Minimal Memory Abstractions
|
|
- Raymond Thompson
- 5 years ago
- Views:
Transcription
1 Miniml Memory Astrtions (As implemented for BioWre Corp ) Nthn Sturtevnt University of Alert GAMES Group Ferury, 7 Tlk Overview Prt I: Building Astrtions Minimizing memory requirements Performnes mesures Prt II: BioWre Corp Implementtion Experiene
2 Bkground Stte-spe strtions hve ommonly een used to speed serh Pttern Dtses for heuristis Grph strtions for pthfinding PRA*, HPA*, et Motivtion Gmes hve tight memory udgets ~4MB totl memory 4x4 or lrger mps MB per yte per grid ell Cn we use uild n strtion whih minimizes memory usge? 4
3 Assumptions Grid world No true -d movement Cells n e loked/free/weighted My e height differene etween ells Units n move ross rel-vlued spe 5 Setors / Regions Divide world into lrge setors Fixed size Index impliitly Divide setors into regions Regions entirely onneted Regions hve enter point 6
4 Setors / Regions Divide world into lrge setors Fixed size Index impliitly Divide setors into regions Regions entirely onneted Regions hve enter point 6 Setors / Regions Divide world into lrge setors Fixed size Index impliitly Divide setors into regions Regions entirely onneted Regions hve enter point 6
5 Edges Look t orders of regions to determine edges 7 Edges Look t orders of regions to determine edges 7
6 Edges Look t orders of regions to determine edges 7 Edges Look t orders of regions to determine edges 7
7 Edges Look t orders of regions to determine edges 7 Edges Look t orders of regions to determine edges 7
8 Astrt Grph Originl Mp: x = 4 ells Astrt Grph: 9 nodes edges 8 its per setor Cn use less its Memory Usge 8 its per edge its - diretion 5 its - region Skip some regions Edges duplited 6 its 6 its per region Setor Dt # Regions Exmple Memory Address unused - Region Dt enter # edges enter # edges Exmple left: upleft: up: up: up: vrile-sized edge storge 9
9 Find Setor/Region Begin with x/y lotion in rel world Must find setor/region If setor only hs region, done Otherwise do BFS to find region enter Cn do reverse A* serh from region enters Avoids pointers! Usge () Find setor/region for strts nd gols Use A* to find omplete strt pth Now we must use the strt pth to guide the serh for n tul pth
10 Usge () Mny different methods for using strt pth Simplest method: Find pth from strt to first region Compute pth to suessive regions Find pth from lst region to gol Usge Exmple Find strt prents Find strt pth Find rel pth
11 Usge Exmple Find strt prents Find strt pth Find rel pth Usge Exmple Find strt prents Find strt pth Find rel pth
12 Usge Exmple Find strt prents Find strt pth Find rel pth Usge Exmple Find strt prents Find strt pth Find rel pth
13 Usge Exmple Find strt prents Find strt pth Find rel pth Totl Pthfinding Cost Astrt plnning ost + Refinement Refinement ost depends on ostles nd totl pth length Astrt plnning ost depends on setor size For fixed pth length, the totl work should depend only on setor size 4
14 Optimizing Region Centers How to determine the region enters? Some lotions re muh etter thn others 5 Optimizing Region Centers 6
15 Optimizing Region Centers 7 Optimizing Region Centers Consider eh region independently Mesure the A* ost to pth etween region nd ll neighors Choose the region enter whih minimizes the mximum ost 8
16 Pthfinding Optimiztion Refinement t strt/ gol n e ineffiient Trimming helps S G Skip to next node t strt/gol 9 Pthfinding Optimiztion Refinement t strt/ gol n e ineffiient Trimming helps S G Skip to next node t strt/gol 9
17 Pthfinding Optimiztion Refinement t strt/ gol n e ineffiient Trimming helps S G Skip to next node t strt/gol 9 Pthfinding Optimiztion Refinement t strt/ gol n e ineffiient Trimming helps S G Skip to next node t strt/gol 9
18 Pthfinding Optimiztion Refinement t strt/ gol n e ineffiient Trimming helps S G Skip to next node t strt/gol 9 Experimentl Results 9, pths over mps Mps sled to 5x5 Pths in 8 ukets length 5 Mesure: Totl ost Inrementl ost
19 Memory Usge How does the memory usge sle with setor size? How muh memory n e sved with simple ompression? Don t store defult regions region, 8 neighors Memory Usge Mps Size 5x5 Totl Memory (KB) Setor Size
20 Dynmi Region Centers Is there gin to dynmilly optimizing region enters? Mesure 95% work done in one-step pth refinement Dynmi Centers Dynmi v. Stti Centers (-Step Plnning) 5 Stti (95th perentile) Dynmi (95th perentile) Nodes Expnded Setor Size 4
21 Optimlity Pths will not e optiml Speil ses for strt/gol help lot Smoothing will e pplied s postproessing step (not mesured) 5 Optimlity Optimlity 5 95% Averge 5% % Suoptiml Setor Size 6
22 Totl Work Sum of work needed: Find prents Find strt pth Refine low-level pth Compre to A* 7 Totl Work Totl Nodes Expnded 5 Setor Size Setor Size Buket (Pth Length/4) 8
23 Totl Work v. A* Svings Over A* Totl Nodes Expnded Mx (A*) Averge (A*) Mx (MM) Averge (MM) Minimum Buket (Pth Length/4) 9 Drgon Age BioWre Corp Due Winter 7/8
24 Drgon Age BioWre Corp Due Winter 7/8 Implementtion weeks: Implement strtion Implement pthfinding Initil testing Met pthfinding requirements
25 Oservtions Cnnot e n expert in one thing Get it good enough Both more nd less rigorous testing thn expeted Gret people Future Continuing work: Smoothing Pleles 4
26 More Info Thnks 6
Solving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence Winter 2016
Solving Prolems y Serching CS 486/686: Introduction to Artificil Intelligence Winter 2016 1 Introduction Serch ws one of the first topics studied in AI - Newell nd Simon (1961) Generl Prolem Solver Centrl
More informationSolving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence
Solving Prolems y Serching CS 486/686: Introduction to Artificil Intelligence 1 Introduction Serch ws one of the first topics studied in AI - Newell nd Simon (1961) Generl Prolem Solver Centrl component
More informationInternet Routing. IP Packet Format. IP Fragmentation & Reassembly. Principles of Internet Routing. Computer Networks 9/29/2014.
omputer Networks 9/29/2014 IP Pket Formt Internet Routing Ki Shen IP protool version numer heder length (words) for qulity of servie mx numer remining hops (deremented t eh router) upper lyer protool to
More informationCSEP 573 Artificial Intelligence Winter 2016
CSEP 573 Artificil Intelligence Winter 2016 Luke Zettlemoyer Problem Spces nd Serch slides from Dn Klein, Sturt Russell, Andrew Moore, Dn Weld, Pieter Abbeel, Ali Frhdi Outline Agents tht Pln Ahed Serch
More informationToday. CS 188: Artificial Intelligence Fall Recap: Search. Example: Pancake Problem. Example: Pancake Problem. General Tree Search.
CS 88: Artificil Intelligence Fll 00 Lecture : A* Serch 9//00 A* Serch rph Serch Tody Heuristic Design Dn Klein UC Berkeley Multiple slides from Sturt Russell or Andrew Moore Recp: Serch Exmple: Pncke
More informationGreedy Algorithm. Algorithm Fall Semester
Greey Algorithm Algorithm 0 Fll Semester Optimiztion prolems An optimiztion prolem is one in whih you wnt to fin, not just solution, ut the est solution A greey lgorithm sometimes works well for optimiztion
More informationV = set of vertices (vertex / node) E = set of edges (v, w) (v, w in V)
Definitions G = (V, E) V = set of verties (vertex / noe) E = set of eges (v, w) (v, w in V) (v, w) orere => irete grph (igrph) (v, w) non-orere => unirete grph igrph: w is jent to v if there is n ege from
More informationA Sparse Grid Representation for Dynamic Three-Dimensional Worlds
A Sprse Grid Representtion for Dynmic Three-Dimensionl Worlds Nthn R. Sturtevnt Deprtment of Computer Science University of Denver Denver, CO, 80208 sturtevnt@cs.du.edu Astrct Grid representtions offer
More informationDistributed Systems Principles and Paradigms
Distriuted Systems Priniples nd Prdigms Christoph Dorn Distriuted Systems Group, Vienn University of Tehnology.dorn@infosys.tuwien..t http://www.infosys.tuwien..t/stff/dorn Slides dpted from Mrten vn Steen,
More informationA Comparison of High-Level Approaches for Speeding Up Pathfinding
A Comprison of High-Level Approches for Speeding Up Pthfinding Nthn R. Sturtevnt Deprtment of Computing Science University of Alert Edmonton, Alert, Cnd nthnst@cs.ulert.c Roert Geiserger Fculty of Informtics
More informationOutline. Motivation Background ARCH. Experiment Additional usages for Input-Depth. Regular Expression Matching DPI over Compressed HTTP
ARCH This work ws supported y: The Europen Reserh Counil, The Isreli Centers of Reserh Exellene, The Neptune Consortium, nd Ntionl Siene Foundtion wrd CNS-119748 Outline Motivtion Bkground Regulr Expression
More informationAnnouncements. CS 188: Artificial Intelligence Fall Recap: Search. Today. General Tree Search. Uniform Cost. Lecture 3: A* Search 9/4/2007
CS 88: Artificil Intelligence Fll 2007 Lecture : A* Serch 9/4/2007 Dn Klein UC Berkeley Mny slides over the course dpted from either Sturt Russell or Andrew Moore Announcements Sections: New section 06:
More informationDistributed Systems Principles and Paradigms. Chapter 11: Distributed File Systems
Distriuted Systems Priniples nd Prdigms Mrten vn Steen VU Amsterdm, Dept. Computer Siene steen@s.vu.nl Chpter 11: Distriuted File Systems Version: Deemer 10, 2012 2 / 14 Distriuted File Systems Distriuted
More informationMa/CS 6b Class 1: Graph Recap
M/CS 6 Clss 1: Grph Recp By Adm Sheffer Course Detils Adm Sheffer. Office hour: Tuesdys 4pm. dmsh@cltech.edu TA: Victor Kstkin. Office hour: Tuesdys 7pm. 1:00 Mondy, Wednesdy, nd Fridy. http://www.mth.cltech.edu/~2014-15/2term/m006/
More informationCorrecting the Dynamic Call Graph Using Control Flow Constraints
Correting the Dynmi Cll Grph Using Control Flow Constrints Byeongheol Lee Kevin Resnik Mihel Bond Kthryn MKinley 1 Appered in CC2007 Motivtion Complexity of lrge objet oriented progrms Deompose the progrm
More informationCS553 Lecture Introduction to Data-flow Analysis 1
! Ide Introdution to Dt-flow nlysis!lst Time! Implementing Mrk nd Sweep GC!Tody! Control flow grphs! Liveness nlysis! Register llotion CS553 Leture Introdution to Dt-flow Anlysis 1 Dt-flow Anlysis! Dt-flow
More informationAnnouncements. CS 188: Artificial Intelligence Fall Recap: Search. Today. Example: Pancake Problem. Example: Pancake Problem
Announcements Project : erch It s live! Due 9/. trt erly nd sk questions. It s longer thn most! Need prtner? Come up fter clss or try Pizz ections: cn go to ny, ut hve priority in your own C 88: Artificil
More informationInter-domain Routing
COMP 631: NETWORKED & DISTRIBUTED SYSTEMS Inter-domin Routing Jsleen Kur Fll 2016 1 Internet-sle Routing: Approhes DV nd link-stte protools do not sle to glol Internet How to mke routing slle? Exploit
More informationMa/CS 6b Class 1: Graph Recap
M/CS 6 Clss 1: Grph Recp By Adm Sheffer Course Detils Instructor: Adm Sheffer. TA: Cosmin Pohot. 1pm Mondys, Wednesdys, nd Fridys. http://mth.cltech.edu/~2015-16/2term/m006/ Min ook: Introduction to Grph
More informationCS 221: Artificial Intelligence Fall 2011
CS 221: Artificil Intelligence Fll 2011 Lecture 2: Serch (Slides from Dn Klein, with help from Sturt Russell, Andrew Moore, Teg Grenger, Peter Norvig) Problem types! Fully observble, deterministic! single-belief-stte
More informationLecture 8: Graph-theoretic problems (again)
COMP36111: Advned Algorithms I Leture 8: Grph-theoreti prolems (gin) In Prtt-Hrtmnn Room KB2.38: emil: iprtt@s.mn..uk 2017 18 Reding for this leture: Sipser: Chpter 7. A grph is pir G = (V, E), where V
More informationLecture 13: Graphs I: Breadth First Search
Leture 13 Grphs I: BFS 6.006 Fll 2011 Leture 13: Grphs I: Bredth First Serh Leture Overview Applitions of Grph Serh Grph Representtions Bredth-First Serh Rell: Grph G = (V, E) V = set of verties (ritrry
More informationToday. Search Problems. Uninformed Search Methods. Depth-First Search Breadth-First Search Uniform-Cost Search
Uninformed Serch [These slides were creted by Dn Klein nd Pieter Abbeel for CS188 Intro to AI t UC Berkeley. All CS188 mterils re vilble t http://i.berkeley.edu.] Tody Serch Problems Uninformed Serch Methods
More informationDistance vector protocol
istne vetor protool Irene Finohi finohi@i.unirom.it Routing Routing protool Gol: etermine goo pth (sequene of routers) thru network from soure to Grph strtion for routing lgorithms: grph noes re routers
More informationChapter 9. Greedy Technique. Copyright 2007 Pearson Addison-Wesley. All rights reserved.
Chpter 9 Greey Tehnique Copyright 2007 Person Aison-Wesley. All rights reserve. Greey Tehnique Construts solution to n optimiztion prolem piee y piee through sequene of hoies tht re: fesile lolly optiml
More informationCS453 INTRODUCTION TO DATAFLOW ANALYSIS
CS453 INTRODUCTION TO DATAFLOW ANALYSIS CS453 Leture Register llotion using liveness nlysis 1 Introdution to Dt-flow nlysis Lst Time Register llotion for expression trees nd lol nd prm vrs Tody Register
More informationCSCI 446: Artificial Intelligence
CSCI 446: Artificil Intelligence Serch Instructor: Michele Vn Dyne [These slides were creted by Dn Klein nd Pieter Abbeel for CS188 Intro to AI t UC Berkeley. All CS188 mterils re vilble t http://i.berkeley.edu.]
More informationAI Adjacent Fields. This slide deck courtesy of Dan Klein at UC Berkeley
AI Adjcent Fields Philosophy: Logic, methods of resoning Mind s physicl system Foundtions of lerning, lnguge, rtionlity Mthemtics Forml representtion nd proof Algorithms, computtion, (un)decidility, (in)trctility
More informationTitle. How FIFO is Your Concurrent FIFO Queue? Andreas Haas, Christoph M. Kirsch, Michael Lippautz, Hannes Payer. RACES Workshop, October 2012
Title How FIFO is Your Concurrent FIFO Queue? Andres Hs, Christoph M. Kirsch, Michel Lipputz, Hnnes Pyer University of Slzurg RACES Workshop, Octoer 2012 1/17 Strict vs. Relxed FIFO Queues strict FIFO
More informationLecture 10 Evolutionary Computation: Evolution strategies and genetic programming
Lecture 10 Evolutionry Computtion: Evolution strtegies nd genetic progrmming Evolution strtegies Genetic progrmming Summry Negnevitsky, Person Eduction, 2011 1 Evolution Strtegies Another pproch to simulting
More informationCS 241 Week 4 Tutorial Solutions
CS 4 Week 4 Tutoril Solutions Writing n Assemler, Prt & Regulr Lnguges Prt Winter 8 Assemling instrutions utomtilly. slt $d, $s, $t. Solution: $d, $s, nd $t ll fit in -it signed integers sine they re 5-it
More informationLesson6: Modeling the Web as a graph Unit5: Linear Algebra for graphs
Lesson6: Modeling the We s grph Unit5: Liner Alger for grphs Rene Pikhrdt Introdution to We Siene Prt 2 Emerging We Properties Rene Pikhrdt Institute CC-BY-SA-3. for We Siene nd Tehnologies Modeling the
More informationAllocator Basics. Dynamic Memory Allocation in the Heap (malloc and free) Allocator Goals: malloc/free. Internal Fragmentation
Alloctor Bsics Dynmic Memory Alloction in the Hep (mlloc nd free) Pges too corse-grined for llocting individul objects. Insted: flexible-sized, word-ligned blocks. Allocted block (4 words) Free block (3
More informationCompression Outline :Algorithms in the Real World. Lempel-Ziv Algorithms. LZ77: Sliding Window Lempel-Ziv
Compression Outline 15-853:Algorithms in the Rel World Dt Compression III Introduction: Lossy vs. Lossless, Benchmrks, Informtion Theory: Entropy, etc. Proility Coding: Huffmn + Arithmetic Coding Applictions
More informationThe Distributed Data Access Schemes in Lambda Grid Networks
The Distributed Dt Access Schemes in Lmbd Grid Networks Ryot Usui, Hiroyuki Miygi, Yutk Arkw, Storu Okmoto, nd Noki Ymnk Grdute School of Science for Open nd Environmentl Systems, Keio University, Jpn
More informationCS321 Languages and Compiler Design I. Winter 2012 Lecture 5
CS321 Lnguges nd Compiler Design I Winter 2012 Lecture 5 1 FINITE AUTOMATA A non-deterministic finite utomton (NFA) consists of: An input lphet Σ, e.g. Σ =,. A set of sttes S, e.g. S = {1, 3, 5, 7, 11,
More informationIn the last lecture, we discussed how valid tokens may be specified by regular expressions.
LECTURE 5 Scnning SYNTAX ANALYSIS We know from our previous lectures tht the process of verifying the syntx of the progrm is performed in two stges: Scnning: Identifying nd verifying tokens in progrm.
More informationLesson 4.4. Euler Circuits and Paths. Explore This
Lesson 4.4 Euler Ciruits nd Pths Now tht you re fmilir with some of the onepts of grphs nd the wy grphs onvey onnetions nd reltionships, it s time to egin exploring how they n e used to model mny different
More informationParallelization Optimization of System-Level Specification
Prlleliztion Optimiztion of System-Level Speifition Luki i niel. Gjski enter for Emedded omputer Systems University of liforni Irvine, 92697, US {li, gjski} @es.ui.edu strt This pper introdues the prlleliztion
More informationCOSC 6374 Parallel Computation. Communication Performance Modeling (II) Edgar Gabriel Fall Overview. Impact of communication costs on Speedup
COSC 6374 Prllel Computtion Communition Performne Modeling (II) Edgr Griel Fll 2015 Overview Impt of ommunition osts on Speedup Crtesin stenil ommunition All-to-ll ommunition Impt of olletive ommunition
More informationPattern Matching. Pattern Matching. Pattern Matching. Review of Regular Expressions
Pttern Mthing Pttern Mthing Some of these leture slides hve een dpted from: lgorithms in C, Roert Sedgewik. Gol. Generlize string serhing to inompletely speified ptterns. pplitions. Test if string or its
More informationCOSC 6374 Parallel Computation. Non-blocking Collective Operations. Edgar Gabriel Fall Overview
COSC 6374 Prllel Computtion Non-loking Colletive Opertions Edgr Griel Fll 2014 Overview Impt of olletive ommunition opertions Impt of ommunition osts on Speedup Crtesin stenil ommunition All-to-ll ommunition
More informationCOSC 6374 Parallel Computation. Dense Matrix Operations
COSC 6374 Prllel Computtion Dense Mtrix Opertions Edgr Griel Fll Edgr Griel Prllel Computtion Edgr Griel erminology Dense Mtrix: ll elements of the mtrix ontin relevnt vlues ypilly stored s 2-D rry, (e.g.
More informationWhat are suffix trees?
Suffix Trees 1 Wht re suffix trees? Allow lgorithm designers to store very lrge mount of informtion out strings while still keeping within liner spce Allow users to serch for new strings in the originl
More informationIf you are at the university, either physically or via the VPN, you can download the chapters of this book as PDFs.
Lecture 5 Wlks, Trils, Pths nd Connectedness Reding: Some of the mteril in this lecture comes from Section 1.2 of Dieter Jungnickel (2008), Grphs, Networks nd Algorithms, 3rd edition, which is ville online
More informationCS311H: Discrete Mathematics. Graph Theory IV. A Non-planar Graph. Regions of a Planar Graph. Euler s Formula. Instructor: Işıl Dillig
CS311H: Discrete Mthemtics Grph Theory IV Instructor: Işıl Dillig Instructor: Işıl Dillig, CS311H: Discrete Mthemtics Grph Theory IV 1/25 A Non-plnr Grph Regions of Plnr Grph The plnr representtion of
More informationDuality in linear interval equations
Aville online t http://ijim.sriu..ir Int. J. Industril Mthemtis Vol. 1, No. 1 (2009) 41-45 Dulity in liner intervl equtions M. Movhedin, S. Slhshour, S. Hji Ghsemi, S. Khezerloo, M. Khezerloo, S. M. Khorsny
More informationBefore We Begin. Introduction to Spatial Domain Filtering. Introduction to Digital Image Processing. Overview (1): Administrative Details (1):
Overview (): Before We Begin Administrtive detils Review some questions to consider Winter 2006 Imge Enhncement in the Sptil Domin: Bsics of Sptil Filtering, Smoothing Sptil Filters, Order Sttistics Filters
More informationParadigm 5. Data Structure. Suffix trees. What is a suffix tree? Suffix tree. Simple applications. Simple applications. Algorithms
Prdigm. Dt Struture Known exmples: link tble, hep, Our leture: suffix tree Will involve mortize method tht will be stressed shortly in this ourse Suffix trees Wht is suffix tree? Simple pplitions History
More informationLexical Analysis: Constructing a Scanner from Regular Expressions
Lexicl Anlysis: Constructing Scnner from Regulr Expressions Gol Show how to construct FA to recognize ny RE This Lecture Convert RE to n nondeterministic finite utomton (NFA) Use Thompson s construction
More informationAlgorithm Design (5) Text Search
Algorithm Design (5) Text Serch Tkshi Chikym School of Engineering The University of Tokyo Text Serch Find sustring tht mtches the given key string in text dt of lrge mount Key string: chr x[m] Text Dt:
More information10.2 Graph Terminology and Special Types of Graphs
10.2 Grph Terminology n Speil Types of Grphs Definition 1. Two verties u n v in n unirete grph G re lle jent (or neighors) in G iff u n v re enpoints of n ege e of G. Suh n ege e is lle inient with the
More informationITEC2620 Introduction to Data Structures
ITEC0 Introduction to Dt Structures Lecture 7 Queues, Priority Queues Queues I A queue is First-In, First-Out = FIFO uffer e.g. line-ups People enter from the ck of the line People re served (exit) from
More informationImplementing Automata. CSc 453. Compilers and Systems Software. 4 : Lexical Analysis II. Department of Computer Science University of Arizona
Implementing utomt Sc 5 ompilers nd Systems Softwre : Lexicl nlysis II Deprtment of omputer Science University of rizon collerg@gmil.com opyright c 009 hristin ollerg NFs nd DFs cn e hrd-coded using this
More informationError Numbers of the Standard Function Block
A.2.2 Numers of the Stndrd Funtion Blok evlution The result of the logi opertion RLO is set if n error ours while the stndrd funtion lok is eing proessed. This llows you to rnh to your own error evlution
More informationCS 340, Fall 2016 Sep 29th Exam 1 Note: in all questions, the special symbol ɛ (epsilon) is used to indicate the empty string.
CS 340, Fll 2016 Sep 29th Exm 1 Nme: Note: in ll questions, the speil symol ɛ (epsilon) is used to indite the empty string. Question 1. [10 points] Speify regulr expression tht genertes the lnguge over
More informationCS 551 Computer Graphics. Hidden Surface Elimination. Z-Buffering. Basic idea: Hidden Surface Removal
CS 55 Computer Grphis Hidden Surfe Removl Hidden Surfe Elimintion Ojet preision lgorithms: determine whih ojets re in front of others Uses the Pinter s lgorithm drw visile surfes from k (frthest) to front
More informationShould be done. Do Soon. Structure of a Typical Compiler. Plan for Today. Lab hours and Office hours. Quiz 1 is due tonight, was posted Tuesday night
Should e done L hours nd Office hours Sign up for the miling list t, strting to send importnt info to list http://groups.google.com/group/cs453-spring-2011 Red Ch 1 nd skim Ch 2 through 2.6, red 3.3 nd
More informationPresentation Martin Randers
Presenttion Mrtin Rnders Outline Introduction Algorithms Implementtion nd experiments Memory consumption Summry Introduction Introduction Evolution of species cn e modelled in trees Trees consist of nodes
More informationStack Manipulation. Other Issues. How about larger constants? Frame Pointer. PowerPC. Alternative Architectures
Other Issues Stck Mnipultion support for procedures (Refer to section 3.6), stcks, frmes, recursion mnipulting strings nd pointers linkers, loders, memory lyout Interrupts, exceptions, system clls nd conventions
More informationTight triangulations: a link between combinatorics and topology
Tight tringultions: link between ombintoris nd topology Jonthn Spreer Melbourne, August 15, 2016 Topologil mnifolds (Geometri) Topology is study of mnifolds (surfes) up to ontinuous deformtion Complited
More informationUnion-Find Problem. Using Arrays And Chains. A Set As A Tree. Result Of A Find Operation
Union-Find Problem Given set {,,, n} of n elements. Initilly ech element is in different set. ƒ {}, {},, {n} An intermixed sequence of union nd find opertions is performed. A union opertion combines two
More informationCOMP 423 lecture 11 Jan. 28, 2008
COMP 423 lecture 11 Jn. 28, 2008 Up to now, we hve looked t how some symols in n lphet occur more frequently thn others nd how we cn sve its y using code such tht the codewords for more frequently occuring
More informationIntroduction to Algebra
INTRODUCTORY ALGEBRA Mini-Leture 1.1 Introdution to Alger Evlute lgeri expressions y sustitution. Trnslte phrses to lgeri expressions. 1. Evlute the expressions when =, =, nd = 6. ) d) 5 10. Trnslte eh
More informationCSc 453. Compilers and Systems Software. 4 : Lexical Analysis II. Department of Computer Science University of Arizona
CSc 453 Compilers nd Systems Softwre 4 : Lexicl Anlysis II Deprtment of Computer Science University of Arizon collerg@gmil.com Copyright c 2009 Christin Collerg Implementing Automt NFAs nd DFAs cn e hrd-coded
More informationCan Pythagoras Swim?
Overview Ativity ID: 8939 Mth Conepts Mterils Students will investigte reltionships etween sides of right tringles to understnd the Pythgoren theorem nd then use it to solve prolems. Students will simplify
More informationCS201 Discussion 10 DRAWTREE + TRIES
CS201 Discussion 10 DRAWTREE + TRIES DrwTree First instinct: recursion As very generic structure, we could tckle this problem s follows: drw(): Find the root drw(root) drw(root): Write the line for the
More informationCS412/413. Introduction to Compilers Tim Teitelbaum. Lecture 4: Lexical Analyzers 28 Jan 08
CS412/413 Introduction to Compilers Tim Teitelum Lecture 4: Lexicl Anlyzers 28 Jn 08 Outline DFA stte minimiztion Lexicl nlyzers Automting lexicl nlysis Jlex lexicl nlyzer genertor CS 412/413 Spring 2008
More informationPLWAP Sequential Mining: Open Source Code
PL Sequentil Mining: Open Source Code C.I. Ezeife School of Computer Science University of Windsor Windsor, Ontrio N9B 3P4 cezeife@uwindsor.c Yi Lu Deprtment of Computer Science Wyne Stte University Detroit,
More information2 Computing all Intersections of a Set of Segments Line Segment Intersection
15-451/651: Design & Anlysis of Algorithms Novemer 14, 2016 Lecture #21 Sweep-Line nd Segment Intersection lst chnged: Novemer 8, 2017 1 Preliminries The sweep-line prdigm is very powerful lgorithmic design
More informationFrom Dependencies to Evaluation Strategies
From Dependencies to Evlution Strtegies Possile strtegies: 1 let the user define the evlution order 2 utomtic strtegy sed on the dependencies: use locl dependencies to determine which ttriutes to compute
More informationCS481: Bioinformatics Algorithms
CS481: Bioinformtics Algorithms Cn Alkn EA509 clkn@cs.ilkent.edu.tr http://www.cs.ilkent.edu.tr/~clkn/teching/cs481/ EXACT STRING MATCHING Fingerprint ide Assume: We cn compute fingerprint f(p) of P in
More informationFrom Indexing Data Structures to de Bruijn Graphs
From Indexing Dt Structures to de Bruijn Grphs Bstien Czux, Thierry Lecroq, Eric Rivls LIRMM & IBC, Montpellier - LITIS Rouen June 1, 201 Czux, Lecroq, Rivls (LIRMM) Generlized Suffix Tree & DBG June 1,
More informationUnit 5 Vocabulary. A function is a special relationship where each input has a single output.
MODULE 3 Terms Definition Picture/Exmple/Nottion 1 Function Nottion Function nottion is n efficient nd effective wy to write functions of ll types. This nottion llows you to identify the input vlue with
More information4452 Mathematical Modeling Lecture 4: Lagrange Multipliers
Mth Modeling Lecture 4: Lgrnge Multipliers Pge 4452 Mthemticl Modeling Lecture 4: Lgrnge Multipliers Lgrnge multipliers re high powered mthemticl technique to find the mximum nd minimum of multidimensionl
More informationOUTPUT DELIVERY SYSTEM
Differences in ODS formtting for HTML with Proc Print nd Proc Report Lur L. M. Thornton, USDA-ARS, Animl Improvement Progrms Lortory, Beltsville, MD ABSTRACT While Proc Print is terrific tool for dt checking
More informationA Tautology Checker loosely related to Stålmarck s Algorithm by Martin Richards
A Tutology Checker loosely relted to Stålmrck s Algorithm y Mrtin Richrds mr@cl.cm.c.uk http://www.cl.cm.c.uk/users/mr/ University Computer Lortory New Museum Site Pemroke Street Cmridge, CB2 3QG Mrtin
More informationQubit allocation for quantum circuit compilers
Quit lloction for quntum circuit compilers Nov. 10, 2017 JIQ 2017 Mrcos Yukio Sirichi Sylvin Collnge Vinícius Fernndes dos Sntos Fernndo Mgno Quintão Pereir Compilers for quntum computing The first genertion
More information[SYLWAN., 158(6)]. ISI
The proposl of Improved Inext Isomorphi Grph Algorithm to Detet Design Ptterns Afnn Slem B-Brhem, M. Rizwn Jmeel Qureshi Fulty of Computing nd Informtion Tehnology, King Adulziz University, Jeddh, SAUDI
More informationGraph theory Route problems
Bhelors thesis Grph theory Route prolems Author: Aolphe Nikwigize Dte: 986 - -5 Sujet: Mthemtis Level: First level (Bhelor) Course oe: MAE Astrt In this thesis we will review some route prolems whih re
More informationSMALL SIZE EDGE-FED SIERPINSKI CARPET MICROSTRIP PATCH ANTENNAS
Progress In Eletromgnetis Reserh C, Vol. 3, 195 22, 28 SMALL SIZE EDGE-FED SIERPINSKI CARPET MICROSTRIP PATCH ANTENNAS W.-L. Chen nd G.-M. Wng Rdr Engineering Deprtment Missile Institute of Air Fore Engineering
More informationTransparent neutral-element elimination in MPI reduction operations
Trnsprent neutrl-element elimintion in MPI reduction opertions Jesper Lrsson Träff Deprtment of Scientific Computing University of Vienn Disclimer Exploiting repetition nd sprsity in input for reducing
More informationFig.1. Let a source of monochromatic light be incident on a slit of finite width a, as shown in Fig. 1.
Answer on Question #5692, Physics, Optics Stte slient fetures of single slit Frunhofer diffrction pttern. The slit is verticl nd illuminted by point source. Also, obtin n expression for intensity distribution
More informationCS 432 Fall Mike Lam, Professor a (bc)* Regular Expressions and Finite Automata
CS 432 Fll 2017 Mike Lm, Professor (c)* Regulr Expressions nd Finite Automt Compiltion Current focus "Bck end" Source code Tokens Syntx tree Mchine code chr dt[20]; int min() { flot x = 42.0; return 7;
More informationMidterm Exam CSC October 2001
Midterm Exm CSC 173 23 Otoer 2001 Diretions This exm hs 8 questions, severl of whih hve suprts. Eh question indites its point vlue. The totl is 100 points. Questions 5() nd 6() re optionl; they re not
More informationSection 10.4 Hyperbolas
66 Section 10.4 Hyperbols Objective : Definition of hyperbol & hyperbols centered t (0, 0). The third type of conic we will study is the hyperbol. It is defined in the sme mnner tht we defined the prbol
More informationChapter 4 Fuzzy Graph and Relation
Chpter 4 Fuzzy Grph nd Reltion Grph nd Fuzzy Grph! Grph n G = (V, E) n V : Set of verties(node or element) n E : Set of edges An edge is pir (x, y) of verties in V.! Fuzzy Grph ~ n ( ~ G = V, E) n V :
More informationMcAfee Data Loss Prevention Prevent
Quik Strt Guide Revision B MAfee Dt Loss Prevention Prevent version 10.x This quik strt guide provides high-level instrutions for setting up MAfee Dt Loss Prevention Prevent (MAfee DLP Prevent) hrdwre
More informationIncremental Design Debugging in a Logic Synthesis Environment
Inrementl Design Deugging in Logi Synthesis Environment Andres Veneris Jing Brndon Liu University of Toronto Freesle Semiondutors Dept ECE nd CS High Performne Tools Group Toronto, ON M5S 3G4 Austin, TX
More informationMITSUBISHI ELECTRIC RESEARCH LABORATORIES Cambridge, Massachusetts. Introduction to Matroids and Applications. Srikumar Ramalingam
Cmrige, Msshusetts Introution to Mtrois n Applitions Srikumr Rmlingm MERL mm//yy Liner Alger (,0,0) (0,,0) Liner inepenene in vetors: v, v2,..., For ll non-trivil we hve s v s v n s, s2,..., s n 2v2...
More informationAgilent Mass Hunter Software
Agilent Mss Hunter Softwre Quick Strt Guide Use this guide to get strted with the Mss Hunter softwre. Wht is Mss Hunter Softwre? Mss Hunter is n integrl prt of Agilent TOF softwre (version A.02.00). Mss
More informationFASTEST METHOD TO FIND ALTERNATIVE RE-ROUTE
INTERNATIONAL JOURNAL OF RESEARCH IN COMPUTER APPLICATIONS AND ROBOTICS ISSN 2320-7345 FASTEST METHOD TO FIND ALTERNATIVE RE-ROUTE 1 M.JothiLkshmi, M.S., M.Phil. 2 C.Theeendr, M.S., M.Phil. 3 M.K.Pvithr,
More informationCSCI 104. Rafael Ferreira da Silva. Slides adapted from: Mark Redekopp and David Kempe
CSCI 0 fel Ferreir d Silv rfsilv@isi.edu Slides dpted from: Mrk edekopp nd Dvid Kempe LOG STUCTUED MEGE TEES Series Summtion eview Let n = + + + + k $ = #%& #. Wht is n? n = k+ - Wht is log () + log ()
More informationCOMBINATORIAL PATTERN MATCHING
COMBINATORIAL PATTERN MATCHING Genomic Repets Exmple of repets: ATGGTCTAGGTCCTAGTGGTC Motivtion to find them: Genomic rerrngements re often ssocited with repets Trce evolutionry secrets Mny tumors re chrcterized
More informationCompiling a Parallel DSL to GPU
Compiling Prllel DSL to GPU Rmesh Nrynswmy Bdri Gopln Synopsys In. Synopsys 2012 1 Agend Overview of Verilog Simultion Prllel Verilog Simultion Algorithms Prllel Simultion Trdeoffs on GPU Chllenges Synopsys
More information2-3 search trees red-black BSTs B-trees
2-3 serch trees red-lck BTs B-trees 3 2-3 tree llow 1 or 2 keys per node. 2-node: one key, two children. 3-node: two keys, three children. ymmetric order. Inorder trversl yields keys in scending order.
More informationReducing a DFA to a Minimal DFA
Lexicl Anlysis - Prt 4 Reducing DFA to Miniml DFA Input: DFA IN Assume DFA IN never gets stuck (dd ded stte if necessry) Output: DFA MIN An equivlent DFA with the minimum numer of sttes. Hrry H. Porter,
More informationInternet Routing. Reminder: Routing. CPSC Network Programming
PS 360 - Network Progrmming Internet Routing Mihele Weigle eprtment of omputer Siene lemson University mweigle@s.lemson.eu pril, 00 http://www.s.lemson.eu/~mweigle/ourses/ps360 Reminer: Routing Internet
More informationDistributed Systems Principles and Paradigms
Distriuted Systems Principles nd Prdigms Chpter 11 (version April 7, 2008) Mrten vn Steen Vrije Universiteit Amsterdm, Fculty of Science Dept. Mthemtics nd Computer Science Room R4.20. Tel: (020) 598 7784
More informationAgilent G3314AA BioConfirm Software
Agilent G3314AA BioConfirm Softwre Quik Strt Guide Use this guide to instll nd get strted with the BioConfirm softwre. Wht is BioConfirm Softwre? Agilent G3314AA BioConfirm Softwre lets you onfirm the
More information