The Role of the Indigenous Microbiota in Zebrafish Gastrointestinal Tract Development. Karen Guillemin University of Oregon

Size: px
Start display at page:

Download "The Role of the Indigenous Microbiota in Zebrafish Gastrointestinal Tract Development. Karen Guillemin University of Oregon"

Transcription

1 The Role of the Indigenous Microbiota in Zebrafish Gastrointestinal Tract Development Karen Guillemin University of Oregon

2 human cells GI tract bacteria cells 25,000 genes ~500 species 1,000,000 genes

3 How is the microbiota established during development? What role does the microbiota play in host development? How does the host perceive and respond to the presence of the microbiota?

4 Advantages of a germ-free zebrafish model Ex-utero development facilitates sterilization of embryos Transparency of larvae allows visualization of internal organs and bacterial interactions Zebrafish GI tract development and physiology is similar to that of mammals Zebrafish have an adaptive and innate immune system similar to mammals Zebrafish are amenable to genetic analysis

5 Anatomy of a zebrafish larva esophageal-intestinal junction intestinal bulb distal intestine vent 8 dpf DAPI

6 Important events in zebrafish development macrophages functional lymphocytes in thymus first V(D)J recombination thymus mature onset of humoral immunity 21 28

7 Bacteria on the zebrafish chorion 10 µm

8 Bacterial distribution during development DAPI Eubacteria 35 hpf 4 dpf 5 dpf 8 dpf

9 Bacteria in the adult gut lumen are sampled by host cells Aeromonas veronii 16S probe Flavobacterium johnsoniae 16S probe

10 Bacterial load during development based on qpcr of 16S rdna E E E+08 Copies 16S rdna/fish E E E E E E E E Adult 12 GI Age (days post fertilization)

11 8 dpf 4 dpf The microbiota changes during development Eubacteria Aeromonas Eubacteria Pseudomonas

12 Important events in zebrafish development macrophages functional lymphocytes in thymus first V(D)J recombination establishment of microbiota ` thymus mature onset of humoral immunity 21 28

13 Raising germfree zebrafish larvae bleach treat newly laid embryos larvae grown in sterile media CV d0 CV d8 CV d8 GF d8 - control - control + control Assay for sterility by: plating PCR with pan bacterial 16S primers microscopy negative control positive bleached untreated control

14 SEM of the surface of untreated and bleached embryos 10 µm Conventionally reared 10 µm Bleach treated

15 Quantification of bacterial 16S rdna S rdna copy number water GF CV

16 Reconstitution of the microbiota in germ-free zebrafish larvae bleach treat newly laid embryos grow in sterile media Day 5 Day 8 transfer to media from conventionally reared fish ex-germ-free larvae

17 Quantification of bacterial 16S rdna S rdna copy number water GF CV XGF

18 Germ-free and ex-germ-free zebrafish CV GF XGF Eubacteria autofluorescence

19 The germ-free intestine fails to up-regulate alkaline phosphatase activity CV 2 dpf CV 3 dpf CV 5 dpf CV 8 dpf GF 8 dpf XGF 8 dpf Alkaline phosphatase activity

20 Quantification of intestinal alkaline phosphatase activity 1.6 ng Pi/min/mg tissue CV 5dpf CV 8dpf GF 8dpf XGF 8dpf

21 The germ-free intestine fails to down-regulation Galα1,3Gal expression CV 5 dpf CV 8 dpf GF 5 dpf GF 8 dpf XGF 8 dpf distal proximal Isolectin B-4 autofluorescence

22 Quantification of Galα1,3Gal expression at the esophogeal-intestinal junction 700 IB4 staining (arbitrary units) CV 5dpf CV 8dpf GF 8dpf XGF 8dpf

23 The germ-free intestine contains fewer goblet cells CV 5 dpf CV 8 dpf GF 5 dpf XGF 8 dpf

24 Quantification of goblet cells 250 goblet cells/intestine CV 5 dpf CV 8 dpf GF 8 dpf XGF 8 dpf

25 The germ-free intestine fails to absorb protein CV GF XGF HRP protein after 24 hour feeding

26 Regular peristalsis is established by 6 dpf 4.5 dpf 5.5 dpf 4.5 dpf 5.5 dpf 6 dpf Julie Kuhlman Judith Eisen

27 Peristalsis is faster in germ-free larvae GF CV XGF Average time between contractions

28 Monoassociation of germfree zebrafish larvae bleach treat newly laid embryos grow in sterile media Day 5 Day 8 Introduce bacterial culture into flask with a sterile needle Monoassociated larvae

29 Monoassociations with Aeromonas sobria and Pseudomonas putida AMA Eubacteria PMA Aeromonas Merge Eubacteria Psedomonas Merge

30 Monoassociation with Aeromonas and Pseudomonas spp. reverses GF phenotypes 1.6 Alkaline phosphatase activity 700 Galα1,3Gal expresison ng Pi/min/mg tissue IB4 staining (arbitrary units) CV 8dpf GF 8dpfXGF XGF 0 8dpfAMA AMA 8dpfPMA PMA 8dp CV CV 8dpfGF GF 8dpfXGF XGF 8dpf AMA AMA 8dpf PMA PMA 8d

31 Heat-killed bacteria are not sufficient to reverse all GF phenotypes 1.6 Alkaline phosphatase activity 700 Galα1,3Gal expresison ng Pi/min/mg tissue IB4 staining (arbitrary units) CV GF XGF AMA PMA HK CV 8dpfGF 8dpfXGF 8dpf AMA 8dpf PMA 8dpf HK 8dpf 0 CV CV 8dpf GF GF 8dpf XGF XGF 8dpf AMA AMA 8dpf PMA PMA 8dpf HK HK 8dp

32 LPS is sufficient to induce intestinal alkaline phosphatase activity 1.6 Alkaline phosphatase activity 700 Galα1,3Gal expresison ng Pi/min/mg tissue IB4 staining (arbitrary units) CV CV8dpf GF GF 8dpf XGF XGF 8dpf AMAPMA AMA 8dpf PMA 8dpf HK HK 8dpfLPS LPS CV CV 8dpf GF GF 8dpf XGF XGF 8dpf AMA AMA 8dpf PMA PMA 8dpf HK HK 8dp

33 The GI microbiota is established after hatching The microbiota is required for the maturation of patterns of expression of glycans and intestinal alkaline phosphatase activity The microbiota is required for normal goblet cell numbers The microbiota is required for protein absorption in the distal intestine and rates of peristalsis Heat-killed bacteria reverse the GF alkaline phosphatase phenotype but not the expression of Gala1,3Gal glycans.

34 Toll like receptors recognize generic microbial patterns Akira (2003) JBC 278:

35 TLR signaling is required to protect against intestinal injury Susceptibility to dextran sulfate sodium Rakoff-Nahoum et al. (2004) Cell 118:229-41

36 Microbial patterns are necessary and sufficient to protect against intestinal injury Antibiotic depletion of microbiota Addition of microbial molecules (LPS, LTA) Rakoff-Nahoum et al. (2004) Cell 118:229-41

37 The mouse intestinal epithelium expresses glycoconjugates in response to the microbiota Hooper et al. (1999) PNAS 96:

38

39 Erika Mittge Jennifer Bates Sarah Cheesman Katy Baden Julie Kuhlman

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb3000 Supplementary Figure 1 Lgr5 expression in the Lgr5-LacZ reporter knock-in mouse. P1: Lgr5-LacZ expression on the ovary surface (black arrow) and sub-surface (arrowheads), as well as

More information

Implementation of a Computer Immune System for Intrusion- and Virus Detection

Implementation of a Computer Immune System for Intrusion- and Virus Detection Implementation of a Computer Immune System for Intrusion- and Virus Detection Markus Christoph Unterleitner office@unterleitner.info February 13, 2006 2 Contents 1. Introduction... 11 1.1 Strategies of

More information

qpcr Hand Calculations - Multiple Reference Genes

qpcr Hand Calculations - Multiple Reference Genes qpcr Hand Calculations - Multiple Reference Genes This word document will take you through the hand calculations needed to determine the Normalized Gene Expression, using the Pfaffl method for efficiency

More information

Lecture 02 Microscopy, Staining, Classification (Ch3)

Lecture 02 Microscopy, Staining, Classification (Ch3) Lecture 02 Microscopy, Staining, Classification (Ch3) Topics Methods of Culturing Microorganisms Microscope (History, Types, Definitions) Staining (Gram s) Dichotomous keys Micro for Health Sciences 1

More information

Figure 6. Genotypes of (C) are: gmr-gal4 (gmr-gal4/+), gmr>erk (gmr-gal4 UAS-

Figure 6. Genotypes of (C) are: gmr-gal4 (gmr-gal4/+), gmr>erk (gmr-gal4 UAS- Supplementary Information 1. Genotypes Figure 3. Genotypes are: WT (w 1118, A, C), RSK D1 (RSK D1 /Y, B, D), RSK D1 ; da>rsk WT (RSK D1 /Y; UAS-RSK WT /+; da-gal4/+, E), e16e-gal4 (e16e-gal4/+, G), e16e>rsk

More information

Topic 02 Microscopy, Staining, Classification (Ch3)

Topic 02 Microscopy, Staining, Classification (Ch3) Topic 02 Microscopy, Staining, Classification (Ch3) Topics Dichotomous keys Methods of Culturing Microorganisms (9.6) Microscope (History, Types, Definitions) Staining (Gram s) (2.4) Micro for Health Sciences

More information

Survival curve, LD USUV Mice poorly seroconverted to Usutu competent mice

Survival curve, LD USUV Mice poorly seroconverted to Usutu competent mice LD, low dose HD, high dose Survival curve, LD USUV Mice poorly seroconverted to Usutu competent mice LD, low dose HD, high dose Survival curve, HD USUV Mice poorly seroconverted to Usutu competent mice

More information

Thermo Scientific Samco Transfer Pipettes. Precisely what you need

Thermo Scientific Samco Transfer Pipettes. Precisely what you need Thermo Scientific Samco Transfer Pipettes Precisely what you need Yesterday, today Thermo Scientific Samco transfer pipettes have been the industry leaders for over 35 years Design Grips easily with latex

More information

TL6 Ultra Micro-volume Spectrophotometer

TL6 Ultra Micro-volume Spectrophotometer TL6 Ultra Micro-volume Spectrophotometer TL6 is the latest Ultra Micro-volume Spectrophotometer of PERSEE ANALYTICS. It is a small portable instrument for fast analysis of nucleic acid and protein concentrations

More information

Past and Future of Flow Cytometry... and some Secrets. FACS Users Meeting Stockholm February 4, 2009

Past and Future of Flow Cytometry... and some Secrets. FACS Users Meeting Stockholm February 4, 2009 Past and Future of Flow Cytometry... and some Secrets FACS Users Meeting Stockholm February 4, 2009 The Short Story 1974: The first sorter by BD-FACS 1978: Start of Monoclonal Center 2008: + $ 1 billion

More information

Expression pattern of nub-gal4. The expression pattern of nub-gal4 was. assayed by combining it with the reporter UAS-His2ADsRed as in Figure 1.

Expression pattern of nub-gal4. The expression pattern of nub-gal4 was. assayed by combining it with the reporter UAS-His2ADsRed as in Figure 1. Supplementary Figure 1. Expression pattern of nub-gal4. The expression pattern of nub-gal4 was assayed by combining it with the reporter UAS-His2ADsRed as in Figure 1. His2ADsRed is localized to the nuclei

More information

STUDIES ON REAL-VALUED NEGATIVE SELECTION ALGORITHMS FOR SELF-NONSELF DISCRIMINATION

STUDIES ON REAL-VALUED NEGATIVE SELECTION ALGORITHMS FOR SELF-NONSELF DISCRIMINATION STUDIES ON REAL-VALUED NEGATIVE SELECTION ALGORITHMS FOR SELF-NONSELF DISCRIMINATION A Thesis Presented to the Faculty of California Polytechnic State University, San Luis Obispo In Partial Fulfillment

More information

Suspicious packages. Deputy Les Wiemers Weld County Sheriffs Office Aims Campus Resource Officer

Suspicious packages. Deputy Les Wiemers Weld County Sheriffs Office Aims Campus Resource Officer Suspicious packages Deputy Les Wiemers Weld County Sheriffs Office Aims Campus Resource Officer Class rules Please interrupt me!!! If I m going too fast, tell me to slow down. If I m going too slow, tell

More information

Supplementary Table S1. Sequences of primers used for cloning of neuropeptide-coding genes. Fw: Forward primer; Rv: Reverse primer.

Supplementary Table S1. Sequences of primers used for cloning of neuropeptide-coding genes. Fw: Forward primer; Rv: Reverse primer. Supplementary Table S1. Sequences of primers used for cloning of neuropeptide-coding genes. Fw: Forward primer; Rv: Reverse primer. Gene name DjNp3 DjNp4 DjNp9 DjNp12 DjNp17 DjNp19 DjNp23 DjNp25 DjNp28

More information

CSE182 Class project: An EST database of H. medicinalis

CSE182 Class project: An EST database of H. medicinalis CSE182 Class project: An EST database of H. medicinalis October 15, 2006 1 Introduction to Hirudo Hirudo medicinalis (medicinal leech is organism with historical medical as well contemporary relvance as

More information

Mixing Bio- and More Conventional Materials

Mixing Bio- and More Conventional Materials Mixing Bio- and More Conventional Materials UGIM Symposium 2016 Forum Session on Exotic Materials June 14, 2016 Mixing Bio and More Conventional Materials Bioelectronics Nano-biology Medical applications

More information

Thermo Scientific Samco Transfer Pipettes. Precisely what you need

Thermo Scientific Samco Transfer Pipettes. Precisely what you need Thermo Scientific Samco Transfer Pipettes Precisely what you need Application Guide LIFE SCIENCE APPLICATIONS INDUSTRIAL, RESEARCH AND TESTING CLINICAL APPLICATIONS Top 9 Pipettes: 6, 3, 5, 20, 23, 24,

More information

Further Developments on Router Nodes Positioning for Wireless Networks using Artificial Immune Systems

Further Developments on Router Nodes Positioning for Wireless Networks using Artificial Immune Systems Further Developments on Router Nodes Positioning for Wireless Networks using Artificial Immune Systems Pedro Henrique Gouvêa Coelho, J. L. M. do Amaral, J. F. M. do Amaral, L. F. de A. Barreira and A.

More information

Light Sheet Fluorescence Microscopy by Carl Zeiss. Chris Power 3D Imaging Specialist Dublin Workshop 25/11/2013

Light Sheet Fluorescence Microscopy by Carl Zeiss. Chris Power 3D Imaging Specialist Dublin Workshop 25/11/2013 Light Sheet Fluorescence Microscopy by Carl Zeiss Chris Power 3D Imaging Specialist Dublin Workshop 25/11/2013 Agenda 1. Requirements and challenges of live cell imaging 2. Light sheet fluorescence microscopy

More information

Yuan_FigS1. Control shrna. Vector. Eset shrna1. Eset shrna2. Eset overexpression. kda. anti-eset. anti-actin

Yuan_FigS1. Control shrna. Vector. Eset shrna1. Eset shrna2. Eset overexpression. kda. anti-eset. anti-actin Yuan_FigS1 kda Vector Control shrna Eset shrna1 Eset shrna2 Eset overexpression 26 16 anti-eset 11 anti-actin Yuan_FigS2 A Relative expression (%) 12 1 8 6 4 2 Nanog Pou5f1 Cdx2 Hand1 Eset B Control shrna

More information

NGS NEXT GENERATION SEQUENCING

NGS NEXT GENERATION SEQUENCING NGS NEXT GENERATION SEQUENCING Paestum (Sa) 15-16 -17 maggio 2014 Relatore Dr Cataldo Senatore Dr.ssa Emilia Vaccaro Sanger Sequencing Reactions For given template DNA, it s like PCR except: Uses only

More information

THE VERTICAL TURN. Leica TCS SP8 DLS Confocal and Digital LightSheet Microscope

THE VERTICAL TURN. Leica TCS SP8 DLS Confocal and Digital LightSheet Microscope THE VERTICAL TURN Leica TCS SP8 DLS Confocal and Digital LightSheet Microscope Color coded three-dimensional image of eye specific GFP expression (3P3 promoter) in Drosophila melanogaster. Specimen courtesy

More information

T H E J O U R N A L O F C E L L B I O L O G Y

T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Courtois et al., http://www.jcb.org/cgi/content/full/jcb.201202135/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Measurement of distribution and size of MTOCs in the

More information

CAP BIOINFORMATICS Su-Shing Chen CISE. 8/19/2005 Su-Shing Chen, CISE 1

CAP BIOINFORMATICS Su-Shing Chen CISE. 8/19/2005 Su-Shing Chen, CISE 1 CAP 5510-2 BIOINFORMATICS Su-Shing Chen CISE 8/19/2005 Su-Shing Chen, CISE 1 Building Local Genomic Databases Genomic research integrates sequence data with gene function knowledge. Gene ontology to represent

More information

1. INTRODUCTION. In 2002 the Computer Security Institute reported that 99% of corporations

1. INTRODUCTION. In 2002 the Computer Security Institute reported that 99% of corporations 1 1. INTRODUCTION In 2002 the Computer Security Institute reported that 99% of corporations and government agencies experienced some kind of security violation [1]. As computer use expands in the coming

More information

Imaging the Materials of Life: MicroCT in Biological Research

Imaging the Materials of Life: MicroCT in Biological Research Imaging the Materials of Life: MicroCT in Biological Research Dr. Brian Metscher Department of Theoretical Biology University of Vienna The real voyage of discovery consists not in seeking new landscapes,

More information

Product Catalog. Disposable Endoscopic Medical Devices

Product Catalog. Disposable Endoscopic Medical Devices Product Catalog Disposable Endoscopic Medical Devices Thank you for choosing Endo Therapeutics. History Endo-Therapeutics, Inc. an endoscopic medical device manufacturer was established in 1992 in Safety

More information

Gegenees genome format...7. Gegenees comparisons...8 Creating a fragmented all-all comparison...9 The alignment The analysis...

Gegenees genome format...7. Gegenees comparisons...8 Creating a fragmented all-all comparison...9 The alignment The analysis... User Manual: Gegenees V 1.1.0 What is Gegenees?...1 Version system:...2 What's new...2 Installation:...2 Perspectives...4 The workspace...4 The local database...6 Populate the local database...7 Gegenees

More information

All mirnas (clustered and individual) were inserted into a multiple cloning site in the 3'-UTR of a fluorescent marker.

All mirnas (clustered and individual) were inserted into a multiple cloning site in the 3'-UTR of a fluorescent marker. Supplementary Figure 1. Vector schematic for UAS-miRNA generation. All mirnas (clustered and individual) were inserted into a multiple cloning site in the 3'-UTR of a fluorescent marker. Supplementary

More information

Lab 2 Functions and Antibiotics

Lab 2 Functions and Antibiotics Lab 2 Functions and Antibiotics Date: August 30, 2011 Assignment and Report Due Date: September 6, 2011 Goal: In this lab you will learn about a model for antibiotic efficiency and see how it relates to

More information

Methods. KS ELISPOT KS ELISPOT compact. Routine Systems for Enzyme Linked Immuno SPOT Assay Evaluations. Microscopy from Carl Zeiss

Methods. KS ELISPOT KS ELISPOT compact. Routine Systems for Enzyme Linked Immuno SPOT Assay Evaluations. Microscopy from Carl Zeiss Microscopy from Carl Zeiss KS ELISPOT KS ELISPOT compact Methods Fast evaluation of standard and fluorescence Elispot specimen Efficient and reproducible method for Enzyme Linked Immuno SPOT assay evaluations

More information

Multi-channel Deep Transfer Learning for Nuclei Segmentation in Glioblastoma Cell Tissue Images

Multi-channel Deep Transfer Learning for Nuclei Segmentation in Glioblastoma Cell Tissue Images Multi-channel Deep Transfer Learning for Nuclei Segmentation in Glioblastoma Cell Tissue Images Thomas Wollmann 1, Julia Ivanova 1, Manuel Gunkel 2, Inn Chung 3, Holger Erfle 2, Karsten Rippe 3, Karl Rohr

More information

Neuroscience Solutions. by leica microsystems

Neuroscience Solutions. by leica microsystems Neuroscience Solutions by leica microsystems neuroscience solutions from leica microsystems Working with Acute Slice Preparations The nervous system works as a tightly regulated, highly complex cellular

More information

COLOCALISATION. Alexia Loynton-Ferrand. Imaging Core Facility Biozentrum Basel

COLOCALISATION. Alexia Loynton-Ferrand. Imaging Core Facility Biozentrum Basel COLOCALISATION Alexia Loynton-Ferrand Imaging Core Facility Biozentrum Basel OUTLINE Introduction How to best prepare your samples for colocalisation How to acquire the images for colocalisation How to

More information

MBS-HACCP&WATER EASY TEST MBS MULTI-READER

MBS-HACCP&WATER EASY TEST MBS MULTI-READER MBS-HACCP&WATER EASY TEST ADVANCED SYSTEM MBS MULTI-READER USER MANUAL TABLE OF CONTENTS 1.1 Introduction 3 1.2 In the box 5 1.3 Connecting the MBS-MR device to computer 5 1.4 MBS-MR software installation

More information

RealTime ready Custom RT-qPCR Assays and Panels Simple Online Configuration

RealTime ready Custom RT-qPCR Assays and Panels Simple Online Configuration RealTime ready Custom RT-qPCR Assays and Panels Simple Online Configuration Browse the Configurator at www.configurator.realtimeready.roche.com. For life science research only. Not for use in diagnostic

More information

1) Describe advanced blood circulatory system in Annelida. Parasitic adaptations in Platyhelminthes.

1) Describe advanced blood circulatory system in Annelida. Parasitic adaptations in Platyhelminthes. (DZOO 01 (NR)) ASSIGNMENT - 1, MAY - 2016. PAPER-I : SYSTEMATICS AND ANATODECEMBER OF INVERTEBRATES 1) Describe advanced blood circulatory system in Annelida. 2) Write short notes on: i) Development in

More information

Fluorescence Tomography Source Reconstruction and Analysis

Fluorescence Tomography Source Reconstruction and Analysis TECHNICAL NOTE Pre-clinical in vivo imaging Fluorescence Tomography Source Reconstruction and Analysis Note: This Technical Note is part of a series for Fluorescence Imaging Tomography (FLIT). The user

More information

Lab Exercise 5: The Smear and Simple Staining

Lab Exercise 5: The Smear and Simple Staining Background Smears The preparation of a good smear is the backbone of all of the staining techniques performed throughout this course. A good smear is the result of the mastery of three individual concepts:

More information

MEPD: Medaka Expression Pattern Database. User manual. 11th September Juan L. Mateo

MEPD: Medaka Expression Pattern Database. User manual. 11th September Juan L. Mateo MEPD: Medaka Expression Pattern Database User manual 11th September 2015 Juan L. Mateo Centre for Organismal Studies, University of Heidelberg, juan.mateo@cos.uni-heidelberg.de Contents 1 Introduction

More information

MEGAN5 tutorial, September 2014, Daniel Huson

MEGAN5 tutorial, September 2014, Daniel Huson MEGAN5 tutorial, September 2014, Daniel Huson This tutorial covers the use of the latest version of MEGAN5. Here is an outline of the steps that we will cover. Note that the computationally most timeconsuming

More information

Introduction to GE Microarray data analysis Practical Course MolBio 2012

Introduction to GE Microarray data analysis Practical Course MolBio 2012 Introduction to GE Microarray data analysis Practical Course MolBio 2012 Claudia Pommerenke Nov-2012 Transkriptomanalyselabor TAL Microarray and Deep Sequencing Core Facility Göttingen University Medical

More information

Welcome to the Quantitative Trait Loci (QTL) Tutorial

Welcome to the Quantitative Trait Loci (QTL) Tutorial Welcome to the Quantitative Trait Loci (QTL) Tutorial This tutorial will describe how to navigate the section of Gramene that provides information on Quantitative Trait Loci (QTL). QTL are a statistical

More information

now the only difficult thing about spectrophotometry is how to say it

now the only difficult thing about spectrophotometry is how to say it Life Sc ienc es now the only difficult thing about spectrophotometry is how to say it Biochrom US 84 October Hill Rd Holliston, MA 01746-1388 USA Telephone: 1-508-893-8999 Toll Free: 1-800-272-2775 Fax:

More information

HRP Magenta chromogen for Dako Omnis. Simply revolutionary 'red'

HRP Magenta chromogen for Dako Omnis. Simply revolutionary 'red' HRP Magenta chromogen for Dako Omnis Simply revolutionary 'red' A new color for the EnVision FLEX family on Dako Omnis Introducing HRP Magenta, a new chromogen available for your Dako Omnis solution that

More information

HEMOSTASIS Solutions for Effective Hemostatic Therapy.

HEMOSTASIS Solutions for Effective Hemostatic Therapy. HEMOSTASIS Solutions for Effective Hemostatic Therapy. 9544 1 OVERVIEW Endoscopic Hemostasis of Gastrointestinal Bleeding Can Be Accomplished by Various Means, Including Adrenaline Injection, Thermal Coagulation,

More information

Leica DFC3000 G. Crisp fluorescence documentation for routine experiments

Leica DFC3000 G. Crisp fluorescence documentation for routine experiments Leica DFC3000 G Crisp fluorescence documentation for routine experiments Leica DFC3000 G fluorescence documentation camera Leica DFC3000 G Crisp Fluorescence Documentation for Routine Experiments The Leica

More information

Leica LMD6500 Laser Microdissection Easy to Use, Fast, Precise, Versatile, Effective

Leica LMD6500 Laser Microdissection Easy to Use, Fast, Precise, Versatile, Effective Bob Fasulka Leica LMD6500 Laser Microdissection Easy to Use, Fast, Precise, Versatile, Effective Latest LM The Leica LMD6500 represents one of the latest laser microdissection technologies Molecular and

More information

Optical Sectioning. Bo Huang. Pharmaceutical Chemistry

Optical Sectioning. Bo Huang. Pharmaceutical Chemistry Optical Sectioning Bo Huang Pharmaceutical Chemistry Approaches to 3D imaging Physical cutting Technical difficulty Highest resolution Highest sensitivity Optical sectioning Simple sample prep. No physical

More information

1 Compound microscopes. Compound, Phase contrast, Digital, Fluorescence and Inverted microscopes

1 Compound microscopes. Compound, Phase contrast, Digital, Fluorescence and Inverted microscopes 8 1 Compound microscopes Compound, Phase contrast, Digital, Fluorescence and Inverted microscopes Compound microscope KERN OBS-1 Objectives OBS OBS 1 OBS 104 OBS 106 EDUCATIONAL LINE The school microscope

More information

Projection with Public Data (PPD)

Projection with Public Data (PPD) Projection with Public Data (PPD) Goal To compare users 16S rrna data with published datasets by processing and normalization them together, and projecting into 3D PCoA plot for visual comparative analysis

More information

My family List of Papers This thesis is based on the following papers, which are referred to in the text by their Roman numerals. I A. Allalou, F. M. van de Rijke, R. J. Tafrechi, A. K. Raap, and C. Wählby.

More information

PerkinElmer Microplates for Life Science Research

PerkinElmer Microplates for Life Science Research Drug Discovery Research Clinical Screening Microplates PerkinElmer Microplates for Life Science Research a complete overview Dear Life Science Researcher, This booklet provides an overview of all PerkinElmer

More information

Tutorial. OTU Clustering Step by Step. Sample to Insight. March 2, 2017

Tutorial. OTU Clustering Step by Step. Sample to Insight. March 2, 2017 OTU Clustering Step by Step March 2, 2017 Sample to Insight QIAGEN Aarhus Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 www.qiagenbioinformatics.com AdvancedGenomicsSupport@qiagen.com

More information

James Boedicker, Hernan Garcia, Manuel Razo Mejia, Griffin Chure, Elizabeth Eck, Meghan Turner

James Boedicker, Hernan Garcia, Manuel Razo Mejia, Griffin Chure, Elizabeth Eck, Meghan Turner Matlab Tutorial: Measuring cell growth rate James Boedicker, Hernan Garcia, Manuel Razo Mejia, Griffin Chure, Elizabeth Eck, Meghan Turner Introduction Reproduction is an essential process of life. In

More information

miscript mirna PCR Array Data Analysis v1.1 revision date November 2014

miscript mirna PCR Array Data Analysis v1.1 revision date November 2014 miscript mirna PCR Array Data Analysis v1.1 revision date November 2014 Overview The miscript mirna PCR Array Data Analysis Quick Reference Card contains instructions for analyzing the data returned from

More information

BHSAI Biotechnology HPC Software Applications Institute

BHSAI Biotechnology HPC Software Applications Institute BHSAI Biotechnology HPC Software Applications Institute QuartetS-DB An Orthology Database for Species User s Guide May 0 The QuartetS database (QuartetS-DB) contains orthology predictions for species (

More information

Huntington s Disease and Vertex Pharmaceuticals

Huntington s Disease and Vertex Pharmaceuticals Huntington s Disease and Vertex Pharmaceuticals Jeff Stack, Ph.D. Vertex, San Diego HDSA Annual Convention June 7, 2008 www.vrtx.com Outline Background on Vertex Pharmaceuticals Vertex drug discovery collaboration

More information

Tutorial. OTU Clustering Step by Step. Sample to Insight. June 28, 2018

Tutorial. OTU Clustering Step by Step. Sample to Insight. June 28, 2018 OTU Clustering Step by Step June 28, 2018 Sample to Insight QIAGEN Aarhus Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 www.qiagenbioinformatics.com ts-bioinformatics@qiagen.com

More information

User Guide for dbpec

User Guide for dbpec User Guide for dbpec Query Options Query dbpec for a specific gene Users can enter a single gene name (HGNC) in the search field entitled Search Genes and submit. If more than one gene matches query, user

More information

BioImaging facility update: from multi-photon in vivo imaging to highcontent high-throughput image-based screening. Alex Laude The BioImaging Unit

BioImaging facility update: from multi-photon in vivo imaging to highcontent high-throughput image-based screening. Alex Laude The BioImaging Unit BioImaging facility update: from multi-photon in vivo imaging to highcontent high-throughput image-based screening Alex Laude The BioImaging Unit Multi-dimensional, multi-modal imaging at the sub-cellular

More information

COMPARATIVE MICROBIAL GENOMICS ANALYSIS WORKSHOP. Exercise 3: Pan- and Core- genome analysis, Pan-genome tree

COMPARATIVE MICROBIAL GENOMICS ANALYSIS WORKSHOP. Exercise 3: Pan- and Core- genome analysis, Pan-genome tree COMPARATIVE MICROBIAL GENOMICS ANALYSIS WORKSHOP Exercise 3: Pan- and Core- genome analysis, Pan-genome tree 1. Pan- and Core- genome plot construction Pan- and core-genome plots are graphs that display

More information

CT slices were reconstructed using COBRA (Exxim Computing Corporation) on

CT slices were reconstructed using COBRA (Exxim Computing Corporation) on PET Imaging Post-Processing CT slices were reconstructed using COBRA (Exxim Computing Corporation) on volumes of 480 x 480 x 683 isotropic voxels, 191.92 µm 3. Each 20 minute PET scan was reconstructed

More information

Epigenetic regulation of the nuclear-coded GCAT and SHMT2 genes confers

Epigenetic regulation of the nuclear-coded GCAT and SHMT2 genes confers Supplementary Information for Epigenetic regulation of the nuclear-coded GCAT and SHMT2 genes confers human age-associated mitochondrial respiration defects Osamu Hashizume, Sakiko Ohnishi, Takayuki Mito,

More information

III: Single particle cryoem - practical approaches

III: Single particle cryoem - practical approaches III: Single particle cryoem - practical approaches Single particle EM analysis can be performed at both 2D and 3D. Single particle EM (both negative stain and cryo) is to extract structural information

More information

Applying Data-Driven Normalization Strategies for qpcr Data Using Bioconductor

Applying Data-Driven Normalization Strategies for qpcr Data Using Bioconductor Applying Data-Driven Normalization Strategies for qpcr Data Using Bioconductor Jessica Mar April 30, 2018 1 Introduction High-throughput real-time quantitative reverse transcriptase polymerase chain reaction

More information

LIMS User Guide 1. Content

LIMS User Guide 1. Content LIMS User Guide 1. Content 1. Content... 1 1. Introduction... 2 2. Get a user account... 2 3. Invoice Address... 2 Create a new invoice address... 2 4. Create Project Request... 4 Request tab... 5 Invoice

More information

The Allen Human Brain Atlas offers three types of searches to allow a user to: (1) obtain gene expression data for specific genes (or probes) of

The Allen Human Brain Atlas offers three types of searches to allow a user to: (1) obtain gene expression data for specific genes (or probes) of Microarray Data MICROARRAY DATA Gene Search Boolean Syntax Differential Search Mouse Differential Search Search Results Gene Classification Correlative Search Download Search Results Data Visualization

More information

The UCSC Genome Browser

The UCSC Genome Browser The UCSC Genome Browser Search, retrieve and display the data that you want Materials prepared by Warren C. Lathe, Ph.D. Mary Mangan, Ph.D. www.openhelix.com Updated: Q3 2006 Version_0906 Copyright OpenHelix.

More information

- Free fluorophores - Donors without partner acceptors - Acceptors without partner donors

- Free fluorophores - Donors without partner acceptors - Acceptors without partner donors Determining Distances / Distance Changes Caveats Angular dependence (κ 2 ) Environment dependence (J, ϕd) Distance is a (complicated) average Probe is large, linkages can be long Construct complications

More information

UNIVERSITY OF HAWA1'1 UBRA~Y

UNIVERSITY OF HAWA1'1 UBRA~Y UNIVERSITY OF HAWA1'1 UBRA~Y NETWORK THREAT DETECTION UTILIZING ADAPTIVE AND INNATE IMMUNE SYSTEM METAPHORS A DISSERTATION SUBMITTED TO THE GRADUATE DIVISION OF THE UNIVERSITY OF HAW AI 1 IN PARTIAL FULFILLMENT

More information

Morphogenesis. Simulation Results

Morphogenesis. Simulation Results Morphogenesis Simulation Results This document contains the results of the simulations designed to investigate the regeneration strength of the computational model of the planarium. Specific portions of

More information

Using Bio-ontologies as Data Annotation, Integration & Analytical Tools at Mouse Genome Informatics

Using Bio-ontologies as Data Annotation, Integration & Analytical Tools at Mouse Genome Informatics CASIMIR Workshop Database Interoperability & Ontologies Using Bio-ontologies as Data Annotation, Integration & Analytical Tools at Mouse Genome Informatics www.informatics.jax.org Anna V. Anagnostopoulos,

More information

Lecture 10: Image-Based Modelling

Lecture 10: Image-Based Modelling Computational Biology Group (CoBI), D-BSSE, ETHZ Lecture 10: Image-Based Modelling Prof Dagmar Iber, PhD DPhil MSc Computational Biology 2015 Contents 1 Image-based Domains for Simulations Staining & Imaging

More information

Sona. NEW The Back-illuminated scmos Microscopy Camera You ve Been Waiting For... P P P. scmos. andor.com. Key Specifications. Key Microscopy Benefits

Sona. NEW The Back-illuminated scmos Microscopy Camera You ve Been Waiting For... P P P. scmos. andor.com. Key Specifications. Key Microscopy Benefits Sona scmos NEW The Back-illuminated scmos Microscopy Camera You ve Been Waiting For... Key Specifications -45 0 C Vacuum Cooled 95% QE 70 fps 4.2 Megapixel (Sona 4.2B-11) largest on-sample field of view

More information

Fluorimetric Enzyme Assay Protocol for Marine Samples

Fluorimetric Enzyme Assay Protocol for Marine Samples Fluorimetric Enzyme Assay Protocol for Marine Samples (Modified from S. Schmidt Lab/M. Weintraub U. of Colorado Boulder, August 2005; Suding Lab, January 2008; and Saiya-Cork, K. R., R. L. Sinsabaugh,

More information

GIS and Forest Engineering Applications

GIS and Forest Engineering Applications FE 257. GIS and Forest Engineering Applications Week 3 This week s topics Clip and erase processes Chapter 6 Selecting landscape features in a GIS Chapter 5 GIS Lab3: Determining land use and ownership

More information

Radnoti. Radnoti. Radnoti. Precise digitally controlled temperature. Illuminated chamber improves sample viewing

Radnoti. Radnoti. Radnoti. Precise digitally controlled temperature. Illuminated chamber improves sample viewing Radnoti Myography Systems Precise digitally controlled temperature Illuminated chamber improves sample viewing Featuring an ergonomically designed sliding wrist rest Modular designed allowing for easy

More information

Analysis of immune cell function using in vivo cell shape analysis and tracking

Analysis of immune cell function using in vivo cell shape analysis and tracking Analysis of immune cell function using in vivo cell shape analysis and tracking Constantino Carlos Reyes-Aldasoro 1, Yifan Zhao 2, Daniel Coca 2, Stephen A. Billings 2, Visakan Kadirkamanathan 2, Gillian

More information

A Generic Lie Group Model for Computer Vision

A Generic Lie Group Model for Computer Vision A Generic Lie Group Model for Computer Vision Within this research track we follow a generic Lie group approach to computer vision based on recent physiological research on how the primary visual cortex

More information

B.Sc. BIOTECHNOLOGY. Course structure of three- year B.Sc. Degree Course in Biotechnology Under Choice Based Credit System

B.Sc. BIOTECHNOLOGY. Course structure of three- year B.Sc. Degree Course in Biotechnology Under Choice Based Credit System B.Sc. BIOTECHNOLOGY Course structure of three- year B.Sc. Degree Course in Under Choice Based Credit System SEMESTER I BBT 101 Core Course-Theory Animal Science BBT 102 Plant Science BBT 103 Foundations

More information

Mic qpcr. Fast. Accurate. Compact. Ultimate Performance for Real-Time PCR. Speed Accuracy Size Connectivity

Mic qpcr. Fast. Accurate. Compact. Ultimate Performance for Real-Time PCR. Speed Accuracy Size Connectivity Mic qpcr Ultimate Performance for Real-Time PCR Fast. Accurate. Compact. Speed Accuracy Size Connectivity Hardware Style meets substance - ultimate performance, beautiful design. Fast results without compromise

More information

Hund Microscopy. 1. Contrasting methods (summary) 2. Microscopes & applications 3. Cameras 4. Selling arguments

Hund Microscopy. 1. Contrasting methods (summary) 2. Microscopes & applications 3. Cameras 4. Selling arguments 1. Contrasting methods (summary) 2. Microscopes & applications 3. Cameras 4. Selling arguments Contrasting methods transmitted light Transmitted light is the classical method for transparent samples in

More information

II: Single particle cryoem - an averaging technique

II: Single particle cryoem - an averaging technique II: Single particle cryoem - an averaging technique Radiation damage limits the total electron dose that can be used to image biological sample. Thus, images of frozen hydrated macromolecules are very

More information

Approximate Graph Patterns for Biological Network

Approximate Graph Patterns for Biological Network Approximate Graph Patterns for Biological Network 1) Conserved patterns of protein interaction in multiple species - Proceedings of the National Academy of Science (PNAS) - 2003 2) Conserved pathways within

More information

Optics of Vision. MATERIAL TO READ Web: 1.

Optics of Vision. MATERIAL TO READ Web: 1. Optics of Vision MATERIAL TO READ Web: 1. www.physics.uoguelph.ca/phys1070/webst.html Text: Chap. 3, pp. 1-39 (NB: pg. 3-37 missing) Chap. 5 pp.1-17 Handbook: 1. study guide 3 2. lab 3 Optics of the eye

More information

Technology Development Studio (TDS) MPI-CBG, Dresden, Germany. Marc Bickle HT-TDS, MPI-CBG

Technology Development Studio (TDS) MPI-CBG, Dresden, Germany. Marc Bickle HT-TDS, MPI-CBG Technology Development Studio (TDS) MPI-CBG, Dresden, Germany Marc Bickle HT-TDS, MPI-CBG TDS: Core Screening Facility Core Screening facility of the MPI-CBG specialized in high content imaging (es 2003)

More information

Facilitating Semantic Alignment of EBI Resources

Facilitating Semantic Alignment of EBI Resources Facilitating Semantic Alignment of EBI Resources 17 th March, 2017 Tony Burdett Technical Co-ordinator Samples, Phenotypes and Ontologies Team www.ebi.ac.uk What is EMBL-EBI? Europe s home for biological

More information

4 AA nickel-etal bybrid cells (min. 2,200 mah) Use only AC Adapter (5 VDC / min. 1 A) supplied for recharging

4 AA nickel-etal bybrid cells (min. 2,200 mah) Use only AC Adapter (5 VDC / min. 1 A) supplied for recharging METERS Microx 4 The Microx 4 is a completely stand-alone, portable fiber optic oxygen meter. It can be used with non-invasive sensors & probes (1 mm fiber), and oxygen microsensors (200 µm fiber) in different

More information

BIOLOGICAL APPROACH TO SYSTEM INFORMATION SECURITY (BASIS)

BIOLOGICAL APPROACH TO SYSTEM INFORMATION SECURITY (BASIS) AFRL-IF-RS-TR-2003-286 Final Technical Report December 2003 BIOLOGICAL APPROACH TO SYSTEM INFORMATION SECURITY (BASIS) Binghamton University APPROVED FOR PUBLIC RELEASE; DISTRIBUTION UNLIMITED. AIR FORCE

More information

Chris Main. Extension Cotton Specialist The University of Tennessee

Chris Main. Extension Cotton Specialist The University of Tennessee Chris Main Extension Cotton Specialist The University of Tennessee Ignite Tolerance Liberty Link varieties Two gene resistance to glufosinate from bar and pat genes which were first isolated from two species

More information

Distributed Password Manager- Using Secure String Management technique

Distributed Password Manager- Using Secure String Management technique Distributed Password Manager- Using Secure String Management technique Syed Ali Mehdi Assistant Professor, Department of Computer Science, Jamia Hamdard, Delhi, India ABSTRACT: We t to use more complicated

More information

DENSITY-BASED CLUSTERING OF HIGH-DIMENSIONAL DNA FINGERPRINTS FOR LIBRARY-DEPENDENT MICROBIAL SOURCE TRACKING. A Thesis.

DENSITY-BASED CLUSTERING OF HIGH-DIMENSIONAL DNA FINGERPRINTS FOR LIBRARY-DEPENDENT MICROBIAL SOURCE TRACKING. A Thesis. DENSITY-BASED CLUSTERING OF HIGH-DIMENSIONAL DNA FINGERPRINTS FOR LIBRARY-DEPENDENT MICROBIAL SOURCE TRACKING A Thesis presented to the Faculty of California Polytechnic State University, San Luis Obispo

More information

Definiens. Tissue Studio 4.2. Tutorial 3: Metadata Import, Manual ROI Selection and Vessel Detection

Definiens. Tissue Studio 4.2. Tutorial 3: Metadata Import, Manual ROI Selection and Vessel Detection Definiens Tissue Studio 4.2 Tutorial 3: Metadata Import, Manual ROI Selection and Vessel Detection Tutorial 3: Metadata Import, Manual ROI Selection and Vessel Detection Imprint and Version Copyright 2015

More information

CATTTTTAGCTCCTTACTTATTTGTATAGTTCATCC GGATGAACTATACAAATAAGTAAGGAGCTAAAAATG GCATATACTGCAGAAACGCTGCTACTATACG

CATTTTTAGCTCCTTACTTATTTGTATAGTTCATCC GGATGAACTATACAAATAAGTAAGGAGCTAAAAATG GCATATACTGCAGAAACGCTGCTACTATACG Supplementary Table 1: Bacterial strains and plasmids E.coli strains Relevant genotype Ref. BW25113 Wild type (pir-) Baba et al (2006) BW25141 Wild type (pir+) Datsenko and Wanner (2000) Keio:cydb BW25113

More information

Documentation to image analysis

Documentation to image analysis Documentation to image analysis The documentation below provides a detailed explanation and pointers towards the use of the MS-ECS-2D update site. It is made available in conjunction with the publication

More information

ANS/NTR/PO 415 Comparative Nutrition Syllabus

ANS/NTR/PO 415 Comparative Nutrition Syllabus ANS/NTR/PO 415 Comparative Nutrition Syllabus Jim Croom, Ph.D., FACN, Instructor John Brake, Ph.D., PAS, WNR Distinguished Professor (Consulting Instructor) Course title Course Information Comparative

More information

From Eye to Insight. Leica DMC2900. Digital microscope camera for easy, efficient documentation and presentation in industry and research

From Eye to Insight. Leica DMC2900. Digital microscope camera for easy, efficient documentation and presentation in industry and research From Eye to Insight Leica DMC2900 Digital microscope camera for easy, efficient documentation and presentation in industry and research 3 High Speed Imaging Leica DMC2900 with USB 3.0 interface for highest

More information

SEEK User Manual. Introduction

SEEK User Manual. Introduction SEEK User Manual Introduction SEEK is a computational gene co-expression search engine. It utilizes a vast human gene expression compendium to deliver fast, integrative, cross-platform co-expression analyses.

More information

Characteristic Quantities of Microvascular Structures in CLSM Volume Datasets K. Winter¹, L. H.-W. Metz, J.-P. Kuska², B. Frerich³

Characteristic Quantities of Microvascular Structures in CLSM Volume Datasets K. Winter¹, L. H.-W. Metz, J.-P. Kuska², B. Frerich³ Characteristic Quantities of Microvascular Structures in CLSM Volume Datasets K. Winter¹, L. H.-W. Metz, J.-P. Kuska², B. Frerich³ ¹Translational Centre for Regenerative Medicine (TRM-Leipzig), University

More information