The Role of the Indigenous Microbiota in Zebrafish Gastrointestinal Tract Development. Karen Guillemin University of Oregon
|
|
- Oswald McCarthy
- 5 years ago
- Views:
Transcription
1 The Role of the Indigenous Microbiota in Zebrafish Gastrointestinal Tract Development Karen Guillemin University of Oregon
2 human cells GI tract bacteria cells 25,000 genes ~500 species 1,000,000 genes
3 How is the microbiota established during development? What role does the microbiota play in host development? How does the host perceive and respond to the presence of the microbiota?
4 Advantages of a germ-free zebrafish model Ex-utero development facilitates sterilization of embryos Transparency of larvae allows visualization of internal organs and bacterial interactions Zebrafish GI tract development and physiology is similar to that of mammals Zebrafish have an adaptive and innate immune system similar to mammals Zebrafish are amenable to genetic analysis
5 Anatomy of a zebrafish larva esophageal-intestinal junction intestinal bulb distal intestine vent 8 dpf DAPI
6 Important events in zebrafish development macrophages functional lymphocytes in thymus first V(D)J recombination thymus mature onset of humoral immunity 21 28
7 Bacteria on the zebrafish chorion 10 µm
8 Bacterial distribution during development DAPI Eubacteria 35 hpf 4 dpf 5 dpf 8 dpf
9 Bacteria in the adult gut lumen are sampled by host cells Aeromonas veronii 16S probe Flavobacterium johnsoniae 16S probe
10 Bacterial load during development based on qpcr of 16S rdna E E E+08 Copies 16S rdna/fish E E E E E E E E Adult 12 GI Age (days post fertilization)
11 8 dpf 4 dpf The microbiota changes during development Eubacteria Aeromonas Eubacteria Pseudomonas
12 Important events in zebrafish development macrophages functional lymphocytes in thymus first V(D)J recombination establishment of microbiota ` thymus mature onset of humoral immunity 21 28
13 Raising germfree zebrafish larvae bleach treat newly laid embryos larvae grown in sterile media CV d0 CV d8 CV d8 GF d8 - control - control + control Assay for sterility by: plating PCR with pan bacterial 16S primers microscopy negative control positive bleached untreated control
14 SEM of the surface of untreated and bleached embryos 10 µm Conventionally reared 10 µm Bleach treated
15 Quantification of bacterial 16S rdna S rdna copy number water GF CV
16 Reconstitution of the microbiota in germ-free zebrafish larvae bleach treat newly laid embryos grow in sterile media Day 5 Day 8 transfer to media from conventionally reared fish ex-germ-free larvae
17 Quantification of bacterial 16S rdna S rdna copy number water GF CV XGF
18 Germ-free and ex-germ-free zebrafish CV GF XGF Eubacteria autofluorescence
19 The germ-free intestine fails to up-regulate alkaline phosphatase activity CV 2 dpf CV 3 dpf CV 5 dpf CV 8 dpf GF 8 dpf XGF 8 dpf Alkaline phosphatase activity
20 Quantification of intestinal alkaline phosphatase activity 1.6 ng Pi/min/mg tissue CV 5dpf CV 8dpf GF 8dpf XGF 8dpf
21 The germ-free intestine fails to down-regulation Galα1,3Gal expression CV 5 dpf CV 8 dpf GF 5 dpf GF 8 dpf XGF 8 dpf distal proximal Isolectin B-4 autofluorescence
22 Quantification of Galα1,3Gal expression at the esophogeal-intestinal junction 700 IB4 staining (arbitrary units) CV 5dpf CV 8dpf GF 8dpf XGF 8dpf
23 The germ-free intestine contains fewer goblet cells CV 5 dpf CV 8 dpf GF 5 dpf XGF 8 dpf
24 Quantification of goblet cells 250 goblet cells/intestine CV 5 dpf CV 8 dpf GF 8 dpf XGF 8 dpf
25 The germ-free intestine fails to absorb protein CV GF XGF HRP protein after 24 hour feeding
26 Regular peristalsis is established by 6 dpf 4.5 dpf 5.5 dpf 4.5 dpf 5.5 dpf 6 dpf Julie Kuhlman Judith Eisen
27 Peristalsis is faster in germ-free larvae GF CV XGF Average time between contractions
28 Monoassociation of germfree zebrafish larvae bleach treat newly laid embryos grow in sterile media Day 5 Day 8 Introduce bacterial culture into flask with a sterile needle Monoassociated larvae
29 Monoassociations with Aeromonas sobria and Pseudomonas putida AMA Eubacteria PMA Aeromonas Merge Eubacteria Psedomonas Merge
30 Monoassociation with Aeromonas and Pseudomonas spp. reverses GF phenotypes 1.6 Alkaline phosphatase activity 700 Galα1,3Gal expresison ng Pi/min/mg tissue IB4 staining (arbitrary units) CV 8dpf GF 8dpfXGF XGF 0 8dpfAMA AMA 8dpfPMA PMA 8dp CV CV 8dpfGF GF 8dpfXGF XGF 8dpf AMA AMA 8dpf PMA PMA 8d
31 Heat-killed bacteria are not sufficient to reverse all GF phenotypes 1.6 Alkaline phosphatase activity 700 Galα1,3Gal expresison ng Pi/min/mg tissue IB4 staining (arbitrary units) CV GF XGF AMA PMA HK CV 8dpfGF 8dpfXGF 8dpf AMA 8dpf PMA 8dpf HK 8dpf 0 CV CV 8dpf GF GF 8dpf XGF XGF 8dpf AMA AMA 8dpf PMA PMA 8dpf HK HK 8dp
32 LPS is sufficient to induce intestinal alkaline phosphatase activity 1.6 Alkaline phosphatase activity 700 Galα1,3Gal expresison ng Pi/min/mg tissue IB4 staining (arbitrary units) CV CV8dpf GF GF 8dpf XGF XGF 8dpf AMAPMA AMA 8dpf PMA 8dpf HK HK 8dpfLPS LPS CV CV 8dpf GF GF 8dpf XGF XGF 8dpf AMA AMA 8dpf PMA PMA 8dpf HK HK 8dp
33 The GI microbiota is established after hatching The microbiota is required for the maturation of patterns of expression of glycans and intestinal alkaline phosphatase activity The microbiota is required for normal goblet cell numbers The microbiota is required for protein absorption in the distal intestine and rates of peristalsis Heat-killed bacteria reverse the GF alkaline phosphatase phenotype but not the expression of Gala1,3Gal glycans.
34 Toll like receptors recognize generic microbial patterns Akira (2003) JBC 278:
35 TLR signaling is required to protect against intestinal injury Susceptibility to dextran sulfate sodium Rakoff-Nahoum et al. (2004) Cell 118:229-41
36 Microbial patterns are necessary and sufficient to protect against intestinal injury Antibiotic depletion of microbiota Addition of microbial molecules (LPS, LTA) Rakoff-Nahoum et al. (2004) Cell 118:229-41
37 The mouse intestinal epithelium expresses glycoconjugates in response to the microbiota Hooper et al. (1999) PNAS 96:
38
39 Erika Mittge Jennifer Bates Sarah Cheesman Katy Baden Julie Kuhlman
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3000 Supplementary Figure 1 Lgr5 expression in the Lgr5-LacZ reporter knock-in mouse. P1: Lgr5-LacZ expression on the ovary surface (black arrow) and sub-surface (arrowheads), as well as
More informationImplementation of a Computer Immune System for Intrusion- and Virus Detection
Implementation of a Computer Immune System for Intrusion- and Virus Detection Markus Christoph Unterleitner office@unterleitner.info February 13, 2006 2 Contents 1. Introduction... 11 1.1 Strategies of
More informationqpcr Hand Calculations - Multiple Reference Genes
qpcr Hand Calculations - Multiple Reference Genes This word document will take you through the hand calculations needed to determine the Normalized Gene Expression, using the Pfaffl method for efficiency
More informationLecture 02 Microscopy, Staining, Classification (Ch3)
Lecture 02 Microscopy, Staining, Classification (Ch3) Topics Methods of Culturing Microorganisms Microscope (History, Types, Definitions) Staining (Gram s) Dichotomous keys Micro for Health Sciences 1
More informationFigure 6. Genotypes of (C) are: gmr-gal4 (gmr-gal4/+), gmr>erk (gmr-gal4 UAS-
Supplementary Information 1. Genotypes Figure 3. Genotypes are: WT (w 1118, A, C), RSK D1 (RSK D1 /Y, B, D), RSK D1 ; da>rsk WT (RSK D1 /Y; UAS-RSK WT /+; da-gal4/+, E), e16e-gal4 (e16e-gal4/+, G), e16e>rsk
More informationTopic 02 Microscopy, Staining, Classification (Ch3)
Topic 02 Microscopy, Staining, Classification (Ch3) Topics Dichotomous keys Methods of Culturing Microorganisms (9.6) Microscope (History, Types, Definitions) Staining (Gram s) (2.4) Micro for Health Sciences
More informationSurvival curve, LD USUV Mice poorly seroconverted to Usutu competent mice
LD, low dose HD, high dose Survival curve, LD USUV Mice poorly seroconverted to Usutu competent mice LD, low dose HD, high dose Survival curve, HD USUV Mice poorly seroconverted to Usutu competent mice
More informationThermo Scientific Samco Transfer Pipettes. Precisely what you need
Thermo Scientific Samco Transfer Pipettes Precisely what you need Yesterday, today Thermo Scientific Samco transfer pipettes have been the industry leaders for over 35 years Design Grips easily with latex
More informationTL6 Ultra Micro-volume Spectrophotometer
TL6 Ultra Micro-volume Spectrophotometer TL6 is the latest Ultra Micro-volume Spectrophotometer of PERSEE ANALYTICS. It is a small portable instrument for fast analysis of nucleic acid and protein concentrations
More informationPast and Future of Flow Cytometry... and some Secrets. FACS Users Meeting Stockholm February 4, 2009
Past and Future of Flow Cytometry... and some Secrets FACS Users Meeting Stockholm February 4, 2009 The Short Story 1974: The first sorter by BD-FACS 1978: Start of Monoclonal Center 2008: + $ 1 billion
More informationExpression pattern of nub-gal4. The expression pattern of nub-gal4 was. assayed by combining it with the reporter UAS-His2ADsRed as in Figure 1.
Supplementary Figure 1. Expression pattern of nub-gal4. The expression pattern of nub-gal4 was assayed by combining it with the reporter UAS-His2ADsRed as in Figure 1. His2ADsRed is localized to the nuclei
More informationSTUDIES ON REAL-VALUED NEGATIVE SELECTION ALGORITHMS FOR SELF-NONSELF DISCRIMINATION
STUDIES ON REAL-VALUED NEGATIVE SELECTION ALGORITHMS FOR SELF-NONSELF DISCRIMINATION A Thesis Presented to the Faculty of California Polytechnic State University, San Luis Obispo In Partial Fulfillment
More informationSuspicious packages. Deputy Les Wiemers Weld County Sheriffs Office Aims Campus Resource Officer
Suspicious packages Deputy Les Wiemers Weld County Sheriffs Office Aims Campus Resource Officer Class rules Please interrupt me!!! If I m going too fast, tell me to slow down. If I m going too slow, tell
More informationSupplementary Table S1. Sequences of primers used for cloning of neuropeptide-coding genes. Fw: Forward primer; Rv: Reverse primer.
Supplementary Table S1. Sequences of primers used for cloning of neuropeptide-coding genes. Fw: Forward primer; Rv: Reverse primer. Gene name DjNp3 DjNp4 DjNp9 DjNp12 DjNp17 DjNp19 DjNp23 DjNp25 DjNp28
More informationCSE182 Class project: An EST database of H. medicinalis
CSE182 Class project: An EST database of H. medicinalis October 15, 2006 1 Introduction to Hirudo Hirudo medicinalis (medicinal leech is organism with historical medical as well contemporary relvance as
More informationMixing Bio- and More Conventional Materials
Mixing Bio- and More Conventional Materials UGIM Symposium 2016 Forum Session on Exotic Materials June 14, 2016 Mixing Bio and More Conventional Materials Bioelectronics Nano-biology Medical applications
More informationThermo Scientific Samco Transfer Pipettes. Precisely what you need
Thermo Scientific Samco Transfer Pipettes Precisely what you need Application Guide LIFE SCIENCE APPLICATIONS INDUSTRIAL, RESEARCH AND TESTING CLINICAL APPLICATIONS Top 9 Pipettes: 6, 3, 5, 20, 23, 24,
More informationFurther Developments on Router Nodes Positioning for Wireless Networks using Artificial Immune Systems
Further Developments on Router Nodes Positioning for Wireless Networks using Artificial Immune Systems Pedro Henrique Gouvêa Coelho, J. L. M. do Amaral, J. F. M. do Amaral, L. F. de A. Barreira and A.
More informationLight Sheet Fluorescence Microscopy by Carl Zeiss. Chris Power 3D Imaging Specialist Dublin Workshop 25/11/2013
Light Sheet Fluorescence Microscopy by Carl Zeiss Chris Power 3D Imaging Specialist Dublin Workshop 25/11/2013 Agenda 1. Requirements and challenges of live cell imaging 2. Light sheet fluorescence microscopy
More informationYuan_FigS1. Control shrna. Vector. Eset shrna1. Eset shrna2. Eset overexpression. kda. anti-eset. anti-actin
Yuan_FigS1 kda Vector Control shrna Eset shrna1 Eset shrna2 Eset overexpression 26 16 anti-eset 11 anti-actin Yuan_FigS2 A Relative expression (%) 12 1 8 6 4 2 Nanog Pou5f1 Cdx2 Hand1 Eset B Control shrna
More informationNGS NEXT GENERATION SEQUENCING
NGS NEXT GENERATION SEQUENCING Paestum (Sa) 15-16 -17 maggio 2014 Relatore Dr Cataldo Senatore Dr.ssa Emilia Vaccaro Sanger Sequencing Reactions For given template DNA, it s like PCR except: Uses only
More informationTHE VERTICAL TURN. Leica TCS SP8 DLS Confocal and Digital LightSheet Microscope
THE VERTICAL TURN Leica TCS SP8 DLS Confocal and Digital LightSheet Microscope Color coded three-dimensional image of eye specific GFP expression (3P3 promoter) in Drosophila melanogaster. Specimen courtesy
More informationT H E J O U R N A L O F C E L L B I O L O G Y
Supplemental material Courtois et al., http://www.jcb.org/cgi/content/full/jcb.201202135/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Measurement of distribution and size of MTOCs in the
More informationCAP BIOINFORMATICS Su-Shing Chen CISE. 8/19/2005 Su-Shing Chen, CISE 1
CAP 5510-2 BIOINFORMATICS Su-Shing Chen CISE 8/19/2005 Su-Shing Chen, CISE 1 Building Local Genomic Databases Genomic research integrates sequence data with gene function knowledge. Gene ontology to represent
More information1. INTRODUCTION. In 2002 the Computer Security Institute reported that 99% of corporations
1 1. INTRODUCTION In 2002 the Computer Security Institute reported that 99% of corporations and government agencies experienced some kind of security violation [1]. As computer use expands in the coming
More informationImaging the Materials of Life: MicroCT in Biological Research
Imaging the Materials of Life: MicroCT in Biological Research Dr. Brian Metscher Department of Theoretical Biology University of Vienna The real voyage of discovery consists not in seeking new landscapes,
More informationProduct Catalog. Disposable Endoscopic Medical Devices
Product Catalog Disposable Endoscopic Medical Devices Thank you for choosing Endo Therapeutics. History Endo-Therapeutics, Inc. an endoscopic medical device manufacturer was established in 1992 in Safety
More informationGegenees genome format...7. Gegenees comparisons...8 Creating a fragmented all-all comparison...9 The alignment The analysis...
User Manual: Gegenees V 1.1.0 What is Gegenees?...1 Version system:...2 What's new...2 Installation:...2 Perspectives...4 The workspace...4 The local database...6 Populate the local database...7 Gegenees
More informationAll mirnas (clustered and individual) were inserted into a multiple cloning site in the 3'-UTR of a fluorescent marker.
Supplementary Figure 1. Vector schematic for UAS-miRNA generation. All mirnas (clustered and individual) were inserted into a multiple cloning site in the 3'-UTR of a fluorescent marker. Supplementary
More informationLab 2 Functions and Antibiotics
Lab 2 Functions and Antibiotics Date: August 30, 2011 Assignment and Report Due Date: September 6, 2011 Goal: In this lab you will learn about a model for antibiotic efficiency and see how it relates to
More informationMethods. KS ELISPOT KS ELISPOT compact. Routine Systems for Enzyme Linked Immuno SPOT Assay Evaluations. Microscopy from Carl Zeiss
Microscopy from Carl Zeiss KS ELISPOT KS ELISPOT compact Methods Fast evaluation of standard and fluorescence Elispot specimen Efficient and reproducible method for Enzyme Linked Immuno SPOT assay evaluations
More informationMulti-channel Deep Transfer Learning for Nuclei Segmentation in Glioblastoma Cell Tissue Images
Multi-channel Deep Transfer Learning for Nuclei Segmentation in Glioblastoma Cell Tissue Images Thomas Wollmann 1, Julia Ivanova 1, Manuel Gunkel 2, Inn Chung 3, Holger Erfle 2, Karsten Rippe 3, Karl Rohr
More informationNeuroscience Solutions. by leica microsystems
Neuroscience Solutions by leica microsystems neuroscience solutions from leica microsystems Working with Acute Slice Preparations The nervous system works as a tightly regulated, highly complex cellular
More informationCOLOCALISATION. Alexia Loynton-Ferrand. Imaging Core Facility Biozentrum Basel
COLOCALISATION Alexia Loynton-Ferrand Imaging Core Facility Biozentrum Basel OUTLINE Introduction How to best prepare your samples for colocalisation How to acquire the images for colocalisation How to
More informationMBS-HACCP&WATER EASY TEST MBS MULTI-READER
MBS-HACCP&WATER EASY TEST ADVANCED SYSTEM MBS MULTI-READER USER MANUAL TABLE OF CONTENTS 1.1 Introduction 3 1.2 In the box 5 1.3 Connecting the MBS-MR device to computer 5 1.4 MBS-MR software installation
More informationRealTime ready Custom RT-qPCR Assays and Panels Simple Online Configuration
RealTime ready Custom RT-qPCR Assays and Panels Simple Online Configuration Browse the Configurator at www.configurator.realtimeready.roche.com. For life science research only. Not for use in diagnostic
More information1) Describe advanced blood circulatory system in Annelida. Parasitic adaptations in Platyhelminthes.
(DZOO 01 (NR)) ASSIGNMENT - 1, MAY - 2016. PAPER-I : SYSTEMATICS AND ANATODECEMBER OF INVERTEBRATES 1) Describe advanced blood circulatory system in Annelida. 2) Write short notes on: i) Development in
More informationFluorescence Tomography Source Reconstruction and Analysis
TECHNICAL NOTE Pre-clinical in vivo imaging Fluorescence Tomography Source Reconstruction and Analysis Note: This Technical Note is part of a series for Fluorescence Imaging Tomography (FLIT). The user
More informationLab Exercise 5: The Smear and Simple Staining
Background Smears The preparation of a good smear is the backbone of all of the staining techniques performed throughout this course. A good smear is the result of the mastery of three individual concepts:
More informationMEPD: Medaka Expression Pattern Database. User manual. 11th September Juan L. Mateo
MEPD: Medaka Expression Pattern Database User manual 11th September 2015 Juan L. Mateo Centre for Organismal Studies, University of Heidelberg, juan.mateo@cos.uni-heidelberg.de Contents 1 Introduction
More informationMEGAN5 tutorial, September 2014, Daniel Huson
MEGAN5 tutorial, September 2014, Daniel Huson This tutorial covers the use of the latest version of MEGAN5. Here is an outline of the steps that we will cover. Note that the computationally most timeconsuming
More informationIntroduction to GE Microarray data analysis Practical Course MolBio 2012
Introduction to GE Microarray data analysis Practical Course MolBio 2012 Claudia Pommerenke Nov-2012 Transkriptomanalyselabor TAL Microarray and Deep Sequencing Core Facility Göttingen University Medical
More informationWelcome to the Quantitative Trait Loci (QTL) Tutorial
Welcome to the Quantitative Trait Loci (QTL) Tutorial This tutorial will describe how to navigate the section of Gramene that provides information on Quantitative Trait Loci (QTL). QTL are a statistical
More informationnow the only difficult thing about spectrophotometry is how to say it
Life Sc ienc es now the only difficult thing about spectrophotometry is how to say it Biochrom US 84 October Hill Rd Holliston, MA 01746-1388 USA Telephone: 1-508-893-8999 Toll Free: 1-800-272-2775 Fax:
More informationHRP Magenta chromogen for Dako Omnis. Simply revolutionary 'red'
HRP Magenta chromogen for Dako Omnis Simply revolutionary 'red' A new color for the EnVision FLEX family on Dako Omnis Introducing HRP Magenta, a new chromogen available for your Dako Omnis solution that
More informationHEMOSTASIS Solutions for Effective Hemostatic Therapy.
HEMOSTASIS Solutions for Effective Hemostatic Therapy. 9544 1 OVERVIEW Endoscopic Hemostasis of Gastrointestinal Bleeding Can Be Accomplished by Various Means, Including Adrenaline Injection, Thermal Coagulation,
More informationLeica DFC3000 G. Crisp fluorescence documentation for routine experiments
Leica DFC3000 G Crisp fluorescence documentation for routine experiments Leica DFC3000 G fluorescence documentation camera Leica DFC3000 G Crisp Fluorescence Documentation for Routine Experiments The Leica
More informationLeica LMD6500 Laser Microdissection Easy to Use, Fast, Precise, Versatile, Effective
Bob Fasulka Leica LMD6500 Laser Microdissection Easy to Use, Fast, Precise, Versatile, Effective Latest LM The Leica LMD6500 represents one of the latest laser microdissection technologies Molecular and
More informationOptical Sectioning. Bo Huang. Pharmaceutical Chemistry
Optical Sectioning Bo Huang Pharmaceutical Chemistry Approaches to 3D imaging Physical cutting Technical difficulty Highest resolution Highest sensitivity Optical sectioning Simple sample prep. No physical
More information1 Compound microscopes. Compound, Phase contrast, Digital, Fluorescence and Inverted microscopes
8 1 Compound microscopes Compound, Phase contrast, Digital, Fluorescence and Inverted microscopes Compound microscope KERN OBS-1 Objectives OBS OBS 1 OBS 104 OBS 106 EDUCATIONAL LINE The school microscope
More informationProjection with Public Data (PPD)
Projection with Public Data (PPD) Goal To compare users 16S rrna data with published datasets by processing and normalization them together, and projecting into 3D PCoA plot for visual comparative analysis
More informationMy family List of Papers This thesis is based on the following papers, which are referred to in the text by their Roman numerals. I A. Allalou, F. M. van de Rijke, R. J. Tafrechi, A. K. Raap, and C. Wählby.
More informationPerkinElmer Microplates for Life Science Research
Drug Discovery Research Clinical Screening Microplates PerkinElmer Microplates for Life Science Research a complete overview Dear Life Science Researcher, This booklet provides an overview of all PerkinElmer
More informationTutorial. OTU Clustering Step by Step. Sample to Insight. March 2, 2017
OTU Clustering Step by Step March 2, 2017 Sample to Insight QIAGEN Aarhus Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 www.qiagenbioinformatics.com AdvancedGenomicsSupport@qiagen.com
More informationJames Boedicker, Hernan Garcia, Manuel Razo Mejia, Griffin Chure, Elizabeth Eck, Meghan Turner
Matlab Tutorial: Measuring cell growth rate James Boedicker, Hernan Garcia, Manuel Razo Mejia, Griffin Chure, Elizabeth Eck, Meghan Turner Introduction Reproduction is an essential process of life. In
More informationmiscript mirna PCR Array Data Analysis v1.1 revision date November 2014
miscript mirna PCR Array Data Analysis v1.1 revision date November 2014 Overview The miscript mirna PCR Array Data Analysis Quick Reference Card contains instructions for analyzing the data returned from
More informationBHSAI Biotechnology HPC Software Applications Institute
BHSAI Biotechnology HPC Software Applications Institute QuartetS-DB An Orthology Database for Species User s Guide May 0 The QuartetS database (QuartetS-DB) contains orthology predictions for species (
More informationHuntington s Disease and Vertex Pharmaceuticals
Huntington s Disease and Vertex Pharmaceuticals Jeff Stack, Ph.D. Vertex, San Diego HDSA Annual Convention June 7, 2008 www.vrtx.com Outline Background on Vertex Pharmaceuticals Vertex drug discovery collaboration
More informationTutorial. OTU Clustering Step by Step. Sample to Insight. June 28, 2018
OTU Clustering Step by Step June 28, 2018 Sample to Insight QIAGEN Aarhus Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 www.qiagenbioinformatics.com ts-bioinformatics@qiagen.com
More informationUser Guide for dbpec
User Guide for dbpec Query Options Query dbpec for a specific gene Users can enter a single gene name (HGNC) in the search field entitled Search Genes and submit. If more than one gene matches query, user
More informationBioImaging facility update: from multi-photon in vivo imaging to highcontent high-throughput image-based screening. Alex Laude The BioImaging Unit
BioImaging facility update: from multi-photon in vivo imaging to highcontent high-throughput image-based screening Alex Laude The BioImaging Unit Multi-dimensional, multi-modal imaging at the sub-cellular
More informationCOMPARATIVE MICROBIAL GENOMICS ANALYSIS WORKSHOP. Exercise 3: Pan- and Core- genome analysis, Pan-genome tree
COMPARATIVE MICROBIAL GENOMICS ANALYSIS WORKSHOP Exercise 3: Pan- and Core- genome analysis, Pan-genome tree 1. Pan- and Core- genome plot construction Pan- and core-genome plots are graphs that display
More informationCT slices were reconstructed using COBRA (Exxim Computing Corporation) on
PET Imaging Post-Processing CT slices were reconstructed using COBRA (Exxim Computing Corporation) on volumes of 480 x 480 x 683 isotropic voxels, 191.92 µm 3. Each 20 minute PET scan was reconstructed
More informationEpigenetic regulation of the nuclear-coded GCAT and SHMT2 genes confers
Supplementary Information for Epigenetic regulation of the nuclear-coded GCAT and SHMT2 genes confers human age-associated mitochondrial respiration defects Osamu Hashizume, Sakiko Ohnishi, Takayuki Mito,
More informationIII: Single particle cryoem - practical approaches
III: Single particle cryoem - practical approaches Single particle EM analysis can be performed at both 2D and 3D. Single particle EM (both negative stain and cryo) is to extract structural information
More informationApplying Data-Driven Normalization Strategies for qpcr Data Using Bioconductor
Applying Data-Driven Normalization Strategies for qpcr Data Using Bioconductor Jessica Mar April 30, 2018 1 Introduction High-throughput real-time quantitative reverse transcriptase polymerase chain reaction
More informationLIMS User Guide 1. Content
LIMS User Guide 1. Content 1. Content... 1 1. Introduction... 2 2. Get a user account... 2 3. Invoice Address... 2 Create a new invoice address... 2 4. Create Project Request... 4 Request tab... 5 Invoice
More informationThe Allen Human Brain Atlas offers three types of searches to allow a user to: (1) obtain gene expression data for specific genes (or probes) of
Microarray Data MICROARRAY DATA Gene Search Boolean Syntax Differential Search Mouse Differential Search Search Results Gene Classification Correlative Search Download Search Results Data Visualization
More informationThe UCSC Genome Browser
The UCSC Genome Browser Search, retrieve and display the data that you want Materials prepared by Warren C. Lathe, Ph.D. Mary Mangan, Ph.D. www.openhelix.com Updated: Q3 2006 Version_0906 Copyright OpenHelix.
More information- Free fluorophores - Donors without partner acceptors - Acceptors without partner donors
Determining Distances / Distance Changes Caveats Angular dependence (κ 2 ) Environment dependence (J, ϕd) Distance is a (complicated) average Probe is large, linkages can be long Construct complications
More informationUNIVERSITY OF HAWA1'1 UBRA~Y
UNIVERSITY OF HAWA1'1 UBRA~Y NETWORK THREAT DETECTION UTILIZING ADAPTIVE AND INNATE IMMUNE SYSTEM METAPHORS A DISSERTATION SUBMITTED TO THE GRADUATE DIVISION OF THE UNIVERSITY OF HAW AI 1 IN PARTIAL FULFILLMENT
More informationMorphogenesis. Simulation Results
Morphogenesis Simulation Results This document contains the results of the simulations designed to investigate the regeneration strength of the computational model of the planarium. Specific portions of
More informationUsing Bio-ontologies as Data Annotation, Integration & Analytical Tools at Mouse Genome Informatics
CASIMIR Workshop Database Interoperability & Ontologies Using Bio-ontologies as Data Annotation, Integration & Analytical Tools at Mouse Genome Informatics www.informatics.jax.org Anna V. Anagnostopoulos,
More informationLecture 10: Image-Based Modelling
Computational Biology Group (CoBI), D-BSSE, ETHZ Lecture 10: Image-Based Modelling Prof Dagmar Iber, PhD DPhil MSc Computational Biology 2015 Contents 1 Image-based Domains for Simulations Staining & Imaging
More informationSona. NEW The Back-illuminated scmos Microscopy Camera You ve Been Waiting For... P P P. scmos. andor.com. Key Specifications. Key Microscopy Benefits
Sona scmos NEW The Back-illuminated scmos Microscopy Camera You ve Been Waiting For... Key Specifications -45 0 C Vacuum Cooled 95% QE 70 fps 4.2 Megapixel (Sona 4.2B-11) largest on-sample field of view
More informationFluorimetric Enzyme Assay Protocol for Marine Samples
Fluorimetric Enzyme Assay Protocol for Marine Samples (Modified from S. Schmidt Lab/M. Weintraub U. of Colorado Boulder, August 2005; Suding Lab, January 2008; and Saiya-Cork, K. R., R. L. Sinsabaugh,
More informationGIS and Forest Engineering Applications
FE 257. GIS and Forest Engineering Applications Week 3 This week s topics Clip and erase processes Chapter 6 Selecting landscape features in a GIS Chapter 5 GIS Lab3: Determining land use and ownership
More informationRadnoti. Radnoti. Radnoti. Precise digitally controlled temperature. Illuminated chamber improves sample viewing
Radnoti Myography Systems Precise digitally controlled temperature Illuminated chamber improves sample viewing Featuring an ergonomically designed sliding wrist rest Modular designed allowing for easy
More informationAnalysis of immune cell function using in vivo cell shape analysis and tracking
Analysis of immune cell function using in vivo cell shape analysis and tracking Constantino Carlos Reyes-Aldasoro 1, Yifan Zhao 2, Daniel Coca 2, Stephen A. Billings 2, Visakan Kadirkamanathan 2, Gillian
More informationA Generic Lie Group Model for Computer Vision
A Generic Lie Group Model for Computer Vision Within this research track we follow a generic Lie group approach to computer vision based on recent physiological research on how the primary visual cortex
More informationB.Sc. BIOTECHNOLOGY. Course structure of three- year B.Sc. Degree Course in Biotechnology Under Choice Based Credit System
B.Sc. BIOTECHNOLOGY Course structure of three- year B.Sc. Degree Course in Under Choice Based Credit System SEMESTER I BBT 101 Core Course-Theory Animal Science BBT 102 Plant Science BBT 103 Foundations
More informationMic qpcr. Fast. Accurate. Compact. Ultimate Performance for Real-Time PCR. Speed Accuracy Size Connectivity
Mic qpcr Ultimate Performance for Real-Time PCR Fast. Accurate. Compact. Speed Accuracy Size Connectivity Hardware Style meets substance - ultimate performance, beautiful design. Fast results without compromise
More informationHund Microscopy. 1. Contrasting methods (summary) 2. Microscopes & applications 3. Cameras 4. Selling arguments
1. Contrasting methods (summary) 2. Microscopes & applications 3. Cameras 4. Selling arguments Contrasting methods transmitted light Transmitted light is the classical method for transparent samples in
More informationII: Single particle cryoem - an averaging technique
II: Single particle cryoem - an averaging technique Radiation damage limits the total electron dose that can be used to image biological sample. Thus, images of frozen hydrated macromolecules are very
More informationApproximate Graph Patterns for Biological Network
Approximate Graph Patterns for Biological Network 1) Conserved patterns of protein interaction in multiple species - Proceedings of the National Academy of Science (PNAS) - 2003 2) Conserved pathways within
More informationOptics of Vision. MATERIAL TO READ Web: 1.
Optics of Vision MATERIAL TO READ Web: 1. www.physics.uoguelph.ca/phys1070/webst.html Text: Chap. 3, pp. 1-39 (NB: pg. 3-37 missing) Chap. 5 pp.1-17 Handbook: 1. study guide 3 2. lab 3 Optics of the eye
More informationTechnology Development Studio (TDS) MPI-CBG, Dresden, Germany. Marc Bickle HT-TDS, MPI-CBG
Technology Development Studio (TDS) MPI-CBG, Dresden, Germany Marc Bickle HT-TDS, MPI-CBG TDS: Core Screening Facility Core Screening facility of the MPI-CBG specialized in high content imaging (es 2003)
More informationFacilitating Semantic Alignment of EBI Resources
Facilitating Semantic Alignment of EBI Resources 17 th March, 2017 Tony Burdett Technical Co-ordinator Samples, Phenotypes and Ontologies Team www.ebi.ac.uk What is EMBL-EBI? Europe s home for biological
More information4 AA nickel-etal bybrid cells (min. 2,200 mah) Use only AC Adapter (5 VDC / min. 1 A) supplied for recharging
METERS Microx 4 The Microx 4 is a completely stand-alone, portable fiber optic oxygen meter. It can be used with non-invasive sensors & probes (1 mm fiber), and oxygen microsensors (200 µm fiber) in different
More informationBIOLOGICAL APPROACH TO SYSTEM INFORMATION SECURITY (BASIS)
AFRL-IF-RS-TR-2003-286 Final Technical Report December 2003 BIOLOGICAL APPROACH TO SYSTEM INFORMATION SECURITY (BASIS) Binghamton University APPROVED FOR PUBLIC RELEASE; DISTRIBUTION UNLIMITED. AIR FORCE
More informationChris Main. Extension Cotton Specialist The University of Tennessee
Chris Main Extension Cotton Specialist The University of Tennessee Ignite Tolerance Liberty Link varieties Two gene resistance to glufosinate from bar and pat genes which were first isolated from two species
More informationDistributed Password Manager- Using Secure String Management technique
Distributed Password Manager- Using Secure String Management technique Syed Ali Mehdi Assistant Professor, Department of Computer Science, Jamia Hamdard, Delhi, India ABSTRACT: We t to use more complicated
More informationDENSITY-BASED CLUSTERING OF HIGH-DIMENSIONAL DNA FINGERPRINTS FOR LIBRARY-DEPENDENT MICROBIAL SOURCE TRACKING. A Thesis.
DENSITY-BASED CLUSTERING OF HIGH-DIMENSIONAL DNA FINGERPRINTS FOR LIBRARY-DEPENDENT MICROBIAL SOURCE TRACKING A Thesis presented to the Faculty of California Polytechnic State University, San Luis Obispo
More informationDefiniens. Tissue Studio 4.2. Tutorial 3: Metadata Import, Manual ROI Selection and Vessel Detection
Definiens Tissue Studio 4.2 Tutorial 3: Metadata Import, Manual ROI Selection and Vessel Detection Tutorial 3: Metadata Import, Manual ROI Selection and Vessel Detection Imprint and Version Copyright 2015
More informationCATTTTTAGCTCCTTACTTATTTGTATAGTTCATCC GGATGAACTATACAAATAAGTAAGGAGCTAAAAATG GCATATACTGCAGAAACGCTGCTACTATACG
Supplementary Table 1: Bacterial strains and plasmids E.coli strains Relevant genotype Ref. BW25113 Wild type (pir-) Baba et al (2006) BW25141 Wild type (pir+) Datsenko and Wanner (2000) Keio:cydb BW25113
More informationDocumentation to image analysis
Documentation to image analysis The documentation below provides a detailed explanation and pointers towards the use of the MS-ECS-2D update site. It is made available in conjunction with the publication
More informationANS/NTR/PO 415 Comparative Nutrition Syllabus
ANS/NTR/PO 415 Comparative Nutrition Syllabus Jim Croom, Ph.D., FACN, Instructor John Brake, Ph.D., PAS, WNR Distinguished Professor (Consulting Instructor) Course title Course Information Comparative
More informationFrom Eye to Insight. Leica DMC2900. Digital microscope camera for easy, efficient documentation and presentation in industry and research
From Eye to Insight Leica DMC2900 Digital microscope camera for easy, efficient documentation and presentation in industry and research 3 High Speed Imaging Leica DMC2900 with USB 3.0 interface for highest
More informationSEEK User Manual. Introduction
SEEK User Manual Introduction SEEK is a computational gene co-expression search engine. It utilizes a vast human gene expression compendium to deliver fast, integrative, cross-platform co-expression analyses.
More informationCharacteristic Quantities of Microvascular Structures in CLSM Volume Datasets K. Winter¹, L. H.-W. Metz, J.-P. Kuska², B. Frerich³
Characteristic Quantities of Microvascular Structures in CLSM Volume Datasets K. Winter¹, L. H.-W. Metz, J.-P. Kuska², B. Frerich³ ¹Translational Centre for Regenerative Medicine (TRM-Leipzig), University
More information