Section 3.1: Sequences and Series
|
|
- Avice Chandler
- 5 years ago
- Views:
Transcription
1 Section.: Sequences d Series Sequences Let s strt out with the definition of sequence: sequence: ordered list of numbers, often with definite pttern Recll tht in set, order doesn t mtter so this is one wy tht sequence differs from set. Also, repetition doesn t mtter in set but does in sequence: if number is repeted in sequence, it isn t considered duplicte d cnot be removed without chging the sequence. Sequences, like sets, c be finite or infinite. If sequence is finite, then either the lst term or the number of terms must be specified so tht it s cler where the sequence stops. Which of the following sequences re infinite? Which re finite? ) 7,, 5, 9, b), 4, 9, 6, 5, 6, 00 c) 4,,,,,,, b) d c) re finite, becuse their lst terms re given. ), however, goes on forever so is infinite. To begin with, let s exmine some sequences in detil. We will begin by looking for ptterns in ech sequence. Wht is the pttern for the following sequences? Wht is the next term for ech sequence? ) 7,, 5, 9, b), 4, 9, 6, 5, 6, 00 c) 4,,,,,,,
2 d), 6,, 4, e), 6, 5, 4, ) The pttern is tht you dd 4 to the previous term to get the next term. The next term is then. b) The pttern is tht if you sy tht is the first term d 4 is the second term, then n will be the nth term. So the next term fter 6 is 49. c) The pttern is to divide ech term by two (or multiply by hlf) to get the next term. So the term fter /6 will be /. d) The pttern is to multiply ech term by to get the next term. The next term is then 48. e) The pttern is to subtrct 9 from the previous term, so the next one is. Note tht in this previous exmple, the lst two sequences looked very similr for three of their first four terms. However, the third term is different so the pttern for the two sequences is not the sme d subsequent terms could look very different. Nottion We will use the nottion n for the nth term in sequence, where n is the index. For exmple, the first term would then be, the second term, d so on. The index n, then, is positive integer (or nturl number, if you like). Other nottions my strt their counting with o being the first term. For the purposes of this course, we ll stick to strting t n =. Defining Sequence There re three wys to define sequence: ) List ll of the terms, or enough terms to set up the pttern. If the sequence is finite, then either the lst term or the number of terms must be given. ) Give generl formul for the nth term. ) Give recursive formul for the nth term. Let s look t exmples of ech type. For instce, the sequences 7,, 5, 9, d, 4, 9, 6, 5, 6, 00 re exmples of sequences defined by listing the terms.
3 Generl Formul A generl formul is formul tht gives n s function of n only. Let s look t the following exmples to exmine some sequences defined in this wy. Give the first four terms of the sequence given by the generl formul 4n. n = 4n +, so = 4 + = 7 = 4 + = = 4 + = 5 4 = = 9 The first four terms re then 7,, 5, d 9. This is the sme sequence tht ws given s prt ) in the first two exmples of this section. n Give ll terms of the sequence given by the formul n for n5. This is finite sequence, since restrictions hve been plced on the vlues of n. The terms re then:
4 You c see from the previous exmples tht the generl formul llows you to clculte n for y vlue of n. The very useful thing bout the generl formul is tht you don t need to know the previous term to clculte prticulr term. For instce, if you wt to know the 50 th term of the sequence 7,, 5, 9,, you c determine tht the pttern is to dd 4 to the previous term to get the next term. However, to get the 50 th term, you d hve to clculte the 49 th first, but the 49 th requires the 48 th, d so on. But if you insted use the expression 4n, which gives the sme sequence, then the 50 th term is just 50 4n d there s no need to clculte preceding terms. Hdy! Recursive Definition A recursive formul gives formul for the next term in terms of the previous one. For exmple, in our old friend 7,, 5, 9,, the next term is found by dding 4 to the previous term: 4. However, tht s not enough informtion to uniquely define the series becuse you don t know where to strt. A complete definition must include the first term lso. Therefore, the recursive definition for our old friend 7,, 5, 9, would be 7 Recursive definitions, then, must specify the first term or terms d lso the rule which llows you to clculte the next term from the previous term or terms. 4 Clculte the first four terms of the sequence given by 0 The first term is lredy given,. Then
5 Give recursive formul for the sequence, 6, 8, 54, The pttern is tht the next term equls the previous term times three. Therefore, Recursive definitions hve the sme drwbck tht we ve seen before: if we wt to know the 00 th term, we need to clculte the 99 th first, d so on. Only the generl formul llows us to clculte ech term directly without knowing the previous one. Fiboncci sequence The Fiboncci sequence is the most fmous exmple of recursive sequence:,,,, 5, 8,, The pttern c be quite difficult to spot you get the next term from the sum of the two previous terms. The recursive formul for this sequence is therefore n n n Here, the first two terms must be given to strt off with so tht you re then ble to clculte the third term from the previous two. Series A series is the sum of sequence, which c be finite or infinite. Here re two exmples: ) b) Nottion The sum of the first n terms of sequence is denoted by S n (lso sometimes clled the nth prtil sum). If the series is finite, it could be the sum of ll of the terms. S is how we write the sum of infinite series, like the second exmple bove.
6 For the series , clculte S d S 4. S = = 60 S 4 = = 88 However, it s esy to see tht this method becomes very cumbersome for lrge vlues of n. We ll develop some more efficient methods in the next two sections. Sigm nottion It s esy to tke sequence in list form d trsform it into series by chging ll of the comms to + signs. However, wht if you re given the generl formul insted? For exmple, let s tke 7,, 5, 9, which we know to be 4n. Since the generl form is so useful for finding n when n is lrge, it would be nice if we could retin tht informtion while writing our sum. To do so, we ll introduce new nottion clled sigm nottion. It uses the Greek letter sigm (the uppercse one): Σ, which is commonly used to me sum of. Let s look t exmple of sigm nottion d discuss wht ll of the prts me. Consider the following 5 i (4i ) The letter i is index here, d it runs from the vlue given t the bottom of the sigm to the number t the top of the sigm in steps of. Here, i runs from to 5. We re summing, then, the vlue of 4i + for ech vlue of i s it runs from to 5: 5 i Let s look t more exmples. i i i i4 i5 (4i )
7 Clculte i (i 5) i i i i (i 5) Clculte 8 j 9 j6 9 j6 j 6 j 7 j 8 j 9 8 j Clculte 6 k 6 j k k k 4 k 5 k 6 5 The tricky thing bout the lst one is deciding how my terms there re. You my, s is shown bove, write out ll of the possible vlues of the index. Or you my use the following nifty rule:
8 # terms = lst first + For instce, the lst exmple hd the index running from to 6. The number of terms, then, for tht series is 6 + = 5. Write the following series in sigm nottion: Let s pick our index first. If we wt to be lzy, insted of strting our index t, we could strt t d our series would be 0 k Other cceptble swers would involve chging our strting point for the index 9 to give j or i or even l 55 j fvourite number. 8 i0 k 65 l57 if 57 hppens to be your Write the following sequence in sigm nottion: j To write infinite series in sigm nottion, you just replce the finl vlue of the index with. j
Section 3.1: Sequences and Series
Sectio 3.: Sequeces d Series Sequeces Let s strt out with the defiitio of sequece: sequece: ordered list of umbers, ofte with defiite ptter Recll tht i set, order does t mtter so this is oe wy tht sequece
More informationSubtracting Fractions
Lerning Enhncement Tem Model Answers: Adding nd Subtrcting Frctions Adding nd Subtrcting Frctions study guide. When the frctions both hve the sme denomintor (bottom) you cn do them using just simple dding
More informationCS201 Discussion 10 DRAWTREE + TRIES
CS201 Discussion 10 DRAWTREE + TRIES DrwTree First instinct: recursion As very generic structure, we could tckle this problem s follows: drw(): Find the root drw(root) drw(root): Write the line for the
More informationCOMP 423 lecture 11 Jan. 28, 2008
COMP 423 lecture 11 Jn. 28, 2008 Up to now, we hve looked t how some symols in n lphet occur more frequently thn others nd how we cn sve its y using code such tht the codewords for more frequently occuring
More informationRay surface intersections
Ry surfce intersections Some primitives Finite primitives: polygons spheres, cylinders, cones prts of generl qudrics Infinite primitives: plnes infinite cylinders nd cones generl qudrics A finite primitive
More informationUnit #9 : Definite Integral Properties, Fundamental Theorem of Calculus
Unit #9 : Definite Integrl Properties, Fundmentl Theorem of Clculus Gols: Identify properties of definite integrls Define odd nd even functions, nd reltionship to integrl vlues Introduce the Fundmentl
More informationSIMPLIFYING ALGEBRA PASSPORT.
SIMPLIFYING ALGEBRA PASSPORT www.mthletics.com.u This booklet is ll bout turning complex problems into something simple. You will be ble to do something like this! ( 9- # + 4 ' ) ' ( 9- + 7-) ' ' Give
More informationIntegration. October 25, 2016
Integrtion October 5, 6 Introduction We hve lerned in previous chpter on how to do the differentition. It is conventionl in mthemtics tht we re supposed to lern bout the integrtion s well. As you my hve
More informationIntroduction to Integration
Introduction to Integrtion Definite integrls of piecewise constnt functions A constnt function is function of the form Integrtion is two things t the sme time: A form of summtion. The opposite of differentition.
More information10.5 Graphing Quadratic Functions
0.5 Grphing Qudrtic Functions Now tht we cn solve qudrtic equtions, we wnt to lern how to grph the function ssocited with the qudrtic eqution. We cll this the qudrtic function. Grphs of Qudrtic Functions
More information3.5.1 Single slit diffraction
3..1 Single slit diffrction ves pssing through single slit will lso diffrct nd produce n interference pttern. The reson for this is to do with the finite width of the slit. e will consider this lter. Tke
More information3.5.1 Single slit diffraction
3.5.1 Single slit diffrction Wves pssing through single slit will lso diffrct nd produce n interference pttern. The reson for this is to do with the finite width of the slit. We will consider this lter.
More informationUnit 5 Vocabulary. A function is a special relationship where each input has a single output.
MODULE 3 Terms Definition Picture/Exmple/Nottion 1 Function Nottion Function nottion is n efficient nd effective wy to write functions of ll types. This nottion llows you to identify the input vlue with
More informationIntegration. September 28, 2017
Integrtion September 8, 7 Introduction We hve lerned in previous chpter on how to do the differentition. It is conventionl in mthemtics tht we re supposed to lern bout the integrtion s well. As you my
More informationSection 10.4 Hyperbolas
66 Section 10.4 Hyperbols Objective : Definition of hyperbol & hyperbols centered t (0, 0). The third type of conic we will study is the hyperbol. It is defined in the sme mnner tht we defined the prbol
More information12-B FRACTIONS AND DECIMALS
-B Frctions nd Decimls. () If ll four integers were negtive, their product would be positive, nd so could not equl one of them. If ll four integers were positive, their product would be much greter thn
More informationWhat do all those bits mean now? Number Systems and Arithmetic. Introduction to Binary Numbers. Questions About Numbers
Wht do ll those bits men now? bits (...) Number Systems nd Arithmetic or Computers go to elementry school instruction R-formt I-formt... integer dt number text chrs... floting point signed unsigned single
More information50 AMC LECTURES Lecture 2 Analytic Geometry Distance and Lines. can be calculated by the following formula:
5 AMC LECTURES Lecture Anlytic Geometry Distnce nd Lines BASIC KNOWLEDGE. Distnce formul The distnce (d) between two points P ( x, y) nd P ( x, y) cn be clculted by the following formul: d ( x y () x )
More informationSection 3.2: Arithmetic Sequences and Series
Sectio 3.: Arithmetic Sequeces Series Arithmetic Sequeces Let s strt out with efiitio: rithmetic sequece: sequece i which the ext term is fou by ig costt (the commo ifferece ) to the previous term Here
More informationEngineer To Engineer Note
Engineer To Engineer Note EE-186 Technicl Notes on using Anlog Devices' DSP components nd development tools Contct our technicl support by phone: (800) ANALOG-D or e-mil: dsp.support@nlog.com Or visit
More informationsuch that the S i cover S, or equivalently S
MATH 55 Triple Integrls Fll 16 1. Definition Given solid in spce, prtition of consists of finite set of solis = { 1,, n } such tht the i cover, or equivlently n i. Furthermore, for ech i, intersects i
More informationIn the last lecture, we discussed how valid tokens may be specified by regular expressions.
LECTURE 5 Scnning SYNTAX ANALYSIS We know from our previous lectures tht the process of verifying the syntx of the progrm is performed in two stges: Scnning: Identifying nd verifying tokens in progrm.
More informationa < a+ x < a+2 x < < a+n x = b, n A i n f(x i ) x. i=1 i=1
Mth 33 Volume Stewrt 5.2 Geometry of integrls. In this section, we will lern how to compute volumes using integrls defined by slice nlysis. First, we recll from Clculus I how to compute res. Given the
More informationMATH 25 CLASS 5 NOTES, SEP
MATH 25 CLASS 5 NOTES, SEP 30 2011 Contents 1. A brief diversion: reltively prime numbers 1 2. Lest common multiples 3 3. Finding ll solutions to x + by = c 4 Quick links to definitions/theorems Euclid
More informationSOME EXAMPLES OF SUBDIVISION OF SMALL CATEGORIES
SOME EXAMPLES OF SUBDIVISION OF SMALL CATEGORIES MARCELLO DELGADO Abstrct. The purpose of this pper is to build up the bsic conceptul frmework nd underlying motivtions tht will llow us to understnd ctegoricl
More informationLists in Lisp and Scheme
Lists in Lisp nd Scheme Lists in Lisp nd Scheme Lists re Lisp s fundmentl dt structures, ut there re others Arrys, chrcters, strings, etc. Common Lisp hs moved on from eing merely LISt Processor However,
More informationCSCI 3130: Formal Languages and Automata Theory Lecture 12 The Chinese University of Hong Kong, Fall 2011
CSCI 3130: Forml Lnguges nd utomt Theory Lecture 12 The Chinese University of Hong Kong, Fll 2011 ndrej Bogdnov In progrmming lnguges, uilding prse trees is significnt tsk ecuse prse trees tell us the
More informationMIPS I/O and Interrupt
MIPS I/O nd Interrupt Review Floting point instructions re crried out on seprte chip clled coprocessor 1 You hve to move dt to/from coprocessor 1 to do most common opertions such s printing, clling functions,
More information6.2 Volumes of Revolution: The Disk Method
mth ppliction: volumes by disks: volume prt ii 6 6 Volumes of Revolution: The Disk Method One of the simplest pplictions of integrtion (Theorem 6) nd the ccumultion process is to determine so-clled volumes
More informationAnswer Key Lesson 6: Workshop: Angles and Lines
nswer Key esson 6: tudent Guide ngles nd ines Questions 1 3 (G p. 406) 1. 120 ; 360 2. hey re the sme. 3. 360 Here re four different ptterns tht re used to mke quilts. Work with your group. se your Power
More informationMatrices and Systems of Equations
Mtrices Mtrices nd Sstems of Equtions A mtri is rectngulr rr of rel numbers. CHAT Pre-Clculus Section 8. m m m............ n n n mn We will use the double subscript nottion for ech element of the mtri.
More informationA Tautology Checker loosely related to Stålmarck s Algorithm by Martin Richards
A Tutology Checker loosely relted to Stålmrck s Algorithm y Mrtin Richrds mr@cl.cm.c.uk http://www.cl.cm.c.uk/users/mr/ University Computer Lortory New Museum Site Pemroke Street Cmridge, CB2 3QG Mrtin
More informationCS 241 Week 4 Tutorial Solutions
CS 4 Week 4 Tutoril Solutions Writing n Assemler, Prt & Regulr Lnguges Prt Winter 8 Assemling instrutions utomtilly. slt $d, $s, $t. Solution: $d, $s, nd $t ll fit in -it signed integers sine they re 5-it
More informationIf f(x, y) is a surface that lies above r(t), we can think about the area between the surface and the curve.
Line Integrls The ide of line integrl is very similr to tht of single integrls. If the function f(x) is bove the x-xis on the intervl [, b], then the integrl of f(x) over [, b] is the re under f over the
More informationEECS 281: Homework #4 Due: Thursday, October 7, 2004
EECS 28: Homework #4 Due: Thursdy, October 7, 24 Nme: Emil:. Convert the 24-bit number x44243 to mime bse64: QUJD First, set is to brek 8-bit blocks into 6-bit blocks, nd then convert: x44243 b b 6 2 9
More informationSimplifying Algebra. Simplifying Algebra. Curriculum Ready.
Simplifying Alger Curriculum Redy www.mthletics.com This ooklet is ll out turning complex prolems into something simple. You will e le to do something like this! ( 9- # + 4 ' ) ' ( 9- + 7-) ' ' Give this
More informationECE 468/573 Midterm 1 September 28, 2012
ECE 468/573 Midterm 1 September 28, 2012 Nme:! Purdue emil:! Plese sign the following: I ffirm tht the nswers given on this test re mine nd mine lone. I did not receive help from ny person or mteril (other
More informationDefinition of Regular Expression
Definition of Regulr Expression After the definition of the string nd lnguges, we re redy to descrie regulr expressions, the nottion we shll use to define the clss of lnguges known s regulr sets. Recll
More information9.1 apply the distance and midpoint formulas
9.1 pply the distnce nd midpoint formuls DISTANCE FORMULA MIDPOINT FORMULA To find the midpoint between two points x, y nd x y 1 1,, we Exmple 1: Find the distnce between the two points. Then, find the
More informationINTRODUCTION TO SIMPLICIAL COMPLEXES
INTRODUCTION TO SIMPLICIAL COMPLEXES CASEY KELLEHER AND ALESSANDRA PANTANO 0.1. Introduction. In this ctivity set we re going to introduce notion from Algebric Topology clled simplicil homology. The min
More informationRepresentation of Numbers. Number Representation. Representation of Numbers. 32-bit Unsigned Integers 3/24/2014. Fixed point Integer Representation
Representtion of Numbers Number Representtion Computer represent ll numbers, other thn integers nd some frctions with imprecision. Numbers re stored in some pproximtion which cn be represented by fixed
More informationRational Numbers---Adding Fractions With Like Denominators.
Rtionl Numbers---Adding Frctions With Like Denomintors. A. In Words: To dd frctions with like denomintors, dd the numertors nd write the sum over the sme denomintor. B. In Symbols: For frctions c nd b
More informationThe Fundamental Theorem of Calculus
MATH 6 The Fundmentl Theorem of Clculus The Fundmentl Theorem of Clculus (FTC) gives method of finding the signed re etween the grph of f nd the x-xis on the intervl [, ]. The theorem is: FTC: If f is
More informationImproper Integrals. October 4, 2017
Improper Integrls October 4, 7 Introduction We hve seen how to clculte definite integrl when the it is rel number. However, there re times when we re interested to compute the integrl sy for emple 3. Here
More information2014 Haskell January Test Regular Expressions and Finite Automata
0 Hskell Jnury Test Regulr Expressions nd Finite Automt This test comprises four prts nd the mximum mrk is 5. Prts I, II nd III re worth 3 of the 5 mrks vilble. The 0 Hskell Progrmming Prize will be wrded
More informationMA1008. Calculus and Linear Algebra for Engineers. Course Notes for Section B. Stephen Wills. Department of Mathematics. University College Cork
MA1008 Clculus nd Liner Algebr for Engineers Course Notes for Section B Stephen Wills Deprtment of Mthemtics University College Cork s.wills@ucc.ie http://euclid.ucc.ie/pges/stff/wills/teching/m1008/ma1008.html
More informationPhysics 152. Diffraction. Difrraction Gratings. Announcements. Friday, February 2, 2007
ics Fri Feb.02. Announcements Diffrction Difrrction Grtings Fridy, Februry 2, 2007 Help sessions: W 9-10 pm in NSC 118 Msteringics WU #5 due Mondy WU #6 due Wednesdy http://www.voltnet.com/ldder/ A bem
More informationZZ - Advanced Math Review 2017
ZZ - Advnced Mth Review Mtrix Multipliction Given! nd! find the sum of the elements of the product BA First, rewrite the mtrices in the correct order to multiply The product is BA hs order x since B is
More informationCS280 HW1 Solution Set Spring2002. now, we need to get rid of the n term. We know that:
CS80 HW Solutio Set Sprig00 Solutios by: Shddi Doghmi -) -) 4 * 4 4 4 ) 4 b-) ) ) ) * ) ) ) 0 ) c-) ) ) ) ) ) ow we eed to get rid of the term. We ow tht: ) ) ) ) substitute ito the recursive epressio:
More informationCOMBINATORIAL PATTERN MATCHING
COMBINATORIAL PATTERN MATCHING Genomic Repets Exmple of repets: ATGGTCTAGGTCCTAGTGGTC Motivtion to find them: Genomic rerrngements re often ssocited with repets Trce evolutionry secrets Mny tumors re chrcterized
More informationbinary trees, expression trees
COMP 250 Lecture 21 binry trees, expression trees Oct. 27, 2017 1 Binry tree: ech node hs t most two children. 2 Mximum number of nodes in binry tree? Height h (e.g. 3) 3 Mximum number of nodes in binry
More informationDr. D.M. Akbar Hussain
Dr. D.M. Akr Hussin Lexicl Anlysis. Bsic Ide: Red the source code nd generte tokens, it is similr wht humns will do to red in; just tking on the input nd reking it down in pieces. Ech token is sequence
More informationStudy Guide for Exam 3
Mth 05 Elementry Algebr Fll 00 Study Guide for Em Em is scheduled for Thursdy, November 8 th nd ill cover chpters 5 nd. You my use "5" note crd (both sides) nd scientific clcultor. You re epected to no
More informationDynamic Programming. Andreas Klappenecker. [partially based on slides by Prof. Welch] Monday, September 24, 2012
Dynmic Progrmming Andres Klppenecker [prtilly bsed on slides by Prof. Welch] 1 Dynmic Progrmming Optiml substructure An optiml solution to the problem contins within it optiml solutions to subproblems.
More informationFig.25: the Role of LEX
The Lnguge for Specifying Lexicl Anlyzer We shll now study how to uild lexicl nlyzer from specifiction of tokens in the form of list of regulr expressions The discussion centers round the design of n existing
More informationMATH 2530: WORKSHEET 7. x 2 y dz dy dx =
MATH 253: WORKSHT 7 () Wrm-up: () Review: polr coordintes, integrls involving polr coordintes, triple Riemnn sums, triple integrls, the pplictions of triple integrls (especilly to volume), nd cylindricl
More informationFig.1. Let a source of monochromatic light be incident on a slit of finite width a, as shown in Fig. 1.
Answer on Question #5692, Physics, Optics Stte slient fetures of single slit Frunhofer diffrction pttern. The slit is verticl nd illuminted by point source. Also, obtin n expression for intensity distribution
More information2 Computing all Intersections of a Set of Segments Line Segment Intersection
15-451/651: Design & Anlysis of Algorithms Novemer 14, 2016 Lecture #21 Sweep-Line nd Segment Intersection lst chnged: Novemer 8, 2017 1 Preliminries The sweep-line prdigm is very powerful lgorithmic design
More informationWhat are suffix trees?
Suffix Trees 1 Wht re suffix trees? Allow lgorithm designers to store very lrge mount of informtion out strings while still keeping within liner spce Allow users to serch for new strings in the originl
More informationMisrepresentation of Preferences
Misrepresenttion of Preferences Gicomo Bonnno Deprtment of Economics, University of Cliforni, Dvis, USA gfbonnno@ucdvis.edu Socil choice functions Arrow s theorem sys tht it is not possible to extrct from
More informationStained Glass Design. Teaching Goals:
Stined Glss Design Time required 45-90 minutes Teching Gols: 1. Students pply grphic methods to design vrious shpes on the plne.. Students pply geometric trnsformtions of grphs of functions in order to
More informationMid-term exam. Scores. Fall term 2012 KAIST EE209 Programming Structures for EE. Thursday Oct 25, Student's name: Student ID:
Fll term 2012 KAIST EE209 Progrmming Structures for EE Mid-term exm Thursdy Oct 25, 2012 Student's nme: Student ID: The exm is closed book nd notes. Red the questions crefully nd focus your nswers on wht
More information1 Quad-Edge Construction Operators
CS48: Computer Grphics Hndout # Geometric Modeling Originl Hndout #5 Stnford University Tuesdy, 8 December 99 Originl Lecture #5: 9 November 99 Topics: Mnipultions with Qud-Edge Dt Structures Scribe: Mike
More informationMath 142, Exam 1 Information.
Mth 14, Exm 1 Informtion. 9/14/10, LC 41, 9:30-10:45. Exm 1 will be bsed on: Sections 7.1-7.5. The corresponding ssigned homework problems (see http://www.mth.sc.edu/ boyln/sccourses/14f10/14.html) At
More informationa(e, x) = x. Diagrammatically, this is encoded as the following commutative diagrams / X
4. Mon, Sept. 30 Lst time, we defined the quotient topology coming from continuous surjection q : X! Y. Recll tht q is quotient mp (nd Y hs the quotient topology) if V Y is open precisely when q (V ) X
More informationCOMPUTATIONAL INTELLIGENCE
COMPUTATIONAL INTELLIGENCE LABORATORY CLASSES Immentton smplstc verson of the network for some nference resons Adrn Horzyk IMPLEMENTATION OF THE SIMPLISTIC OR AANG Imment the smplstc verson of n structure
More informationGeometric transformations
Geometric trnsformtions Computer Grphics Some slides re bsed on Shy Shlom slides from TAU mn n n m m T A,,,,,, 2 1 2 22 12 1 21 11 Rows become columns nd columns become rows nm n n m m A,,,,,, 1 1 2 22
More informationCS321 Languages and Compiler Design I. Winter 2012 Lecture 5
CS321 Lnguges nd Compiler Design I Winter 2012 Lecture 5 1 FINITE AUTOMATA A non-deterministic finite utomton (NFA) consists of: An input lphet Σ, e.g. Σ =,. A set of sttes S, e.g. S = {1, 3, 5, 7, 11,
More informationCS481: Bioinformatics Algorithms
CS481: Bioinformtics Algorithms Cn Alkn EA509 clkn@cs.ilkent.edu.tr http://www.cs.ilkent.edu.tr/~clkn/teching/cs481/ EXACT STRING MATCHING Fingerprint ide Assume: We cn compute fingerprint f(p) of P in
More informationLecture 7: Integration Techniques
Lecture 7: Integrtion Techniques Antiderivtives nd Indefinite Integrls. In differentil clculus, we were interested in the derivtive of given rel-vlued function, whether it ws lgeric, eponentil or logrithmic.
More informationVery sad code. Abstraction, List, & Cons. CS61A Lecture 7. Happier Code. Goals. Constructors. Constructors 6/29/2011. Selectors.
6/9/ Abstrction, List, & Cons CS6A Lecture 7-6-9 Colleen Lewis Very sd code (define (totl hnd) (if (empty? hnd) (+ (butlst (lst hnd)) (totl (butlst hnd))))) STk> (totl (h c d)) 7 STk> (totl (h ks d)) ;;;EEEK!
More informationCS311H: Discrete Mathematics. Graph Theory IV. A Non-planar Graph. Regions of a Planar Graph. Euler s Formula. Instructor: Işıl Dillig
CS311H: Discrete Mthemtics Grph Theory IV Instructor: Işıl Dillig Instructor: Işıl Dillig, CS311H: Discrete Mthemtics Grph Theory IV 1/25 A Non-plnr Grph Regions of Plnr Grph The plnr representtion of
More informationBefore We Begin. Introduction to Spatial Domain Filtering. Introduction to Digital Image Processing. Overview (1): Administrative Details (1):
Overview (): Before We Begin Administrtive detils Review some questions to consider Winter 2006 Imge Enhncement in the Sptil Domin: Bsics of Sptil Filtering, Smoothing Sptil Filters, Order Sttistics Filters
More informationHomework. Context Free Languages III. Languages. Plan for today. Context Free Languages. CFLs and Regular Languages. Homework #5 (due 10/22)
Homework Context Free Lnguges III Prse Trees nd Homework #5 (due 10/22) From textbook 6.4,b 6.5b 6.9b,c 6.13 6.22 Pln for tody Context Free Lnguges Next clss of lnguges in our quest! Lnguges Recll. Wht
More information1. SEQUENCES INVOLVING EXPONENTIAL GROWTH (GEOMETRIC SEQUENCES)
Numbers nd Opertions, Algebr, nd Functions 45. SEQUENCES INVOLVING EXPONENTIAL GROWTH (GEOMETRIC SEQUENCES) In sequence of terms involving eponentil growth, which the testing service lso clls geometric
More informationAngle Properties in Polygons. Part 1 Interior Angles
2.4 Angle Properties in Polygons YOU WILL NEED dynmic geometry softwre OR protrctor nd ruler EXPLORE A pentgon hs three right ngles nd four sides of equl length, s shown. Wht is the sum of the mesures
More informationMTH 146 Conics Supplement
105- Review of Conics MTH 146 Conics Supplement In this section we review conics If ou ne more detils thn re present in the notes, r through section 105 of the ook Definition: A prol is the set of points
More informationMath 464 Fall 2012 Notes on Marginal and Conditional Densities October 18, 2012
Mth 464 Fll 2012 Notes on Mrginl nd Conditionl Densities klin@mth.rizon.edu October 18, 2012 Mrginl densities. Suppose you hve 3 continuous rndom vribles X, Y, nd Z, with joint density f(x,y,z. The mrginl
More informationP(r)dr = probability of generating a random number in the interval dr near r. For this probability idea to make sense we must have
Rndom Numers nd Monte Crlo Methods Rndom Numer Methods The integrtion methods discussed so fr ll re sed upon mking polynomil pproximtions to the integrnd. Another clss of numericl methods relies upon using
More informationASTs, Regex, Parsing, and Pretty Printing
ASTs, Regex, Prsing, nd Pretty Printing CS 2112 Fll 2016 1 Algeric Expressions To strt, consider integer rithmetic. Suppose we hve the following 1. The lphet we will use is the digits {0, 1, 2, 3, 4, 5,
More informationTO REGULAR EXPRESSIONS
Suject :- Computer Science Course Nme :- Theory Of Computtion DA TO REGULAR EXPRESSIONS Report Sumitted y:- Ajy Singh Meen 07000505 jysmeen@cse.iit.c.in BASIC DEINITIONS DA:- A finite stte mchine where
More informationToday. Search Problems. Uninformed Search Methods. Depth-First Search Breadth-First Search Uniform-Cost Search
Uninformed Serch [These slides were creted by Dn Klein nd Pieter Abbeel for CS188 Intro to AI t UC Berkeley. All CS188 mterils re vilble t http://i.berkeley.edu.] Tody Serch Problems Uninformed Serch Methods
More informationQuestions About Numbers. Number Systems and Arithmetic. Introduction to Binary Numbers. Negative Numbers?
Questions About Numbers Number Systems nd Arithmetic or Computers go to elementry school How do you represent negtive numbers? frctions? relly lrge numbers? relly smll numbers? How do you do rithmetic?
More information. (b) Evaluate the sum given by. Exercise #1: A sequence is defined by the equation a n 2n
Nme: 453 Dte: SEQUENCES ALGEBRA WITH TRIGONOMETRY Sequeces, or ordered list of umbers, re extremely importt i mthemtics, both theoreticl d pplied A sequece is formlly defied s fuctio tht hs s its domi
More information9 4. CISC - Curriculum & Instruction Steering Committee. California County Superintendents Educational Services Association
9. CISC - Curriculum & Instruction Steering Committee The Winning EQUATION A HIGH QUALITY MATHEMATICS PROFESSIONAL DEVELOPMENT PROGRAM FOR TEACHERS IN GRADES THROUGH ALGEBRA II STRAND: NUMBER SENSE: Rtionl
More informationWhat do all those bits mean now? Number Systems and Arithmetic. Introduction to Binary Numbers. Questions About Numbers
Wht do ll those bits men now? bits (...) Number Systems nd Arithmetic or Computers go to elementry school instruction R-formt I-formt... integer dt number text chrs... floting point signed unsigned single
More informationFall 2017 Midterm Exam 1 October 19, You may not use any books, notes, or electronic devices during this exam.
15-112 Fll 2017 Midterm Exm 1 October 19, 2017 Nme: Andrew ID: Recittion Section: You my not use ny books, notes, or electronic devices during this exm. You my not sk questions bout the exm except for
More informationΕΠΛ323 - Θεωρία και Πρακτική Μεταγλωττιστών
ΕΠΛ323 - Θωρία και Πρακτική Μταγλωττιστών Lecture 3 Lexicl Anlysis Elis Athnsopoulos elisthn@cs.ucy.c.cy Recognition of Tokens if expressions nd reltionl opertors if è if then è then else è else relop
More information4452 Mathematical Modeling Lecture 4: Lagrange Multipliers
Mth Modeling Lecture 4: Lgrnge Multipliers Pge 4452 Mthemticl Modeling Lecture 4: Lgrnge Multipliers Lgrnge multipliers re high powered mthemticl technique to find the mximum nd minimum of multidimensionl
More information6.3 Volumes. Just as area is always positive, so is volume and our attitudes towards finding it.
6.3 Volumes Just s re is lwys positive, so is volume nd our ttitudes towrds finding it. Let s review how to find the volume of regulr geometric prism, tht is, 3-dimensionl oject with two regulr fces seprted
More informationGraphs with at most two trees in a forest building process
Grphs with t most two trees in forest uilding process rxiv:802.0533v [mth.co] 4 Fe 208 Steve Butler Mis Hmnk Mrie Hrdt Astrct Given grph, we cn form spnning forest y first sorting the edges in some order,
More informationCOMPUTER SCIENCE 123. Foundations of Computer Science. 6. Tuples
COMPUTER SCIENCE 123 Foundtions of Computer Science 6. Tuples Summry: This lecture introduces tuples in Hskell. Reference: Thompson Sections 5.1 2 R.L. While, 2000 3 Tuples Most dt comes with structure
More informationSolutions to Math 41 Final Exam December 12, 2011
Solutions to Mth Finl Em December,. ( points) Find ech of the following its, with justifiction. If there is n infinite it, then eplin whether it is or. ( ) / ln() () (5 points) First we compute the it:
More informationCreating Flexible Interfaces. Friday, 24 April 2015
Creting Flexible Interfces 1 Requests, not Objects Domin objects re esy to find but they re not t the design center of your ppliction. Insted, they re trp for the unwry. Sequence digrms re vehicle for
More informationIf you are at the university, either physically or via the VPN, you can download the chapters of this book as PDFs.
Lecture 5 Wlks, Trils, Pths nd Connectedness Reding: Some of the mteril in this lecture comes from Section 1.2 of Dieter Jungnickel (2008), Grphs, Networks nd Algorithms, 3rd edition, which is ville online
More informationAn Efficient Divide and Conquer Algorithm for Exact Hazard Free Logic Minimization
An Efficient Divide nd Conquer Algorithm for Exct Hzrd Free Logic Minimiztion J.W.J.M. Rutten, M.R.C.M. Berkelr, C.A.J. vn Eijk, M.A.J. Kolsteren Eindhoven University of Technology Informtion nd Communiction
More informationIntermediate Information Structures
CPSC 335 Intermedite Informtion Structures LECTURE 13 Suffix Trees Jon Rokne Computer Science University of Clgry Cnd Modified from CMSC 423 - Todd Trengen UMD upd Preprocessing Strings We will look t
More informationQuiz2 45mins. Personal Number: Problem 1. (20pts) Here is an Table of Perl Regular Ex
Long Quiz2 45mins Nme: Personl Numer: Prolem. (20pts) Here is n Tle of Perl Regulr Ex Chrcter Description. single chrcter \s whitespce chrcter (spce, t, newline) \S non-whitespce chrcter \d digit (0-9)
More informationCS143 Handout 07 Summer 2011 June 24 th, 2011 Written Set 1: Lexical Analysis
CS143 Hndout 07 Summer 2011 June 24 th, 2011 Written Set 1: Lexicl Anlysis In this first written ssignment, you'll get the chnce to ply round with the vrious constructions tht come up when doing lexicl
More informationFall 2018 Midterm 1 October 11, ˆ You may not ask questions about the exam except for language clarifications.
15-112 Fll 2018 Midterm 1 October 11, 2018 Nme: Andrew ID: Recittion Section: ˆ You my not use ny books, notes, extr pper, or electronic devices during this exm. There should be nothing on your desk or
More information