Figure 6. Genotypes of (C) are: gmr-gal4 (gmr-gal4/+), gmr>erk (gmr-gal4 UAS-
|
|
|
- Bruce Stanley
- 6 years ago
- Views:
Transcription
1 Supplementary Information 1. Genotypes Figure 3. Genotypes are: WT (w 1118, A, C), RSK D1 (RSK D1 /Y, B, D), RSK D1 ; da>rsk WT (RSK D1 /Y; UAS-RSK WT /+; da-gal4/+, E), e16e-gal4 (e16e-gal4/+, G), e16e>rsk WT (e16e-gal4/uas-rsk WT, H), MS1096-Gal4 (MS1096-Gal4/+, I), and MS1096>RSK WT (MS1096-Gal4/+; UAS-RSK WT /+, J). Figure 4. Genotypes are: gmr-gal4 UAS-RSK WT /+; Ras e1b /+ (A), Raf HM7 /Y; gmr-gal4 UAS-RSK WT /+ (B), dsor LH110 /+; gmr-gal4 UAS-RSK WT /+ (C), rl 10a /gmr-gal4 UAS- RSK WT (D), sev s11 /Y; sev-gal4/+ (E), sev-gal4/+; UAS-Ras V12 /+ (F), sev-gal4/+; UAS- Raf F179 /+ (G), sev-gal4/uas-erk Sem (H), sev s11 /Y; sev-gal4 UAS-RSK WT /+ (I), sev- Gal4 UAS-RSK WT /+; UAS-Ras V12 /+ (J), sev-gal4 UAS-RSK WT /+; UAS-Raf F179 /+ (K), sev-gal4 UAS-RSK WT /UAS-ERK Sem (L), Raf HM7 /Y (M), and Raf HM7 RSK D1 /Y (N). Figure 5. Genotypes of (D, E) are: sev>erk+ras V12 (sev-gal4 UAS-ERK/+; UAS- Ras V12 /+), sev>erk+ras V12 +RSK WT (sev-gal4 UAS-ERK/UAS-RSK WT ; UAS-Ras V12 /+), sev>ras V12 (sev-gal4/+; UAS-Ras V12 /+), and sev>ras V12 +RSK WT (sev-gal4/uas- RSK WT ; UAS-Ras V12 /+). Figure 6. Genotypes of (C) are: gmr-gal4 (gmr-gal4/+), gmr>erk (gmr-gal4 UAS- ERK/+), gmr>rsk WT (gmr-gal4/uas-rsk WT ), gmr>rsk KR (gmr-gal4/+; UAS- RSK KR /+), gmr>rsk WT/RA (gmr-gal4/+; UAS-RSK WT/RA /+), gmr>rsk KR/RA (gmr-gal4/+; UAS-RSK KR/RA /+), gmr>erk+rsk WT (gmr-gal4 UAS-ERK/UAS-RSK WT ), gmr>erk+rsk KR (gmr-gal4 UAS-ERK/+; UAS-RSK KR /+), gmr>erk+rsk WT/RA (gmr- 1
2 Gal4 UAS-ERK/+; UAS-RSK WT/RA /+), and gmr>erk+rsk KR/RA (gmr-gal4 UAS-ERK/+; UAS-RSK KR/RA /+). Genotypes of (D) are: hs-gal4 (hs-gal4/+), hs>rsk KR (hs-gal4/+; UAS-RSK KR /+), and hs>rsk WT (hs-gal4/uas-rsk WT ). Genotypes of (E) are: gmr-gal4 (gmr-gal4/+), gmr>rsk WT (gmr-gal4 UAS-RSK WT /+), gmr>rsk WT/RA (gmr-gal4/+; UAS-RSK WT/RA /+), gmr>rsk KR (gmr-gal4/+; UAS-RSK KR /+), and gmr>rsk KR/RA (gmr- Gal4/+; UAS-RSK KR/RA /+). Genotypes of (F) are: e16e-gal4 (e16e-gal4/+), e16e>rsk WT (e16e-gal4/uas-rsk WT ), e16e>rsk WT/RA (e16e-gal4/+; UAS- RSK WT/RA /+), e16e>rsk KR (e16e-gal4/+; UAS-RSK KR /+), and e16e>rsk KR/RA (e16e- Gal4/+; UAS-RSK KR/RA /+). Figure 7. Genotypes of (A-G) are: sev-gal4/+ (A), sev-gal4/+; UAS-RSK KR /+, (B) sev- Gal4/+; Ras e1b /UAS-RSK KR (C), rl 10a /sev-gal4; UAS-RSK KR /+ (D), sev-gal4/+; UAS- RSK KR /UAS-Ras V12 (E), sev-gal4/+; UAS-RSK KR /UAS-Raf F179 (F), and sev-gal4/ UAS- ERK Sem ; UAS-RSK KR /+ (G). Genotypes from left to right of (H) are: sev-gal4 UAS- ERK/+; UAS-Ras V12 /+ (first row), sev-gal4 UAS-ERK/+; UAS-RSK KR /UAS-Ras V12 (second row), sev-gal4 UAS-ERK/+; UAS-RSK WT/RA /UAS-Ras V12 (third row), and sev- Gal4 UAS-ERK/+; UAS-RSK KR/RA /UAS-Ras V12 (fourth row). Genotypes of (I) are: gmr- Gal4 rho-lacz (gmr-gal4/+; rho-lacz/+), gmr>rsk KR rho-lacz (gmr-gal4/+; UAS- RSK KR /rho-lacz), gmr>rsk WT/RA rho-lacz (gmr-gal4/+; UAS-RSK WT/RA /rho-lacz), and gmr>rsk KR/RA rho-lacz (gmr-gal4/+; UAS-RSK KR/RA /rho-lacz). Genotypes from left to right of (J) are: sev-gal4/+; UAS-Ras V12 /+ (first row), sev-gal4/+; UAS-RSK KR /UAS- Ras V12 (second row), sev-gal4/+; UAS-RSK WT/RA /UAS-Ras V12 (third row), and sev- Gal4/+; UAS-RSK KR/RA /UAS-Ras V12 (fourth row). Genotypes from left to right of upper graph of (K) are: sev-gal4 UAS-ERK/+; UAS-Ras V12 /+, sev-gal4 UAS-ERK/UAS- RSK WT ; UAS-Ras V12 /+, sev-gal4 UAS-ERK/+; UAS-RSK KR /UAS-Ras V12, sev-gal4 UAS- 2
3 ERK/+; UAS-RSK WT/RA /UAS-Ras V12, and sev-gal4 UAS-ERK/+; UAS-RSK KR/RA /UAS- Ras V12. Genotypes from left to right of lower graph of (K) are: sev-gal4/+; UAS- Ras V12 /+, sev-gal4/uas-rsk WT ; UAS-Ras V12 /+, sev-gal4/+; UAS-RSK KR /UAS-Ras V12, sev-gal4/+; UAS-RSK WT/RA /UAS-Ras V12, and sev-gal4/+; UAS-RSK KR/RA /UAS-Ras V12. 3
4 2. Supplementary Materials and methods Fertility test Male (Watnick et al, 2003) and female (Lee et al, 2003) fertility assays were conducted as previously described. Cuticle preparation of embryos For the cuticle preparation, dechorionated embryos or larvae were immersed in a solution containing acetic acid and glycerol in a 3:1 ratio and incubated for 3 hr at 65 o C. Samples were then mounted in Hoyer s medium and incubated for 24 hr at 65 o C. RT-PCR analysis Total RNA was isolated using the easy-blue TM system (Intron, Korea), and reversely transcribed into cdna with reverse transcriptase (Promega). Primer sequences used for PCR are as follow. RSK-forward RSK-reverse CG14080-forward CG14080-reverse CG7378-forward CG7378-reverse CG15528-forward CG15528-reverse CG5475-forward CG5475-reverse : 5'- TGAGGCCAGCGCGGTGTTAAG-3' : 5'- GTCATAGCCCTGTCTCTTTAGAACC-3' : 5'-ACAGCTGCGACTCGGAAGCG-3' : 5'-GTTGGCTCTCGAAGGACAGC-3' : 5'-TCGCCCAGCCGCTTGGAG-3' : 5'-GTAGGGATACAGGTTCTTGCGC-3' : 5'-ATGCCATTTGGCAGAGCCCC-3' : 5'-TCGGGGATCTCCTTGTCCAG-3' : 5'-ATGTCAGTGTCCATTACAAAAAAGTTTTACAAG-3' : 5'-AAAAACTGGACGTGGTCGTCGG-3' 4
5 pnt-p1-forward pnt-p1-reverse actin-forward actin-reverse : 5'-GATGTCAACTTCTTTAGTTC-3' : 5'-GCATCATAGGGCGTAAATTC-3' : 5'-CGTCTTCCCATCGATTGTG-3' : 5'-GATGCCAGGGTACATGGTG-3' 5
6 3. References Watnick TJ, Jin Y, Matunis E, Kernan MJ, Montell C. (2003) A flagellar polycystin-2 homolog required for male fertility in Drosophila. Curr Biol 13: Lee JH, Lee E, Park J, Kim E, Kim J, Chung J. (2003) In vivo p53 function is indispensable for DNA damage-induced apoptotic signaling in Drosophila. FEBS Lett 550: 5-10 Kim M, Cha GH, Kim S, Lee JH, Park J, Koh H, Choi KY, Chung J. (2004) MKP-3 has essential roles as a negative regulator of the Ras/mitogen-activated protein kinase pathway during Drosophila development. Mol Cell Biol 24:
All mirnas (clustered and individual) were inserted into a multiple cloning site in the 3'-UTR of a fluorescent marker.
Supplementary Figure 1. Vector schematic for UAS-miRNA generation. All mirnas (clustered and individual) were inserted into a multiple cloning site in the 3'-UTR of a fluorescent marker. Supplementary
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3000 Supplementary Figure 1 Lgr5 expression in the Lgr5-LacZ reporter knock-in mouse. P1: Lgr5-LacZ expression on the ovary surface (black arrow) and sub-surface (arrowheads), as well as
Nature Biotechnology: doi: /nbt Supplementary Figure 1
Supplementary Figure 1 Detailed schematic representation of SuRE methodology. See Methods for detailed description. a. Size-selected and A-tailed random fragments ( queries ) of the human genome are inserted
TECH NOTE Improving the Sensitivity of Ultra Low Input mrna Seq
TECH NOTE Improving the Sensitivity of Ultra Low Input mrna Seq SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Powered by SMART and LNA technologies: Locked nucleic acid technology significantly improves
Tutorial 1: Exploring the UCSC Genome Browser
Last updated: May 12, 2011 Tutorial 1: Exploring the UCSC Genome Browser Open the homepage of the UCSC Genome Browser at: http://genome.ucsc.edu/ In the blue bar at the top, click on the Genomes link.
Pairwise Sequence Alignment. Zhongming Zhao, PhD
Pairwise Sequence Alignment Zhongming Zhao, PhD Email: zhongming.zhao@vanderbilt.edu http://bioinfo.mc.vanderbilt.edu/ Sequence Similarity match mismatch A T T A C G C G T A C C A T A T T A T G C G A T
Supplementary Figures
Supplementary Figures Supplementary Figure 1: The pattern of AbdB-GAL4 LDN -driven expression does not overlap that of en-gal4. (a) ECFP driven by AbdB-GAL4 LDN did not overlap the anti-engrailed (en)
Computational Genomics and Molecular Biology, Fall
Computational Genomics and Molecular Biology, Fall 2015 1 Sequence Alignment Dannie Durand Pairwise Sequence Alignment The goal of pairwise sequence alignment is to establish a correspondence between the
and genomic DNA (Mut) and WT of patient healthy women and
Supplementary Figure 1 TEKT germline variations in the control group and blood sampless of 84 breast cancerr patients. (a) TEKT44 wild-typee (WT), mutant (Mut) and WT to Mut genotype byy Sanger sequencing
Expression pattern of nub-gal4. The expression pattern of nub-gal4 was. assayed by combining it with the reporter UAS-His2ADsRed as in Figure 1.
Supplementary Figure 1. Expression pattern of nub-gal4. The expression pattern of nub-gal4 was assayed by combining it with the reporter UAS-His2ADsRed as in Figure 1. His2ADsRed is localized to the nuclei
Introduction to GE Microarray data analysis Practical Course MolBio 2012
Introduction to GE Microarray data analysis Practical Course MolBio 2012 Claudia Pommerenke Nov-2012 Transkriptomanalyselabor TAL Microarray and Deep Sequencing Core Facility Göttingen University Medical
A Reliable and Distributed LIMS for Efficient Management of the Microarray Experiment Environment
A Reliable and Distributed LIMS for Efficient Management of the Microarray Experiment Environment Hee-Jeong Jin BK Center for U-Port IT Research Education, Pusan National University, Busan, South Korea,
The Role of the Indigenous Microbiota in Zebrafish Gastrointestinal Tract Development. Karen Guillemin University of Oregon
The Role of the Indigenous Microbiota in Zebrafish Gastrointestinal Tract Development Karen Guillemin University of Oregon human 10 13 cells GI tract bacteria 10 14 cells 25,000 genes ~500 species 1,000,000
Wilson Leung 01/03/2018 An Introduction to NCBI BLAST. Prerequisites: Detecting and Interpreting Genetic Homology: Lecture Notes on Alignment
An Introduction to NCBI BLAST Prerequisites: Detecting and Interpreting Genetic Homology: Lecture Notes on Alignment Resources: The BLAST web server is available at https://blast.ncbi.nlm.nih.gov/blast.cgi
Supplementary Information. Structure of a RSC nucleosome Complex and Insights into Chromatin Remodeling
Supplementary Information Structure of a RSC nucleosome Complex and Insights into Chromatin Remodeling Yuriy Chaban 1, Chukwudi Ezeokonkwo 1, Wen-Hsiang Chung 1, Fan Zhang 1, Roger D. Kornberg 2, Barbara
Wilson Leung 05/27/2008 A Simple Introduction to NCBI BLAST
A Simple Introduction to NCBI BLAST Prerequisites: Detecting and Interpreting Genetic Homology: Lecture Notes on Alignment Resources: The BLAST web server is available at http://www.ncbi.nih.gov/blast/
HS-27 Manual 5/2/2013. Neuralynx, Inc. 105 Commercial Drive, Bozeman, MT Phone Fax
5/2/2013 Neuralynx, Inc. 105 Commercial Drive, Bozeman, MT 59715 Phone 406.585.4542 Fax 866.585.1743 www.neuralynx.com support@neuralynx.com Table of Contents 1 Headstage 27 Overview... 3 2 Glossary...
Supplementary Information for. HybTrack: A hybrid single particle tracking software using manual and automatic detection of dim signals
Supplementary Information for HybTrack: A hybrid single particle tracking software using manual and automatic detection of dim signals Byung Hun Lee 1 and Hye Yoon Park 1,2 * Affiliations: 1 Department
Applying Data-Driven Normalization Strategies for qpcr Data Using Bioconductor
Applying Data-Driven Normalization Strategies for qpcr Data Using Bioconductor Jessica Mar April 30, 2018 1 Introduction High-throughput real-time quantitative reverse transcriptase polymerase chain reaction
RealTime ready Custom RT-qPCR Assays and Panels Simple Online Configuration
RealTime ready Custom RT-qPCR Assays and Panels Simple Online Configuration Browse the Configurator at www.configurator.realtimeready.roche.com. For life science research only. Not for use in diagnostic
MSCBIO 2070/02-710: Computational Genomics, Spring A4: spline, HMM, clustering, time-series data analysis, RNA-folding
MSCBIO 2070/02-710:, Spring 2015 A4: spline, HMM, clustering, time-series data analysis, RNA-folding Due: April 13, 2015 by email to Silvia Liu (silvia.shuchang.liu@gmail.com) TA in charge: Silvia Liu
The UCSC Genome Browser
The UCSC Genome Browser Search, retrieve and display the data that you want Materials prepared by Warren C. Lathe, Ph.D. Mary Mangan, Ph.D. www.openhelix.com Updated: Q3 2006 Version_0906 Copyright OpenHelix.
HS-27-Mini. Headstage preamplifier providing 27 channels of unity gain amplification.
HS-27-Mini Headstage preamplifier providing 27 channels of unity gain amplification. 9/16/2013 Neuralynx, Inc. 105 Commercial Drive, Bozeman, MT 59715 Phone 406.585.4542 Fax 866.585.1743 www.neuralynx.com
Computational Molecular Biology
Computational Molecular Biology Erwin M. Bakker Lecture 2 Materials used from R. Shamir [2] and H.J. Hoogeboom [4]. 1 Molecular Biology Sequences DNA A, T, C, G RNA A, U, C, G Protein A, R, D, N, C E,
Resveratrol mitigates lipopolysaccharide-mediated acute. inflammation in rats by inhibiting the TLR4/NF-κBp65/MAPKs.
Resveratrol mitigates lipopolysaccharide-mediated acute inflammation in rats by inhibiting the TLR4/NF-κBp65/MAPKs signaling cascade Guangxi Wang a,1, Zhiqiang Hu b,1, Qiuting Fu a,1, Xu Song a,1, Qiankun
3. Open Vector NTI 9 (note 2) from desktop. A three pane window appears.
SOP: SP043.. Recombinant Plasmid Map Design Vector NTI Materials and Reagents: 1. Dell Dimension XPS T450 Room C210 2. Vector NTI 9 application, on desktop 3. Tuberculist database open in Internet Explorer
PLEASE SCROLL DOWN FOR ARTICLE. Full terms and conditions of use:
This article was downloaded by: [Lee, Gi-Dong] On: 15 June 2011 Access details: Access Details: [subscription number 938667207] Publisher Taylor & Francis Informa Ltd Registered in England and Wales Registered
CAP BIOINFORMATICS Su-Shing Chen CISE. 8/19/2005 Su-Shing Chen, CISE 1
CAP 5510-2 BIOINFORMATICS Su-Shing Chen CISE 8/19/2005 Su-Shing Chen, CISE 1 Building Local Genomic Databases Genomic research integrates sequence data with gene function knowledge. Gene ontology to represent
Colorado State University Bioinformatics Algorithms Assignment 6: Analysis of High- Throughput Biological Data Hamidreza Chitsaz, Ali Sharifi- Zarchi
Colorado State University Bioinformatics Algorithms Assignment 6: Analysis of High- Throughput Biological Data Hamidreza Chitsaz, Ali Sharifi- Zarchi Although a little- bit long, this is an easy exercise
Database Searching Using BLAST
Mahidol University Objectives SCMI512 Molecular Sequence Analysis Database Searching Using BLAST Lecture 2B After class, students should be able to: explain the FASTA algorithm for database searching explain
Comets v. 1.0 Matlab toolbox. User Manual. Written by Young-Jin Jung
Comets v. 1.0 Matlab toolbox User Manual Written by Young-Jin Jung (cometstool@gmail.com) Comets A Matlab toolbox for simulating electric field due to tdcs Version 1.0, Feb. 1, 2012 Downloadable at http://www.cometstool.com
BLAST: Basic Local Alignment Search Tool Altschul et al. J. Mol Bio CS 466 Saurabh Sinha
BLAST: Basic Local Alignment Search Tool Altschul et al. J. Mol Bio. 1990. CS 466 Saurabh Sinha Motivation Sequence homology to a known protein suggest function of newly sequenced protein Bioinformatics
Tutorial for Windows and Macintosh. Trimming Sequence Gene Codes Corporation
Tutorial for Windows and Macintosh Trimming Sequence 2007 Gene Codes Corporation Gene Codes Corporation 775 Technology Drive, Ann Arbor, MI 48108 USA 1.800.497.4939 (USA) +1.734.769.7249 (elsewhere) +1.734.769.7074
Nature Neuroscience: doi: /nn Supplementary Figure 1. Comparisons of GFP-expressing HVC Av, HVC RA and HVC X cell bodies.
Supplementary Figure 1 Comparisons of GFP-expressing HVC Av, HVC RA and HVC X cell bodies. a) Soma diameter measured at the long axis of the cell body for HVC Av (green), HVC RA (red), and HVC X (blue)
LIMS User Guide 1. Content
LIMS User Guide 1. Content 1. Content... 1 1. Introduction... 2 2. Get a user account... 2 3. Invoice Address... 2 Create a new invoice address... 2 4. Create Project Request... 4 Request tab... 5 Invoice
Gribskov Profile. Hidden Markov Models. Building a Hidden Markov Model #$ %&
Gribskov Profile #$ %& Hidden Markov Models Building a Hidden Markov Model "! Proteins, DNA and other genomic features can be classified into families of related sequences and structures How to detect
TruSight HLA Assign 2.1 RUO Software Guide
TruSight HLA Assign 2.1 RUO Software Guide For Research Use Only. Not for use in diagnostic procedures. Introduction 3 Computing Requirements and Compatibility 4 Installation 5 Getting Started 6 Navigating
A tree-structured index algorithm for Expressed Sequence Tags clustering
A tree-structured index algorithm for Expressed Sequence Tags clustering Benjamin Kumwenda 0408046X Supervisor: Professor Scott Hazelhurst April 21, 2008 Declaration I declare that this dissertation is
CATTTTTAGCTCCTTACTTATTTGTATAGTTCATCC GGATGAACTATACAAATAAGTAAGGAGCTAAAAATG GCATATACTGCAGAAACGCTGCTACTATACG
Supplementary Table 1: Bacterial strains and plasmids E.coli strains Relevant genotype Ref. BW25113 Wild type (pir-) Baba et al (2006) BW25141 Wild type (pir+) Datsenko and Wanner (2000) Keio:cydb BW25113
Manual. Model#-DB25M-3R6A. 6 Axis CNC Interface Breakout Board. Lastest update : Feb Store this manual away for further reference.
Manual 6 Axis CNC Interface Breakout Board Model#-DB25M-3R6A Lastest update : Feb 2016 Read this manual carefully before making connections to the board. Store this manual away for further reference. Safety
1. Introduction Supported data formats/arrays Aligned BAM files How to load and open files Affymetrix files...
How to import data 1. Introduction... 2 2. Supported data formats/arrays... 2 3. Aligned BAM files... 3 4. How to load and open files... 3 5. Affymetrix files... 4 5.1 Affymetrix CEL files (.cel)... 4
Epigenetic regulation of the nuclear-coded GCAT and SHMT2 genes confers
Supplementary Information for Epigenetic regulation of the nuclear-coded GCAT and SHMT2 genes confers human age-associated mitochondrial respiration defects Osamu Hashizume, Sakiko Ohnishi, Takayuki Mito,
Intelligent Motion Controller for VME Bus Computers
VS4 ISO 9001 CERTIFIED Intelligent Motion Controller for VME Bus Computers VS4 FEATURES Controller capability! Up to four axes of stepper control with encoder feedback Communications! VME bus! Interrupt
Re-dock of Roscovitine Against Human Cyclin-Dependent Kinase 2 with Molegro Virtual Docker
Tutorial Re-dock of Roscovitine Against Human Cyclin-Dependent Kinase 2 with Molegro Virtual Docker Prof. Dr. Walter Filgueira de Azevedo Jr. walter@azevedolab.net azevedolab.net 1 Introduction In this
Categorized software tools: (this page is being updated and links will be restored ASAP. Click on one of the menu links for more information)
Categorized software tools: (this page is being updated and links will be restored ASAP. Click on one of the menu links for more information) 1 / 5 For array design, fabrication and maintaining a database
PLEASE SCROLL DOWN FOR ARTICLE
This article was downloaded by: [Lee, Gi-Dong] On: 1 April 2009 Access details: Access Details: [subscription number 909871315] Publisher Taylor & Francis Informa Ltd Registered in England and Wales Registered
nature methods Automated monitoring and analysis of social behavior in Drosophila
nature methods Automated monitoring and analysis of social behavior in Drosophila Heiko Dankert, Liming Wang, Eric D Hoopfer, David J Anderson & Pietro Perona Supplementary figures and text: Supplementary
Supporting Information
Supporting Information Chameleon-Inspired Mechanochromic Photonic Films Composed of Nonclose-Packed Colloidal Arrays Gun Ho Lee, Tae Min Choi, Bomi Kim, Sang Hoon Han, Jung Min Lee, and Shin-Hyun Kim *,
Olink Wizard for GenEx
Olink Wizard for GenEx USER GUIDE Version 1.1 (Feb 2014) TECHNICAL SUPPORT For support and technical information, please contact support@multid.se, or join the GenEx online forum: www.multid.se/forum.php.
A Single Poly Flash Memory Intellectual Property for Low-Cost, Low-Density Embedded Nonvolatile Memory Applications
Journal of the Korean Physical Society, Vol. 41, No. 6, December 2002, pp. 846 850 A Single Poly Flash Memory Intellectual Property for Low-Cost, Low-Density Embedded Nonvolatile Memory Applications Jai-Cheol
Motif Scan Results. hamap, pat, freq_pat, pre, prf, pfam_fs, pfam_ls.
Page 1 Motif Scan Results search help user: GUEST log in Tools Hub Results Stored results Private area Misc Deprecated width: 600 settings Query Protein temporarily stored here. HAMAP profiles [hamap],
Overview. Dataset: testpos DNA: CCCATGGTCGGGGGGGGGGAGTCCATAACCC Num exons: 2 strand: + RNA (from file): AUGGUCAGUCCAUAA peptide (from file): MVSP*
Overview In this homework, we will write a program that will print the peptide (a string of amino acids) from four pieces of information: A DNA sequence (a string). The strand the gene appears on (a string).
Science Sample Paper 4
Science Sample Paper 4 Paper: X Science SA II Sample Paper 2 Total marks of the paper: Total time of the paper: General Instructions: 90 3.5 hrs 1. The question paper comprises of two sections, A and B
Long Read RNA-seq Mapper
UNIVERSITY OF ZAGREB FACULTY OF ELECTRICAL ENGENEERING AND COMPUTING MASTER THESIS no. 1005 Long Read RNA-seq Mapper Josip Marić Zagreb, February 2015. Table of Contents 1. Introduction... 1 2. RNA Sequencing...
Thermo Scientific Samco Transfer Pipettes. Precisely what you need
Thermo Scientific Samco Transfer Pipettes Precisely what you need Yesterday, today Thermo Scientific Samco transfer pipettes have been the industry leaders for over 35 years Design Grips easily with latex
Bioinformatics. Sequence alignment BLAST Significance. Next time Protein Structure
Bioinformatics Sequence alignment BLAST Significance Next time Protein Structure 1 Experimental origins of sequence data The Sanger dideoxynucleotide method F Each color is one lane of an electrophoresis
Quick Tutorial. Running CellDesigner TM Simulation with ControlPanel
Running CellDesigner TM Simulation with ControlPanel Quick Tutorial 2005/09/01 The Systems Biology Institute http://www.systems-biology.org/ Mitsui Knowledge Industry Co. Ltd. http://bio.mki.co.jp/en/
360 KB FDU PANASONIC JU C09 SA450
360 KB FDU PANASIC JU-455-5 C09 SA450 3 JUMPER DESCRIPTI SETTING DS1 Drive selected as DRIVE 1 DS2 Drive selected as DRIVE 2 DS3 Drive selected as DRIVE 3 DS4 Drive selected as DRIVE 4 MX Drive selected
Thermo Scientific Samco Transfer Pipettes. Precisely what you need
Thermo Scientific Samco Transfer Pipettes Precisely what you need Application Guide LIFE SCIENCE APPLICATIONS INDUSTRIAL, RESEARCH AND TESTING CLINICAL APPLICATIONS Top 9 Pipettes: 6, 3, 5, 20, 23, 24,
Supplemental Data The Influence of Cell Mechanics, Cell-Cell Interactions, and Proliferation on Epithelial Packing
Supplemental Data The Influence of Cell Mechanics, Cell-Cell Interactions, and Proliferation on Epithelial Packing S1 Reza Farhadifar, Jens-Christian Röper, Benoit Aigouy, Suzanne Eaton, and Frank Jülicher
Guide to running KASP TM genotyping reactions on the Roche LC480-Series instruments
extraction sequencing genotyping extraction sequencing genotyping extraction sequencing genotyping extraction sequencing Guide to running KASP TM genotyping reactions on the Roche LC480-Series instruments
Exercise 2: Browser-Based Annotation and RNA-Seq Data
Exercise 2: Browser-Based Annotation and RNA-Seq Data Jeremy Buhler July 24, 2018 This exercise continues your introduction to practical issues in comparative annotation. You ll be annotating genomic sequence
Easy visualization of the read coverage using the CoverageView package
Easy visualization of the read coverage using the CoverageView package Ernesto Lowy European Bioinformatics Institute EMBL June 13, 2018 > options(width=40) > library(coverageview) 1 Introduction This
CEQ 8000 Series Fragment Analysis Training Guide
TM CEQ 8000 Series Fragment Analysis Training Guide PN A16039-AB September 2005 Beckman Coulter, Inc., 4300 N. Harbor Blvd., Fullerton, CA 92835 Copyright 2005 Beckman Coulter, Inc., Printed in U.S.A.
Byte Index Chunking Approach for Data Compression
Ider Lkhagvasuren 1, Jung Min So 1, Jeong Gun Lee 1, Chuck Yoo 2, Young Woong Ko 1 1 Dept. of Computer Engineering, Hallym University Chuncheon, Korea {Ider555, jso, jeonggun.lee, yuko}@hallym.ac.kr 2
UCSC Genome Browser Pittsburgh Workshop -- Practical Exercises
UCSC Genome Browser Pittsburgh Workshop -- Practical Exercises We will be using human assembly hg19. These problems will take you through a variety of resources at the UCSC Genome Browser. You will learn
Supplementary Information
Supplementary Information Supplementary Fig 1. Megalin endocytosis in subconfluent MDCK cells (a) Schematic representation of mmeg-ha endocytic assay. Subconfluent mmeg-mdck cells were labeled for the
ALGORITHMS AND ARCHITECTURES FOR REAL-TIME CONTROL
ALGORITHMS AND ARCHITECTURES FOR REAL-TIME CONTROL Preprints ofthe IFAC Workshop, Seoul, Korea, 31 August - 2 September 1992 Edited by PJ. FLEMING Department of Automatic Control and Systems Engineering,
Introduction to StatKey Getting Data Into StatKey
Introduction to StatKey 2016-17 03. Getting Data Into StatKey Introduction This handout assumes that you do not want to type in the data by hand. This handout shows you how to use Excel and cut and paste
Olink NPX Manager. User Guide
Olink NPX Manager User Guide Table of contents INTRODUCTION 3 Process 3 Limitations 3 Requirements for analysis 3 List of abbreviations 3 TO CREATE A HEAT MAP CT CSV FILE 4 OLINK NPX MANAGER STEP BY STEP
Tour Guide for Windows and Macintosh
Tour Guide for Windows and Macintosh 2011 Gene Codes Corporation Gene Codes Corporation 775 Technology Drive, Suite 100A, Ann Arbor, MI 48108 USA phone 1.800.497.4939 or 1.734.769.7249 (fax) 1.734.769.7074
KL ChineseJournalofPathophysiology 2013,29(2): [] (2013) !"#$%&',,, (!"#$%&' %, ) Rolesofmitochondrialdysfunction
![KL ChineseJournalofPathophysiology 2013,29(2): [] (2013) !#$%&',,, (!#$%&' %, ) Rolesofmitochondrialdysfunction](/thumbs/88/117807589.jpg "KL ChineseJournalofPathophysiology 2013,29(2): [] (2013) !#$%&',,, (!#$%&' %, ) Rolesofmitochondrialdysfunction")
364 @ KL ChineseJournalofPathophysiology 2013,29(2):364 370 [] 1000 4718(2013)02 0364 07!"#$%&',,, (!"#$%&' %, 510182) Rolesofmitochondrialdysfunctionincardiovasculardiseases XIONGYan,ZHANGMei,CHENFei,FANGWei
Universal Compact Extruded Cylinders
Universal Compact Extruded Cylinders Clippard s new Compact, Extruded Body Cylinders are available in double acting, double rod, single acting spring return, and single acting spring extended models. Universally
Genome Browsers - The UCSC Genome Browser
Genome Browsers - The UCSC Genome Browser Background The UCSC Genome Browser is a well-curated site that provides users with a view of gene or sequence information in genomic context for a specific species,
PyroMark Q24 Software User Guide
July 2009 PyroMark Q24 Software User Guide For use with the PyroMark Q24 Sample & Assay Technologies QIAGEN Sample and Assay Technologies QIAGEN is the leading provider of innovative sample and assay technologies,
Computational Molecular Biology
Computational Molecular Biology Erwin M. Bakker Lecture 3, mainly from material by R. Shamir [2] and H.J. Hoogeboom [4]. 1 Pairwise Sequence Alignment Biological Motivation Algorithmic Aspect Recursive
Determining gapped palindrome density in RNA using suffix arrays
Determining gapped palindrome density in RNA using suffix arrays Sjoerd J. Henstra Leiden Institute of Advanced Computer Science Leiden University, The Netherlands Abstract DNA and RNA strings contain
Laboratory for Two-Way ANOVA: Interactions
Laboratory for Two-Way ANOVA: Interactions For the last lab, we focused on the basics of the Two-Way ANOVA. That is, you learned how to compute a Brown-Forsythe analysis for a Two-Way ANOVA, as well as
Download and Register SnapGene 7. Generate an with a Download Link 10. Unregister the Computer You Are Using 12
SnapGene User Guide SnapGene User Guide 1 Licenses 1.1 1.2 1.3 1.4 1.5 1.6 1.7 1.8 Download and Register SnapGene 7 Generate an Email with a Download Link 10 Unregister the Computer You Are Using 12 Unregister
VersaMax IP I/O Module
Module accepts four digital input signals and provides four digital outputs. It connects to a local bus that is interfaced to a Profibus-DP / PROFINET network by a Profibus Interface Unit (IC677PBI001)
/ Computational Genomics. Normalization
10-810 /02-710 Computational Genomics Normalization Genes and Gene Expression Technology Display of Expression Information Yeast cell cycle expression Experiments (over time) baseline expression program
RNA Folding with Hard and Soft Constraints - Supplementary Material
RNA Folding with Hard and Soft Constraints - Supplementary Material Ronny Lorenz 1, Ivo L. Hofacker 1,2,3, and Peter F. Stadler 4,1,3,5,6,7 1 Institute for Theoretical Chemistry, University of Vienna,
How to use KAIKObase Version 3.1.0
How to use KAIKObase Version 3.1.0 Version3.1.0 29/Nov/2010 http://sgp2010.dna.affrc.go.jp/kaikobase/ Copyright National Institute of Agrobiological Sciences. All rights reserved. Outline 1. System overview
Introduction to Bioinformatics AS Laboratory Assignment 2
Introduction to Bioinformatics AS 250.265 Laboratory Assignment 2 Last week, we discussed several high-throughput methods for the analysis of gene expression in cells. Of those methods, microarray technologies
Drug Response and Genotype
: The Pharmacogenetics Knowledge Base Daniel L. Rubin, M.D., M.S. Stanford Medical Informatics Stanford University School of Medicine Drug Response and Genotype Patient responses to drugs are variable
Setup and Users Manual
\04_TSHARC-Octopus\UsersManual\OctopusRev1.6\04B_TSHARC_Octopus1.6Users040419.doc Setup and Users Manual TSHARC Octopus RS-232, PS/2, USB Touch Screen Controller Version 1.6 TSHARC Octopus Mechanical Specification
Supplementary Material VDJServer: A Cloud-Based Analysis Portal and Data Commons for Immune Repertoire Sequences and Rearrangements
Supplementary Material VDJServer: A Cloud-Based Analysis Portal and Data Commons for Immune Repertoire Sequences and Rearrangements Scott Christley, Walter Scarborough, Eddie Salinas, William H. Rounds,
SHARPR (Systematic High-resolution Activation and Repression Profiling with Reporter-tiling) User Manual (v1.0.2)
SHARPR (Systematic High-resolution Activation and Repression Profiling with Reporter-tiling) User Manual (v1.0.2) Overview Email any questions to Jason Ernst (jason.ernst@ucla.edu) SHARPR is software for
Impact of Mobility on Concurrent Transactions Mixture
Impact of Mobility on Concurrent Transactions Mixture Ahmad Alqerem Abstract This paper presents a simulation analysis of the impact of mobility on concurrent transaction processing over a mixture of mobile
QNet: A Tool for Querying Protein Interaction Networks
QNet: A Tool for Querying Protein Interaction Networks Banu Dost 1,, Tomer Shlomi 2,, Nitin Gupta 1, Eytan Ruppin 2,3, Vineet Bafna 1, and Roded Sharan 2 1 Computer Science and Engineering, Univ. of California,
Towards a Weighted-Tree Similarity Algorithm for RNA Secondary Structure Comparison
Towards a Weighted-Tree Similarity Algorithm for RNA Secondary Structure Comparison Jing Jin, Biplab K. Sarker, Virendra C. Bhavsar, Harold Boley 2, Lu Yang Faculty of Computer Science, University of New
Today s Lecture. Multiple sequence alignment. Improved scoring of pairwise alignments. Affine gap penalties Profiles
Today s Lecture Multiple sequence alignment Improved scoring of pairwise alignments Affine gap penalties Profiles 1 The Edit Graph for a Pair of Sequences G A C G T T G A A T G A C C C A C A T G A C G
TL6 Ultra Micro-volume Spectrophotometer
TL6 Ultra Micro-volume Spectrophotometer TL6 is the latest Ultra Micro-volume Spectrophotometer of PERSEE ANALYTICS. It is a small portable instrument for fast analysis of nucleic acid and protein concentrations
LIGHTWEIGHT DESIGN OF SEAT CUSHION EXTENSION MODULES USING THE PROPERTIES OF PLASTIC AND HCA-SIMP
International Journal of Mechanical Engineering and Technology (IJMET) Volume 9, Issue 5, May 2018, pp. 624 632, Article ID: IJMET_09_05_068 Available online at http://www.iaeme.com/ijmet/issues.asp?jtype=ijmet&vtype=9&itype=5
Managing Your Biological Data with Python
Chapman & Hall/CRC Mathematical and Computational Biology Series Managing Your Biological Data with Python Ailegra Via Kristian Rother Anna Tramontano CRC Press Taylor & Francis Group Boca Raton London
Topics of the talk. Biodatabases. Data types. Some sequence terminology...
Topics of the talk Biodatabases Jarno Tuimala / Eija Korpelainen CSC What data are stored in biological databases? What constitutes a good database? Nucleic acid sequence databases Amino acid sequence
Light Sheet Fluorescence Microscopy by Carl Zeiss. Chris Power 3D Imaging Specialist Dublin Workshop 25/11/2013
Light Sheet Fluorescence Microscopy by Carl Zeiss Chris Power 3D Imaging Specialist Dublin Workshop 25/11/2013 Agenda 1. Requirements and challenges of live cell imaging 2. Light sheet fluorescence microscopy
GUTI Reallocation Demystified: Cellular Location Tracking with Changing Temporary Identifier
SysSec System Security Lab. GUTI Reallocation Demystified: Cellular Location Tracking with Changing Temporary Identifier Byeongdo Hong, Sangwook Bae, Yongdae Kim KAIST SysSec Feb. 19, 2018 Paging Area
A Robust Bloom Filter
A Robust Bloom Filter Yoon-Hwa Choi Department of Computer Engineering, Hongik University, Seoul, Korea. Orcid: 0000-0003-4585-2875 Abstract A Bloom filter is a space-efficient randomized data structure
Analysis of (cdna) Microarray Data: Part I. Sources of Bias and Normalisation
Analysis of (cdna) Microarray Data: Part I. Sources of Bias and Normalisation MICROARRAY ANALYSIS My (Educated?) View 1. Data included in GEXEX a. Whole data stored and securely available b. GP3xCLI on