS Su-Shing Chen CISE 8/20/2005 Su-Shing Chen, CISE 1 BLAST Basic Local Alignment Prof Search Su-Shing Chen Tool A Fast Pair-wise Alignment and Database Searching Tool 8/20/2005

More information

Single Pass, BLAST-like, Approximate String Matching on FPGAs*

Single Pass, BLAST-like, Approximate String Matching on FPGAs* Single Pass, BLAST-like, Approximate String Matching on FPGAs* Martin Herbordt Josh Model Yongfeng Gu Bharat Sukhwani Tom VanCourt Computer Architecture and Automated Design Laboratory Department of Electrical

More information

Introduction to UNIX command-line II

Introduction to UNIX command-line II Introduction to UNIX command-line II Boyce Thompson Institute 2017 Prashant Hosmani Class Content Terminal file system navigation Wildcards, shortcuts and special characters File permissions Compression

More information

Parameter searches and the batch system

Parameter searches and the batch system Parameter searches and the batch system Scientific Computing Group css@rrzn.uni-hannover.de Parameter searches and the batch system Scientific Computing Group 1st of October 2012 1 Contents 1 Parameter

More information

BGGN 213 Foundations of Bioinformatics Barry Grant

BGGN 213 Foundations of Bioinformatics Barry Grant BGGN 213 Foundations of Bioinformatics Barry Grant http://thegrantlab.org/bggn213 Recap From Last Time: 25 Responses: https://tinyurl.com/bggn213-02-f17 Why ALIGNMENT FOUNDATIONS Why compare biological

More information

ASAP - Allele-specific alignment pipeline

ASAP - Allele-specific alignment pipeline ASAP - Allele-specific alignment pipeline Jan 09, 2012 (1) ASAP - Quick Reference ASAP needs a working version of Perl and is run from the command line. Furthermore, Bowtie needs to be installed on your

More information

Genome Assembly. 2 Sept. Groups. Wiki. Job files Read cleaning Other cleaning Genome Assembly

Genome Assembly. 2 Sept. Groups. Wiki. Job files Read cleaning Other cleaning Genome Assembly 2 Sept Groups Group 5 was down to 3 people so I merged it into the other groups Group 1 is now 6 people anyone want to change? The initial drafter is not the official leader use any management structure

More information

CS 284A: Algorithms for Computational Biology Notes on Lecture: BLAST. The statistics of alignment scores.

CS 284A: Algorithms for Computational Biology Notes on Lecture: BLAST. The statistics of alignment scores. CS 284A: Algorithms for Computational Biology Notes on Lecture: BLAST. The statistics of alignment scores. prepared by Oleksii Kuchaiev, based on presentation by Xiaohui Xie on February 20th. 1 Introduction

More information

BLAST Exercise 2: Using mrna and EST Evidence in Annotation Adapted by W. Leung and SCR Elgin from Annotation Using mrna and ESTs by Dr. J.

BLAST Exercise 2: Using mrna and EST Evidence in Annotation Adapted by W. Leung and SCR Elgin from Annotation Using mrna and ESTs by Dr. J. BLAST Exercise 2: Using mrna and EST Evidence in Annotation Adapted by W. Leung and SCR Elgin from Annotation Using mrna and ESTs by Dr. J. Buhler Prerequisites: BLAST Exercise: Detecting and Interpreting

More information

2) NCBI BLAST tutorial This is a users guide written by the education department at NCBI.

2) NCBI BLAST tutorial   This is a users guide written by the education department at NCBI. Web resources -- Tour. page 1 of 8 This is a guided tour. Any homework is separate. In fact, this exercise is used for multiple classes and is publicly available to everyone. The entire tour will take

More information

When we search a nucleic acid databases, there is no need for you to carry out your own six frame translation. Mascot always performs a 6 frame

When we search a nucleic acid databases, there is no need for you to carry out your own six frame translation. Mascot always performs a 6 frame 1 When we search a nucleic acid databases, there is no need for you to carry out your own six frame translation. Mascot always performs a 6 frame translation on the fly. That is, 3 reading frames from

More information

Introduc)on to annota)on with Artemis. Download presenta.on and data

Introduc)on to annota)on with Artemis. Download presenta.on and data Introduc)on to annota)on with Artemis Download presenta.on and data Annota)on Assign an informa)on to genomic sequences???? Genome annota)on 1. Iden.fying genomic elements by: Predic)on (structural annota.on

More information

These will serve as a basic guideline for read prep. This assumes you have demultiplexed Illumina data.

These will serve as a basic guideline for read prep. This assumes you have demultiplexed Illumina data. These will serve as a basic guideline for read prep. This assumes you have demultiplexed Illumina data. We have a few different choices for running jobs on DT2 we will explore both here. We need to alter

More information

Finding homologous sequences in databases

Finding homologous sequences in databases Finding homologous sequences in databases There are multiple algorithms to search sequences databases BLAST (EMBL, NCBI, DDBJ, local) FASTA (EMBL, local) For protein only databases scan via Smith-Waterman

More information

Benchmarking of RNA-seq aligners

Benchmarking of RNA-seq aligners Lecture 17 RNA-seq Alignment STAR Benchmarking of RNA-seq aligners Benchmarking of RNA-seq aligners Benchmarking of RNA-seq aligners Benchmarking of RNA-seq aligners Based on this analysis the most reliable

More information

BLAST, Profile, and PSI-BLAST

BLAST, Profile, and PSI-BLAST BLAST, Profile, and PSI-BLAST Jianlin Cheng, PhD School of Electrical Engineering and Computer Science University of Central Florida 26 Free for academic use Copyright @ Jianlin Cheng & original sources

More information

BLAST & Genome assembly

BLAST & Genome assembly BLAST & Genome assembly Solon P. Pissis Tomáš Flouri Heidelberg Institute for Theoretical Studies November 17, 2012 1 Introduction Introduction 2 BLAST What is BLAST? The algorithm 3 Genome assembly De

More information

.. Fall 2011 CSC 570: Bioinformatics Alexander Dekhtyar..

.. Fall 2011 CSC 570: Bioinformatics Alexander Dekhtyar.. .. Fall 2011 CSC 570: Bioinformatics Alexander Dekhtyar.. PAM and BLOSUM Matrices Prepared by: Jason Banich and Chris Hoover Background As DNA sequences change and evolve, certain amino acids are more

More information

Lecture Overview. Sequence search & alignment. Searching sequence databases. Sequence Alignment & Search. Goals: Motivations:

Lecture Overview. Sequence search & alignment. Searching sequence databases. Sequence Alignment & Search. Goals: Motivations: Lecture Overview Sequence Alignment & Search Karin Verspoor, Ph.D. Faculty, Computational Bioscience Program University of Colorado School of Medicine With credit and thanks to Larry Hunter for creating

More information

Working with files. File Reading and Writing. Reading and writing. Opening a file

Working with files. File Reading and Writing. Reading and writing. Opening a file Working with files File Reading and Writing Reading get info into your program Parsing processing file contents Writing get info out of your program MBV-INFx410 Fall 2014 Reading and writing Three-step

More information

Pairwise Sequence Alignment. Zhongming Zhao, PhD

Pairwise Sequence Alignment. Zhongming Zhao, PhD Pairwise Sequence Alignment Zhongming Zhao, PhD Email: zhongming.zhao@vanderbilt.edu http://bioinfo.mc.vanderbilt.edu/ Sequence Similarity match mismatch A T T A C G C G T A C C A T A T T A T G C G A T

More information

User Manual for MEGAN V6.10.6

User Manual for MEGAN V6.10.6 User Manual for MEGAN V6.10.6 Daniel H. Huson December 20, 2017 Contents Contents 1 1 Introduction 3 2 Getting Started 5 3 Obtaining and Installing the Program 5 4 Program Overview 6 5 Importing, Reading

More information

A BANDED SMITH-WATERMAN FPGA ACCELERATOR FOR MERCURY BLASTP

A BANDED SMITH-WATERMAN FPGA ACCELERATOR FOR MERCURY BLASTP A BANDED SITH-WATERAN FPGA ACCELERATOR FOR ERCURY BLASTP Brandon Harris*, Arpith C. Jacob*, Joseph. Lancaster*, Jeremy Buhler*, Roger D. Chamberlain* *Dept. of Computer Science and Engineering, Washington

More information

11/8/2017 Trinity De novo Transcriptome Assembly Workshop trinityrnaseq/rnaseq_trinity_tuxedo_workshop Wiki GitHub

11/8/2017 Trinity De novo Transcriptome Assembly Workshop trinityrnaseq/rnaseq_trinity_tuxedo_workshop Wiki GitHub trinityrnaseq / RNASeq_Trinity_Tuxedo_Workshop Trinity De novo Transcriptome Assembly Workshop Brian Haas edited this page on Oct 17, 2015 14 revisions De novo RNA-Seq Assembly and Analysis Using Trinity

More information

Sequence Analysis, WS 14/15, D. Huson & R. Neher (this part by D. Huson) January 8,

Sequence Analysis, WS 14/15, D. Huson & R. Neher (this part by D. Huson) January 8, Sequence Analysis, WS 14/15, D. Huson & R. Neher (this part by D. Huson) January 8, 2015 1 8 The DIAMOND algorithm Functional analysis is an important computational problem in microbiome analysis. Typical

More information

Scoring and heuristic methods for sequence alignment CG 17

Scoring and heuristic methods for sequence alignment CG 17 Scoring and heuristic methods for sequence alignment CG 17 Amino Acid Substitution Matrices Used to score alignments. Reflect evolution of sequences. Unitary Matrix: M ij = 1 i=j { 0 o/w Genetic Code Matrix:

More information

Sequence Alignment & Search

Sequence Alignment & Search Sequence Alignment & Search Karin Verspoor, Ph.D. Faculty, Computational Bioscience Program University of Colorado School of Medicine With credit and thanks to Larry Hunter for creating the first version

More information

Introduction to BLAST with Protein Sequences. Utah State University Spring 2014 STAT 5570: Statistical Bioinformatics Notes 6.2

Introduction to BLAST with Protein Sequences. Utah State University Spring 2014 STAT 5570: Statistical Bioinformatics Notes 6.2 Introduction to BLAST with Protein Sequences Utah State University Spring 2014 STAT 5570: Statistical Bioinformatics Notes 6.2 1 References Chapter 2 of Biological Sequence Analysis (Durbin et al., 2001)

More information

Guillimin HPC Users Meeting March 17, 2016

Guillimin HPC Users Meeting March 17, 2016 Guillimin HPC Users Meeting March 17, 2016 guillimin@calculquebec.ca McGill University / Calcul Québec / Compute Canada Montréal, QC Canada Outline Compute Canada News System Status Software Updates Training

More information

Daniel H. Huson and Stephan C. Schuster with contributions from Alexander F. Auch, Daniel C. Richter, Suparna Mitra and Qi Ji.

Daniel H. Huson and Stephan C. Schuster with contributions from Alexander F. Auch, Daniel C. Richter, Suparna Mitra and Qi Ji. User Manual for MEGAN V3.9 Daniel H. Huson and Stephan C. Schuster with contributions from Alexander F. Auch, Daniel C. Richter, Suparna Mitra and Qi Ji March 30, 2010 Contents Contents 1 1 Introduction

More information

Tutorial: How to use the Wheat TILLING database

Tutorial: How to use the Wheat TILLING database Tutorial: How to use the Wheat TILLING database Last Updated: 9/7/16 1. Visit http://dubcovskylab.ucdavis.edu/wheat_blast to go to the BLAST page or click on the Wheat BLAST button on the homepage. 2.

More information

BLAST. Basic Local Alignment Search Tool. Used to quickly compare a protein or DNA sequence to a database.

BLAST. Basic Local Alignment Search Tool. Used to quickly compare a protein or DNA sequence to a database. BLAST Basic Local Alignment Search Tool Used to quickly compare a protein or DNA sequence to a database. There is no such thing as a free lunch BLAST is fast and highly sensitive compared to competitors.

More information

Introduction to Computational Molecular Biology

Introduction to Computational Molecular Biology 18.417 Introduction to Computational Molecular Biology Lecture 13: October 21, 2004 Scribe: Eitan Reich Lecturer: Ross Lippert Editor: Peter Lee 13.1 Introduction We have been looking at algorithms to

More information

Understanding and Pre-processing Raw Illumina Data

Understanding and Pre-processing Raw Illumina Data Understanding and Pre-processing Raw Illumina Data Matt Johnson October 4, 2013 1 Understanding FASTQ files After an Illumina sequencing run, the data is stored in very large text files in a standard format

More information

Metagenome Processing and Analysis

Metagenome Processing and Analysis San Jose State University SJSU ScholarWorks Master's Projects Master's Theses and Graduate Research Spring 2012 Metagenome Processing and Analysis Sheetal Gosrani Follow this and additional works at: http://scholarworks.sjsu.edu/etd_projects

More information

Dr. Gabriela Salinas Dr. Orr Shomroni Kaamini Rhaithata

Dr. Gabriela Salinas Dr. Orr Shomroni Kaamini Rhaithata Analysis of RNA sequencing data sets using the Galaxy environment Dr. Gabriela Salinas Dr. Orr Shomroni Kaamini Rhaithata Microarray and Deep-sequencing core facility 30.10.2017 RNA-seq workflow I Hypothesis

More information

Chapter 4: Blast. Chaochun Wei Fall 2014

Chapter 4: Blast. Chaochun Wei Fall 2014 Course organization Introduction ( Week 1-2) Course introduction A brief introduction to molecular biology A brief introduction to sequence comparison Part I: Algorithms for Sequence Analysis (Week 3-11)

More information

RAMMCAP The Rapid Analysis of Multiple Metagenomes with a Clustering and Annotation Pipeline

RAMMCAP The Rapid Analysis of Multiple Metagenomes with a Clustering and Annotation Pipeline RAMMCAP The Rapid Analysis of Multiple Metagenomes with a Clustering and Annotation Pipeline Weizhong Li, liwz@sdsc.edu CAMERA project (http://camera.calit2.net) Contents: 1. Introduction 2. Implementation

More information

HIPPIE User Manual. (v0.0.2-beta, 2015/4/26, Yih-Chii Hwang, yihhwang [at] mail.med.upenn.edu)

HIPPIE User Manual. (v0.0.2-beta, 2015/4/26, Yih-Chii Hwang, yihhwang [at] mail.med.upenn.edu) HIPPIE User Manual (v0.0.2-beta, 2015/4/26, Yih-Chii Hwang, yihhwang [at] mail.med.upenn.edu) OVERVIEW OF HIPPIE o Flowchart of HIPPIE o Requirements PREPARE DIRECTORY STRUCTURE FOR HIPPIE EXECUTION o

More information

Wei Shen Third Military Medical University, China Aug 2016

Wei Shen Third Military Medical University, China  Aug 2016 Wei Shen Third Military Medical University, China http://shenwei.me Aug 2016 About http://shenwei.me FASTA/Q formats FASTA FASTQ >cel-let-7 MI0000001 Caenorhabditis elegans let-7 stem-loop UACACUGUGGAUCCGGUGAGGUAGUAGGUUGUAUAGUUUGGAAUAUUACCACCGGUGAAC

More information

COS 551: Introduction to Computational Molecular Biology Lecture: Oct 17, 2000 Lecturer: Mona Singh Scribe: Jacob Brenner 1. Database Searching

COS 551: Introduction to Computational Molecular Biology Lecture: Oct 17, 2000 Lecturer: Mona Singh Scribe: Jacob Brenner 1. Database Searching COS 551: Introduction to Computational Molecular Biology Lecture: Oct 17, 2000 Lecturer: Mona Singh Scribe: Jacob Brenner 1 Database Searching In database search, we typically have a large sequence database

More information

Sequence Analysis Pipeline

Sequence Analysis Pipeline Sequence Analysis Pipeline Transcript fragments 1. PREPROCESSING 2. ASSEMBLY (today) Removal of contaminants, vector, adaptors, etc Put overlapping sequence together and calculate bigger sequences 3. Analysis/Annotation

More information

Working with files. File Reading and Writing. Reading and writing. Opening a file

Working with files. File Reading and Writing. Reading and writing. Opening a file Working with files File Reading and Writing Reading get info into your program Parsing processing file contents Writing get info out of your program MBV-INFx410 Fall 2015 Reading and writing Three-step

More information

PyMod 2. User s Guide. PyMod 2 Documention (Last updated: 7/11/2016)

PyMod 2. User s Guide. PyMod 2 Documention (Last updated: 7/11/2016) PyMod 2 User s Guide PyMod 2 Documention (Last updated: 7/11/2016) http://schubert.bio.uniroma1.it/pymod/index.html Department of Biochemical Sciences A. Rossi Fanelli, Sapienza University of Rome, Italy

More information

see also:

see also: ESSENTIALS OF NEXT GENERATION SEQUENCING WORKSHOP 2014 UNIVERSITY OF KENTUCKY AGTC Class 3 Genome Assembly Newbler 2.9 Most assembly programs are run in a similar manner to one another. We will use the

More information

How to run applications on Aziz supercomputer. Mohammad Rafi System Administrator Fujitsu Technology Solutions

How to run applications on Aziz supercomputer. Mohammad Rafi System Administrator Fujitsu Technology Solutions How to run applications on Aziz supercomputer Mohammad Rafi System Administrator Fujitsu Technology Solutions Agenda Overview Compute Nodes Storage Infrastructure Servers Cluster Stack Environment Modules

More information

Similarity searches in biological sequence databases

Similarity searches in biological sequence databases Similarity searches in biological sequence databases Volker Flegel september 2004 Page 1 Outline Keyword search in databases General concept Examples SRS Entrez Expasy Similarity searches in databases

More information

Mapping Reads to Reference Genome

Mapping Reads to Reference Genome Mapping Reads to Reference Genome DNA carries genetic information DNA is a double helix of two complementary strands formed by four nucleotides (bases): Adenine, Cytosine, Guanine and Thymine 2 of 31 Gene

More information

Eval: A Gene Set Comparison System

Eval: A Gene Set Comparison System Masters Project Report Eval: A Gene Set Comparison System Evan Keibler evan@cse.wustl.edu Table of Contents Table of Contents... - 2 - Chapter 1: Introduction... - 5-1.1 Gene Structure... - 5-1.2 Gene

More information

The BLASTER suite Documentation

The BLASTER suite Documentation The BLASTER suite Documentation Hadi Quesneville Bioinformatics and genomics Institut Jacques Monod, Paris, France http://www.ijm.fr/ijm/recherche/equipes/bioinformatique-genomique Last modification: 05/09/06

More information

Browser Exercises - I. Alignments and Comparative genomics

Browser Exercises - I. Alignments and Comparative genomics Browser Exercises - I Alignments and Comparative genomics 1. Navigating to the Genome Browser (GBrowse) Note: For this exercise use http://www.tritrypdb.org a. Navigate to the Genome Browser (GBrowse)

More information

Sequence analysis Pairwise sequence alignment

Sequence analysis Pairwise sequence alignment UMF11 Introduction to bioinformatics, 25 Sequence analysis Pairwise sequence alignment 1. Sequence alignment Lecturer: Marina lexandersson 12 September, 25 here are two types of sequence alignments, global

More information