Multiple Sequence Alignments

Transcription

1 Multiple Sequence Alignments

2 Pair-wise Alignments Blast and FASTA first find small high-scoring alignments to build words which are used as a starting points for alignments Blast words default size is 3 for proteins and 11 for nucleotides GATGAGTATGCTCGTACCTGTAATGTAGTGTATAGTACATGCA GAAGACTATGCTCGTACCTCTAATGTAG TACATGCA GTACATGCA G TA CATGCA Affine gaps

3 Progressive Multiple Sequence Alignment 1. First pairwise alignments of each sequence are made to form a guide tree 2. Guide tree is used to progressively add sequences to the alignment beginning with the most closely related and continuing until the most distant A B C D E F G 1. A with B ---> alignment AB 2. C with D ---> alignment CD 3. AB with CD ---> alignment ABCD 4. ABCD with E---> ABCDE 5. ABCDE with F ---> ABCDEF 6. ABCDEF with G ---> ABCDEFG Pros: Cons: Relatively fast Alignment errors early in the progression will be carried throughout the entire process Instant Notes Bioinformatics

4 ClustalW ClustalW is a Multiple Sequence Alignment (MSA) program for DNA or protein sequences. It produces biologically meaningful multiple sequence alignments of divergent sequences. You need to create gulo_aa.fa using these NP_ accessions saved in a file and run your script from last week. NP_ NP_ NP_ NP_ sudo apt get install clustalw phylip clustalw infile=gulo_aa.fa type=protein clustalw infile=gulo_aa.aln tree output=phylip # look at the.ph file, this is a standard text format used for a phylogenetic tree # now use phylip to draw an diagram of your phylogenetic tree phylip drawgram enter gulo_aa.ph when prompted. S to change tree style phylip retree

5 Create a single Perl script to create a Phylogenetic Tree 1. Read in a file that is a single column of NCBI accessions. 2. Use BioPerl to create a file of FASTA formatted sequences for the accessions 3. Use PRANK to perform a multiple alignment of the sequences in the file from step Use R to create a.jpg image of the phylogenetic tree of your sequence alignment. Perl pipeline script BioPerl PRANK R accessions_file seqs.fa alignment.dnd.jpg image

6 PRANK Prank is a multiple sequence alignment application that first performs pairwise alignments of each sequence to form a multiple alignment. Then it generates a new guide tree based on this first alignment and makes a second, more improved alignment Search the web for prank alignment download, unzip and install sudo apt get install g++ tar xzf prank.src tgz cd prank sudo make sudo cp prank /usr/local/bin prank gulo_aa.fa #install g++ compiler #copy prank to UNIX path #command to run prank First Alignment Output Files: output.1.dnd output.1.fas output.1.xml file for constructing graphical tree fasta format of the alignment xml format of the alignment Second Improved Alignment output.2.dnd file for constructing graphical tree * output.2.fas fasta format of the second alignment output.2.xml xml format of the second alignment * use this file for generating tree image

7 View and Save your alignment using R First install the ape package from the R command prompt: sudo R install.packages("ape") q() #start R from UNIX terminal #only needs to be done once in R #quit R and open gedit library(ape) my_tree < read.tree("output.2.dnd") jpeg("gulo_tree.jpg") plot(my_tree) dev.off() Save these commands to a text file and quit gedit: commands_file.r U N I X R save < commands_file.r eog gulo_tree.jpg #input commands_file.r into R #view image from UNIX command line

8 Using only one Perl script, create a 'pipeline' script to generate a phylogenetic tree of related sequences and save as a jpg image. Pseudocode: 1. use BioPerl to get FASTA formatted sequences * get hominids D-Loop accessions file dloop_accessions.txt * use the dloop_accessions.txt file name as an argument * save sequences to a file in FASTA format: dloop_accessions.fa 2. use PRANK to create an alignment of your sequences from your FASTA file 3. use R to create a phylogenetic tree image of your PRANK alignment * save your image using the file name of your accessions list dloop_accessions.jpg * this means you will need to use Perl to write all the R commands to a file. * hints: Perl Pipeline Script Assignment print R_FILE "jpeg(\"image.jpg\")\n"; #backslash \" to print " `R save < commands_file.r`; #use backticks ` to run a UNIX commands within a Perl script

9 dloop_accessions.list dloop_accessions.jpg AF AF Perl Pipeline Script write BioPerl PRANK a file R dloop_seqs.fa >L-gulono.. CTGTATG TAGACGT output.2.dnd ( A1: , A2: ) commands_file.r library(ape) my_tree <- read attach(my_tree)